Homologs in group_1671

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11615 FBDBKF_11615 58.0 Morganella morganii S1 zipA cell division protein ZipA
EHELCC_17535 EHELCC_17535 58.0 Morganella morganii S2 zipA cell division protein ZipA
NLDBIP_18745 NLDBIP_18745 58.0 Morganella morganii S4 zipA cell division protein ZipA
LHKJJB_17975 LHKJJB_17975 58.0 Morganella morganii S3 zipA cell division protein ZipA
HKOGLL_18675 HKOGLL_18675 58.0 Morganella morganii S5 zipA cell division protein ZipA
F4V73_RS08065 F4V73_RS08065 57.0 Morganella psychrotolerans zipA cell division protein ZipA

Distribution of the homologs in the orthogroup group_1671

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1671

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JFY9 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668M5 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMG5 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pestis (strain Pestoides F)
Q1CJV8 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH1 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Angola)
P58492 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pestis
B2K918 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5X8 1.06e-97 295 47 7 367 3 zipA Cell division protein ZipA Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGC1 5.14e-97 293 47 7 365 3 zipA Cell division protein ZipA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2NSC1 6e-95 288 47 8 357 3 zipA Cell division protein ZipA Sodalis glossinidius (strain morsitans)
Q6D8S6 1.59e-94 287 46 7 365 3 zipA Cell division protein ZipA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VE39 4.47e-92 280 47 8 353 3 zipA Cell division protein ZipA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8GHF3 6.4e-88 270 45 7 355 3 zipA Cell division protein ZipA Serratia proteamaculans (strain 568)
Q7N6Y5 7.21e-87 267 48 10 351 3 zipA Cell division protein ZipA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A7MKW3 6.62e-68 219 41 8 350 3 zipA Cell division protein ZipA Cronobacter sakazakii (strain ATCC BAA-894)
A7ZPL3 1.93e-66 215 41 9 358 3 zipA Cell division protein ZipA Escherichia coli O139:H28 (strain E24377A / ETEC)
B6I4Y9 4.29e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli (strain SE11)
A8A2Q8 4.29e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli O9:H4 (strain HS)
B7M6S2 4.29e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli O8 (strain IAI1)
B7LCF7 4.29e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli (strain 55989 / EAEC)
P77173 5.55e-66 214 41 9 358 1 zipA Cell division protein ZipA Escherichia coli (strain K12)
B1IX59 5.55e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA83 5.55e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / DH10B)
C4ZVU3 5.55e-66 214 41 9 358 3 zipA Cell division protein ZipA Escherichia coli (strain K12 / MC4100 / BW2952)
Q3YZD0 6.81e-66 214 41 9 358 3 zipA Cell division protein ZipA Shigella sonnei (strain Ss046)
Q83QN9 8.48e-66 214 42 9 353 3 zipA Cell division protein ZipA Shigella flexneri
Q31Y67 9.82e-66 213 41 9 358 3 zipA Cell division protein ZipA Shigella boydii serotype 4 (strain Sb227)
Q8X492 3.1e-65 212 41 9 358 3 zipA Cell division protein ZipA Escherichia coli O157:H7
B5XVT3 2.43e-64 211 67 0 141 3 zipA Cell division protein ZipA Klebsiella pneumoniae (strain 342)
A6TC48 3.44e-64 210 67 0 141 3 zipA Cell division protein ZipA Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1LU19 1.19e-62 203 67 1 137 3 zipA Cell division protein ZipA Baumannia cicadellinicola subsp. Homalodisca coagulata
A9MIF9 5.66e-59 196 62 2 143 3 zipA Cell division protein ZipA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4SZU6 2.12e-58 194 62 2 143 3 zipA Cell division protein ZipA Salmonella newport (strain SL254)
Q57LT0 2.21e-58 194 62 2 143 3 zipA Cell division protein ZipA Salmonella choleraesuis (strain SC-B67)
C0PZB3 3.02e-58 194 62 2 143 3 zipA Cell division protein ZipA Salmonella paratyphi C (strain RKS4594)
B5F0F6 3.02e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella agona (strain SL483)
P0A2N6 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2N7 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella typhi
B5BB71 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain AKU_12601)
A9N361 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PND8 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TCF7 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella heidelberg (strain SL476)
B5RCQ0 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3V5 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella enteritidis PT4 (strain P125109)
B5FQC0 4.78e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella dublin (strain CT_02021853)
B4TQF9 4.99e-58 194 64 1 137 3 zipA Cell division protein ZipA Salmonella schwarzengrund (strain CVM19633)
A8ADI1 2.31e-57 192 62 1 142 3 zipA Cell division protein ZipA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TF54 7.58e-57 191 62 2 143 3 zipA Cell division protein ZipA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FFC0 4.72e-56 189 61 2 142 3 zipA Cell division protein ZipA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2TWZ6 5.08e-56 188 61 2 142 3 zipA Cell division protein ZipA Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7UGB3 5.3e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32DE1 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R8W0 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli (strain UTI89 / UPEC)
B1LMK6 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli (strain SMS-3-5 / SECEC)
A1ADS9 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli O1:K1 / APEC
B5YZV9 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7MHR6 5.78e-56 188 61 2 142 3 zipA Cell division protein ZipA Escherichia coli O45:K1 (strain S88 / ExPEC)
A4WD24 1.22e-55 187 61 0 133 3 zipA Cell division protein ZipA Enterobacter sp. (strain 638)
A4WD24 3.36e-13 72 68 0 45 3 zipA Cell division protein ZipA Enterobacter sp. (strain 638)
B5FGU8 3.75e-51 176 35 7 346 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain MJ11)
C4K4K3 6.64e-50 171 56 0 135 3 zipA Cell division protein ZipA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
C4K4K3 2.11e-07 55 53 0 45 3 zipA Cell division protein ZipA Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q5E3L0 7.83e-49 170 36 7 352 3 zipA Cell division protein ZipA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87RJ5 3.81e-48 167 35 8 341 3 zipA Cell division protein ZipA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MT68 6.08e-48 167 33 7 353 3 zipA Cell division protein ZipA Vibrio campbellii (strain ATCC BAA-1116)
B6EJQ7 7.1e-48 167 34 10 345 3 zipA Cell division protein ZipA Aliivibrio salmonicida (strain LFI1238)
A3QFJ6 8.31e-48 167 33 9 367 3 zipA Cell division protein ZipA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12L81 3.04e-47 166 32 7 348 3 zipA Cell division protein ZipA Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KJT6 5.08e-47 164 33 8 354 3 zipA Cell division protein ZipA Shewanella woodyi (strain ATCC 51908 / MS32)
A1S5R6 1.07e-46 165 32 11 375 3 zipA Cell division protein ZipA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7MMT6 1.15e-46 164 31 7 347 3 zipA Cell division protein ZipA Vibrio vulnificus (strain YJ016)
Q8DFK4 1.6e-46 163 31 7 347 3 zipA Cell division protein ZipA Vibrio vulnificus (strain CMCP6)
A4Y803 2.04e-46 164 32 8 355 3 zipA Cell division protein ZipA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RII6 4.19e-46 163 32 11 362 3 zipA Cell division protein ZipA Shewanella sp. (strain W3-18-1)
Q8ED69 1.21e-45 162 33 12 360 3 zipA Cell division protein ZipA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HK32 1.6e-45 161 32 12 360 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-4)
Q0HWD3 2.3e-45 161 32 12 360 3 zipA Cell division protein ZipA Shewanella sp. (strain MR-7)
B0TKB3 2.01e-44 157 32 9 364 3 zipA Cell division protein ZipA Shewanella halifaxensis (strain HAW-EB4)
A8H375 2.4e-44 158 31 11 370 3 zipA Cell division protein ZipA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FU25 8.36e-41 149 31 9 365 3 zipA Cell division protein ZipA Shewanella sediminis (strain HAW-EB3)
A0KVI3 1.41e-40 149 30 10 372 3 zipA Cell division protein ZipA Shewanella sp. (strain ANA-3)
A9L5Z2 1.47e-38 143 31 13 379 3 zipA Cell division protein ZipA Shewanella baltica (strain OS195)
A6WPS6 1.47e-38 143 31 13 379 3 zipA Cell division protein ZipA Shewanella baltica (strain OS185)
C3LTL8 9.48e-38 139 48 0 139 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain M66-2)
C3LTL8 4.22e-07 54 45 1 55 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain M66-2)
Q9KTD2 9.48e-38 139 48 0 139 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KTD2 4.22e-07 54 45 1 55 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2W2 9.48e-38 139 48 0 139 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5F2W2 4.22e-07 54 45 1 55 3 zipA Cell division protein ZipA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0US80 1.93e-35 134 26 9 374 3 zipA Cell division protein ZipA Histophilus somni (strain 2336)
Q0I2I2 9.35e-35 133 26 9 374 3 zipA Cell division protein ZipA Histophilus somni (strain 129Pt)
A4VKM9 1.79e-32 125 42 2 152 3 zipA Cell division protein ZipA Stutzerimonas stutzeri (strain A1501)
Q65RN5 4.62e-32 126 28 10 361 3 zipA Cell division protein ZipA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4KFH2 6.31e-32 124 38 3 171 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6LTU6 1.04e-31 125 45 0 128 3 zipA Cell division protein ZipA Photobacterium profundum (strain SS9)
Q3KFB3 1.16e-31 123 41 2 150 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain Pf0-1)
A4XVY6 1.18e-31 123 38 4 192 3 zipA Cell division protein ZipA Pseudomonas mendocina (strain ymp)
C3JYN4 1.66e-31 123 42 2 146 3 zipA Cell division protein ZipA Pseudomonas fluorescens (strain SBW25)
Q4QLI9 3.33e-31 123 29 11 360 3 zipA Cell division protein ZipA Haemophilus influenzae (strain 86-028NP)
A6V7X4 3.41e-31 122 41 1 155 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain PA7)
Q9I3I5 5.49e-31 122 43 1 136 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ4 5.49e-31 122 43 1 136 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain LESB58)
A1TZT8 5.66e-31 123 43 1 144 3 zipA Cell division protein ZipA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q02K11 6.54e-31 121 43 1 136 3 zipA Cell division protein ZipA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q080K8 3.1e-30 121 45 1 130 3 zipA Cell division protein ZipA Shewanella frigidimarina (strain NCIMB 400)
C1DN28 4.37e-30 119 42 1 137 3 zipA Cell division protein ZipA Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C4LAQ5 6.37e-30 118 43 1 141 3 zipA Cell division protein ZipA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A5UIM7 1.07e-29 119 29 11 360 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittGG)
A5UD03 1.98e-29 118 27 8 351 3 zipA Cell division protein ZipA Haemophilus influenzae (strain PittEE)
P44113 2.24e-29 118 27 8 351 3 zipA Cell division protein ZipA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87YY5 3.41e-29 117 33 4 219 3 zipA Cell division protein ZipA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48KR3 5.1e-29 116 39 2 157 3 zipA Cell division protein ZipA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1ICK1 8.62e-29 116 29 10 354 3 zipA Cell division protein ZipA Pseudomonas entomophila (strain L48)
B0KPX4 9.26e-29 116 41 2 143 3 zipA Cell division protein ZipA Pseudomonas putida (strain GB-1)
Q88F24 1.1e-28 115 42 2 145 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W0T9 1.47e-28 115 42 2 145 3 zipA Cell division protein ZipA Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4ZVF7 1.58e-28 115 41 1 138 3 zipA Cell division protein ZipA Pseudomonas syringae pv. syringae (strain B728a)
B1JC07 9.14e-28 113 41 2 145 3 zipA Cell division protein ZipA Pseudomonas putida (strain W619)
A3N1V3 4.7e-27 112 29 12 357 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3H276 7.65e-27 111 29 14 365 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BQN7 3.51e-25 107 37 3 164 3 zipA Cell division protein ZipA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q7VMX6 1.37e-24 105 26 8 340 3 zipA Cell division protein ZipA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q47YH9 1.79e-24 105 38 0 154 3 zipA Cell division protein ZipA Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8F313 7.57e-24 102 38 2 135 3 zipA Cell division protein ZipA Glaesserella parasuis serovar 5 (strain SH0165)
A6VR17 2.51e-23 102 39 0 133 3 zipA Cell division protein ZipA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CKC8 6.69e-23 100 36 1 129 3 zipA Cell division protein ZipA Pasteurella multocida (strain Pm70)
Q3BV17 3.68e-19 88 32 4 173 3 zipA Cell division protein ZipA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PM10 1.49e-18 87 32 4 173 3 zipA Cell division protein ZipA Xanthomonas axonopodis pv. citri (strain 306)
Q8PAB7 3.7e-18 85 33 3 147 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTA8 3.7e-18 85 33 3 147 3 zipA Cell division protein ZipA Xanthomonas campestris pv. campestris (strain 8004)
Q87A87 1.79e-16 81 31 0 138 3 zipA Cell division protein ZipA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PAG1 2e-16 80 33 2 139 3 zipA Cell division protein ZipA Xylella fastidiosa (strain 9a5c)
C6D9P6 5.33e-16 81 80 0 46 3 zipA Cell division protein ZipA Pectobacterium carotovorum subsp. carotovorum (strain PC1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09005
Feature type CDS
Gene zipA
Product cell division protein ZipA
Location 1962278 - 1963333 (strand: -1)
Length 1056 (nucleotides) / 351 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1671
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04354 ZipA, C-terminal FtsZ-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3115 Cell cycle control, cell division, chromosome partitioning (D) D Cell division protein ZipA, interacts with FtsZ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03528 cell division protein ZipA - -

Protein Sequence

MMQQNLRLILIVVGAILIIALLLHGLWIGRKERSKLFRNRPVKRQKQNYQSDENDDEPQYTEANHQMSSLTSTQEAQSVPPVKSEPTLAPQSSVADKDPLMSGTPAQGHSNDTSLQREPSLGVFDVIEQNNDSAPQQKQPIPEVEVNHADVKEGDISETKLADVEPVPVSSNSVASDEIHTTDTDRPLDAETSSDVKQAEQALSGTEEPKAEEELVLVLNVSAHHGQMLDGEVLMQSIIQAGFQFGAMNIFHRHLNPTGNGPVLFSLANMVKPGTFNIDTMAELTTPGVSMFMMVPSYGDANQNFKLMLQAAQRIASDVGGVVLDEERKLLTPQKIELYKSRIRRTLDLHQ

Flanking regions ( +/- flanking 50bp)

AGTAATATTCGCCATTGTGGCTATTAAACCTCAAGACAACAGAGATAGAAATGATGCAGCAAAATTTGCGTCTGATATTAATCGTTGTTGGTGCGATTTTAATCATAGCTTTGTTATTACACGGCTTATGGATTGGTCGAAAAGAGCGTTCTAAGCTTTTCCGTAATCGCCCAGTAAAACGTCAGAAACAGAATTATCAGTCAGATGAGAACGATGATGAACCCCAGTATACTGAGGCAAATCATCAGATGTCGTCTTTAACTTCAACGCAGGAGGCTCAAAGTGTGCCACCGGTTAAATCGGAGCCAACACTTGCGCCACAATCCTCAGTTGCAGATAAAGATCCACTTATGTCTGGAACACCAGCACAGGGACATTCTAACGATACTTCATTACAACGAGAGCCTAGTCTTGGTGTTTTTGATGTTATTGAACAAAATAATGACTCTGCGCCTCAGCAAAAACAACCGATACCCGAGGTAGAGGTAAACCATGCTGATGTAAAAGAAGGTGATATTAGTGAGACAAAACTTGCCGATGTAGAGCCAGTGCCAGTATCGTCGAACTCTGTTGCTAGTGATGAAATACATACCACTGATACAGATAGGCCATTGGATGCTGAAACCTCATCTGATGTGAAACAAGCTGAGCAAGCTTTATCCGGAACAGAAGAGCCAAAAGCAGAAGAAGAGCTGGTATTAGTATTAAATGTCAGCGCTCATCATGGTCAAATGCTTGACGGTGAGGTGTTAATGCAGAGCATTATTCAAGCGGGTTTCCAGTTTGGTGCGATGAATATTTTCCATCGACATCTTAACCCGACGGGTAATGGCCCTGTATTGTTTAGTCTTGCCAATATGGTAAAACCGGGTACTTTCAATATTGATACGATGGCTGAATTAACCACGCCTGGCGTATCCATGTTTATGATGGTGCCATCTTATGGTGATGCTAACCAAAACTTTAAATTGATGTTGCAAGCAGCTCAGCGTATTGCCTCTGATGTGGGCGGTGTTGTGCTTGATGAAGAGCGCAAACTGTTAACACCACAAAAAATTGAACTTTATAAATCTAGAATTCGTAGAACACTAGATTTACATCAATAGTCTTTTTATCAAAAGCTCGCTTGCGGTGCTAGGTTGGATAGATTTAAAGA