Homologs in group_1714

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11615 FBDBKF_11615 100.0 Morganella morganii S1 zipA cell division protein ZipA
EHELCC_17535 EHELCC_17535 100.0 Morganella morganii S2 zipA cell division protein ZipA
NLDBIP_18745 NLDBIP_18745 100.0 Morganella morganii S4 zipA cell division protein ZipA
LHKJJB_17975 LHKJJB_17975 100.0 Morganella morganii S3 zipA cell division protein ZipA
F4V73_RS08065 F4V73_RS08065 79.0 Morganella psychrotolerans zipA cell division protein ZipA
PMI_RS09005 PMI_RS09005 58.0 Proteus mirabilis HI4320 zipA cell division protein ZipA

Distribution of the homologs in the orthogroup group_1714

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1714

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8GHF3 5.58e-93 282 50 7 332 3 zipA Cell division protein ZipA Serratia proteamaculans (strain 568)
B1JFY9 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668M5 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMG5 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pestis (strain Pestoides F)
Q1CJV8 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH1 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Angola)
P58492 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pestis
B2K918 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5X8 1.91e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGC1 1.93e-92 281 47 7 343 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VE39 4.66e-92 279 50 6 329 3 zipA Cell division protein ZipA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6D8S6 1.18e-91 279 48 8 349 3 zipA Cell division protein ZipA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NSC1 1.32e-90 276 49 8 340 3 zipA Cell division protein ZipA Sodalis glossinidius (strain morsitans)
C6D9P6 1.2e-86 266 46 7 350 3 zipA Cell division protein ZipA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7N6Y5 2.14e-85 262 51 8 329 3 zipA Cell division protein ZipA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4WD24 9.74e-76 238 42 5 328 3 zipA Cell division protein ZipA Enterobacter sp. (strain 638)
A7MKW3 1.23e-75 238 48 6 323 3 zipA Cell division protein ZipA Cronobacter sakazakii (strain ATCC BAA-894)
A7ZPL3 1.93e-71 227 48 8 330 3 zipA Cell division protein ZipA Escherichia coli O139:H28 (strain E24377A / ETEC)
P77173 4.42e-71 226 48 6 329 1 zipA Cell division protein ZipA Escherichia coli (strain K12)
B1IX59 4.42e-71 226 48 6 329 3 zipA Cell division protein ZipA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA83 4.42e-71 226 48 6 329 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / DH10B)
C4ZVU3 4.42e-71 226 48 6 329 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / MC4100 / BW2952)
B6I4Y9 5.26e-71 226 48 8 330 3 zipA Cell division protein ZipA Escherichia coli (strain SE11)
A8A2Q8 5.26e-71 226 48 8 330 3 zipA Cell division protein ZipA Escherichia coli O9:H4 (strain HS)
B7M6S2 5.26e-71 226 48 8 330 3 zipA Cell division protein ZipA Escherichia coli O8 (strain IAI1)
B7LCF7 5.26e-71 226 48 8 330 3 zipA Cell division protein ZipA Escherichia coli (strain 55989 / EAEC)
Q31Y67 9.12e-71 225 48 8 330 3 zipA Cell division protein ZipA Shigella boydii serotype 4 (strain Sb227)
Q8X492 9.12e-71 225 48 6 329 3 zipA Cell division protein ZipA Escherichia coli O157:H7
Q3YZD0 1.94e-70 224 48 8 330 3 zipA Cell division protein ZipA Shigella sonnei (strain Ss046)
Q83QN9 2.78e-70 224 47 7 329 3 zipA Cell division protein ZipA Shigella flexneri
Q0TF54 9.11e-68 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FFC0 9.41e-68 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R8W0 1.03e-67 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli (strain UTI89 / UPEC)
B1LMK6 1.03e-67 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli (strain SMS-3-5 / SECEC)
A1ADS9 1.03e-67 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli O1:K1 / APEC
B7MHR6 1.03e-67 218 45 8 341 3 zipA Cell division protein ZipA Escherichia coli O45:K1 (strain S88 / ExPEC)
Q32DE1 1.04e-67 218 46 7 332 3 zipA Cell division protein ZipA Shigella dysenteriae serotype 1 (strain Sd197)
B5YZV9 1.04e-67 218 46 7 332 3 zipA Cell division protein ZipA Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7UGB3 1.68e-67 217 45 8 341 3 zipA Cell division protein ZipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TWZ6 6.5e-67 216 46 8 340 3 zipA Cell division protein ZipA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1LU19 1.04e-60 197 37 7 327 3 zipA Cell division protein ZipA Baumannia cicadellinicola subsp. Homalodisca coagulata
C4K4K3 3.53e-59 194 35 6 316 3 zipA Cell division protein ZipA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A9MIF9 4.59e-58 192 59 2 157 3 zipA Cell division protein ZipA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ADI1 2.27e-57 191 59 1 153 3 zipA Cell division protein ZipA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57LT0 2.35e-57 191 59 3 159 3 zipA Cell division protein ZipA Salmonella choleraesuis (strain SC-B67)
C0PZB3 3.11e-57 191 59 3 159 3 zipA Cell division protein ZipA Salmonella paratyphi C (strain RKS4594)
B5FGU8 5.22e-57 190 40 8 333 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain MJ11)
Q5E3L0 9.95e-57 189 39 7 344 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain ATCC 700601 / ES114)
A6TC48 2.6e-56 189 59 1 154 3 zipA Cell division protein ZipA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XVT3 8.83e-56 187 59 0 147 3 zipA Cell division protein ZipA Klebsiella pneumoniae (strain 342)
B5F0F6 7.03e-55 184 60 1 140 3 zipA Cell division protein ZipA Salmonella agona (strain SL483)
B4SZU6 1.15e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella newport (strain SL254)
P0A2N6 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2N7 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella typhi
B5BB71 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain AKU_12601)
A9N361 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PND8 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TCF7 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella heidelberg (strain SL476)
B5RCQ0 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3V5 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella enteritidis PT4 (strain P125109)
B5FQC0 1.18e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella dublin (strain CT_02021853)
B4TQF9 1.44e-54 184 60 1 140 3 zipA Cell division protein ZipA Salmonella schwarzengrund (strain CVM19633)
Q6LTU6 4.73e-52 178 36 9 352 3 zipA Cell division protein ZipA Photobacterium profundum (strain SS9)
C3LTL8 2.63e-50 171 34 7 325 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain M66-2)
Q9KTD2 2.63e-50 171 34 7 325 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2W2 2.63e-50 171 34 7 325 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6EJQ7 2.85e-50 172 37 7 324 3 zipA Cell division protein ZipA Aliivibrio salmonicida (strain LFI1238)
A3QFJ6 2.64e-49 170 35 11 344 3 zipA Cell division protein ZipA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q7MMT6 7.52e-49 168 33 6 318 3 zipA Cell division protein ZipA Vibrio vulnificus (strain YJ016)
Q8DFK4 1.28e-48 168 33 5 317 3 zipA Cell division protein ZipA Vibrio vulnificus (strain CMCP6)
B0TKB3 2.78e-48 167 36 10 334 3 zipA Cell division protein ZipA Shewanella halifaxensis (strain HAW-EB4)
A8H375 8.51e-48 166 34 7 335 3 zipA Cell division protein ZipA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0HK32 4.05e-47 165 34 8 347 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-4)
Q0HWD3 5.23e-47 164 34 8 347 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-7)
Q12L81 5.23e-47 164 32 7 341 3 zipA Cell division protein ZipA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q87RJ5 1.11e-46 163 33 5 326 3 zipA Cell division protein ZipA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ED69 1.38e-46 163 34 10 344 3 zipA Cell division protein ZipA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B1KJT6 3.16e-46 161 32 6 339 3 zipA Cell division protein ZipA Shewanella woodyi (strain ATCC 51908 / MS32)
A1S5R6 5.5e-46 162 32 8 357 3 zipA Cell division protein ZipA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4Y803 8.32e-46 161 32 9 351 3 zipA Cell division protein ZipA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RII6 9.85e-46 161 32 9 351 3 zipA Cell division protein ZipA Shewanella sp. (strain W3-18-1)
A0KVI3 8.91e-45 159 34 8 348 3 zipA Cell division protein ZipA Shewanella sp. (strain ANA-3)
A9L5Z2 1.61e-43 155 31 11 366 3 zipA Cell division protein ZipA Shewanella baltica (strain OS195)
A6WPS6 1.61e-43 155 31 11 366 3 zipA Cell division protein ZipA Shewanella baltica (strain OS185)
C4LAQ5 3.7e-43 152 33 10 324 3 zipA Cell division protein ZipA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0US80 4.38e-41 149 29 10 344 3 zipA Cell division protein ZipA Histophilus somni (strain 2336)
Q0I2I2 7.99e-41 148 30 11 349 3 zipA Cell division protein ZipA Histophilus somni (strain 129Pt)
Q080K8 1.04e-40 148 33 8 337 3 zipA Cell division protein ZipA Shewanella frigidimarina (strain NCIMB 400)
A8FU25 4.45e-38 141 31 6 341 3 zipA Cell division protein ZipA Shewanella sediminis (strain HAW-EB3)
A5UIM7 6.36e-34 130 28 9 334 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittGG)
P44113 1.94e-33 128 28 9 334 3 zipA Cell division protein ZipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLI9 3.93e-33 127 28 9 334 3 zipA Cell division protein ZipA Haemophilus influenzae (strain 86-028NP)
A7MT68 8.33e-33 127 45 0 128 3 zipA Cell division protein ZipA Vibrio campbellii (strain ATCC BAA-1116)
A5UD03 1.41e-32 126 27 8 334 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittEE)
A1TZT8 1.07e-30 121 28 7 349 3 zipA Cell division protein ZipA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q65RN5 1.02e-28 116 38 1 154 3 zipA Cell division protein ZipA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VR17 1.03e-26 110 28 11 330 3 zipA Cell division protein ZipA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BQN7 2.76e-25 107 38 3 151 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A4VKM9 4.06e-25 105 36 2 172 3 zipA Cell division protein ZipA Stutzerimonas stutzeri (strain A1501)
Q9CKC8 5.76e-25 105 27 8 318 3 zipA Cell division protein ZipA Pasteurella multocida (strain Pm70)
B3H276 7.75e-25 105 37 3 151 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B8F313 8.85e-25 104 35 2 151 3 zipA Cell division protein ZipA Glaesserella parasuis serovar 5 (strain SH0165)
Q1ICK1 9e-25 104 30 10 324 3 zipA Cell division protein ZipA Pseudomonas entomophila (strain L48)
C3JYN4 2.53e-24 103 37 2 156 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain SBW25)
Q7VMX6 3.9e-24 103 36 2 146 3 zipA Cell division protein ZipA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6V7X4 6.36e-24 102 28 9 331 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain PA7)
Q4KFH2 7.59e-24 102 35 2 160 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9I3I5 9.78e-24 101 28 9 330 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ4 9.78e-24 101 28 9 330 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain LESB58)
Q47YH9 1.02e-23 103 45 0 101 3 zipA Cell division protein ZipA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4XVY6 2.48e-23 100 40 0 130 3 zipA Cell division protein ZipA Pseudomonas mendocina (strain ymp)
C1DN28 2.82e-23 100 37 0 130 3 zipA Cell division protein ZipA Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q02K11 5.5e-23 99 28 9 339 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3KFB3 1.28e-22 98 37 1 142 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain Pf0-1)
B0KPX4 1.04e-21 96 37 1 142 3 zipA Cell division protein ZipA Pseudomonas putida (strain GB-1)
Q88F24 1.73e-21 95 37 1 142 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87YY5 2.06e-21 95 32 4 169 3 zipA Cell division protein ZipA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZVF7 2.31e-21 95 33 3 169 3 zipA Cell division protein ZipA Pseudomonas syringae pv. syringae (strain B728a)
B1JC07 2.39e-21 95 37 1 142 3 zipA Cell division protein ZipA Pseudomonas putida (strain W619)
A5W0T9 2.46e-21 95 37 1 142 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q48KR3 2.72e-21 95 33 3 169 3 zipA Cell division protein ZipA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8PAB7 1.98e-18 86 32 0 134 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTA8 1.98e-18 86 32 0 134 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain 8004)
Q3BV17 2.04e-18 86 31 0 142 3 zipA Cell division protein ZipA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PM10 3.24e-18 85 30 1 170 3 zipA Cell division protein ZipA Xanthomonas axonopodis pv. citri (strain 306)
Q9PAG1 3.61e-17 82 32 1 148 3 zipA Cell division protein ZipA Xylella fastidiosa (strain 9a5c)
Q87A87 3.91e-17 82 31 1 148 3 zipA Cell division protein ZipA Xylella fastidiosa (strain Temecula1 / ATCC 700964)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18675
Feature type CDS
Gene zipA
Product cell division protein ZipA
Location 6396 - 7367 (strand: -1)
Length 972 (nucleotides) / 323 (amino acids)
In genomic island -

Contig

Accession ZDB_707
Length 24230 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1714
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04354 ZipA, C-terminal FtsZ-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3115 Cell cycle control, cell division, chromosome partitioning (D) D Cell division protein ZipA, interacts with FtsZ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03528 cell division protein ZipA - -

Protein Sequence

MQDLRLILIVVGAVAIIALLLHGLWTSRKERSSLFRARPMKRRKYESQDEAADDMSEARGSRHSAVLPEDPAPQVSPYSEAQNEQDPLLSAGRMYPSSEPEEPPVMPKAQSPRRQPVKAPETEPQIGLFDALEQEAQAPAAPAPEVMTTAAVITAAETDMPHTEEPVTEPEPVQEAPRSSAENNEIVLALFVSAHPGQMVAGDILRTAIEQAGFRFGAMNIYHRHVDPAGSGPVLFSLANMVNPGTFVPEQMEEIETPGVAMFMMVPSYGDANQNFKLMLQAAQRIASDVGGVVLDEERKMLTPQKIEVYKARIRKVLVAKQN

Flanking regions ( +/- flanking 50bp)

ATAGTATTTTGCCATGGTGGCCTTTAATTTAAACAACAGAGATAGCACTGATGCAAGATTTGCGTCTGATATTAATCGTTGTGGGTGCGGTAGCAATCATCGCATTGTTACTTCACGGACTGTGGACGAGCCGTAAAGAGCGTTCTTCCCTGTTTCGCGCGCGCCCCATGAAGCGTCGTAAATACGAGTCGCAGGATGAAGCCGCTGATGATATGTCAGAGGCACGCGGCTCCCGTCACTCTGCTGTATTACCGGAGGATCCGGCTCCGCAGGTCTCTCCGTATTCAGAAGCGCAGAATGAGCAGGATCCGTTATTATCTGCCGGCAGAATGTATCCGTCATCAGAGCCGGAAGAACCGCCTGTGATGCCGAAAGCCCAGAGCCCGCGCCGTCAGCCGGTAAAAGCACCGGAAACAGAGCCGCAAATCGGATTATTTGATGCCCTTGAGCAGGAAGCACAGGCACCGGCAGCTCCGGCTCCGGAGGTCATGACAACAGCCGCGGTGATCACTGCCGCTGAAACTGACATGCCTCACACAGAAGAGCCGGTAACTGAACCGGAACCGGTTCAGGAAGCGCCGCGCAGCAGTGCAGAGAACAATGAGATTGTGCTGGCACTGTTTGTGTCCGCCCATCCGGGACAGATGGTCGCAGGTGATATTCTGCGCACCGCTATCGAGCAGGCCGGGTTCCGTTTCGGGGCGATGAACATCTATCACCGCCATGTCGATCCGGCAGGCAGTGGTCCGGTGTTATTCAGTCTGGCCAATATGGTGAATCCGGGCACGTTTGTACCGGAGCAGATGGAAGAGATCGAAACCCCGGGCGTGGCCATGTTTATGATGGTGCCGTCTTACGGTGACGCAAACCAGAACTTCAAGCTGATGTTACAGGCTGCTCAGCGTATCGCCTCTGATGTCGGCGGCGTGGTTCTGGATGAGGAGCGCAAAATGCTGACACCGCAGAAAATCGAGGTGTACAAGGCGCGCATCCGCAAAGTTCTCGTCGCCAAACAGAACTGAGACACACAAATCGCACAAAAACCCCCGCAATGACGGGGGTTTTTTTCAGG