Homologs in group_598

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01110 FBDBKF_01110 93.7 Morganella morganii S1 fdx ISC system 2Fe-2S type ferredoxin
EHELCC_00435 EHELCC_00435 93.7 Morganella morganii S2 fdx ISC system 2Fe-2S type ferredoxin
NLDBIP_03025 NLDBIP_03025 93.7 Morganella morganii S4 fdx ISC system 2Fe-2S type ferredoxin
LHKJJB_04540 LHKJJB_04540 93.7 Morganella morganii S3 fdx ISC system 2Fe-2S type ferredoxin
HKOGLL_02505 HKOGLL_02505 93.7 Morganella morganii S5 fdx ISC system 2Fe-2S type ferredoxin
PMI_RS09155 PMI_RS09155 91.9 Proteus mirabilis HI4320 fdx ISC system 2Fe-2S type ferredoxin

Distribution of the homologs in the orthogroup group_598

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_598

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9R6 2.55e-68 203 85 0 111 3 fdx 2Fe-2S ferredoxin Shigella flexneri
P0A9R4 2.55e-68 203 85 0 111 1 fdx 2Fe-2S ferredoxin Escherichia coli (strain K12)
P0A9R5 2.55e-68 203 85 0 111 3 fdx 2Fe-2S ferredoxin Escherichia coli O157:H7
Q51383 5.76e-59 179 78 0 110 3 fdx 2Fe-2S ferredoxin Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44428 1.91e-50 158 66 0 110 3 fdx 2Fe-2S ferredoxin Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q89A15 4.38e-46 147 60 0 107 3 fdx 2Fe-2S ferredoxin Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O51882 1.53e-45 145 59 0 111 3 fdx 2Fe-2S ferredoxin Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57661 3.37e-44 142 57 0 111 3 fdx 2Fe-2S ferredoxin Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9AKM6 6.41e-17 73 42 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia montanensis
Q12184 8e-17 74 43 2 92 1 YAH1 Adrenodoxin homolog, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92J08 9.48e-17 72 42 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9AKH1 1.16e-16 72 42 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia rickettsii
Q9AKC4 1.17e-16 72 41 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8SV19 1.79e-16 72 38 3 109 1 ECU07_0600 Adrenodoxin homolog Encephalitozoon cuniculi (strain GB-M1)
Q4UKL2 2.65e-16 71 41 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZDW6 2.86e-16 71 41 3 107 3 fdxB 2Fe-2S ferredoxin Rickettsia prowazekii (strain Madrid E)
P37193 5.63e-15 69 46 2 86 2 Fdx1 Adrenodoxin-like protein 1, mitochondrial Drosophila melanogaster
Q08C57 5.95e-15 70 46 2 89 2 fdx2 Ferredoxin-2, mitochondrial Danio rerio
P37098 5.97e-15 68 38 5 108 3 fdxB 2Fe-2S ferredoxin Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8S904 2.85e-14 68 46 2 89 2 MFDX2 Adrenodoxin-like protein 2, mitochondrial Arabidopsis thaliana
Q9CPW2 6.16e-14 67 47 2 86 1 Fdx2 Ferredoxin-2, mitochondrial Mus musculus
Q9M0V0 7.86e-14 67 44 2 89 1 MFDX1 Adrenodoxin-like protein 1, mitochondrial Arabidopsis thaliana
Q1RJ69 1.52e-13 64 45 2 95 3 fdxB 2Fe-2S ferredoxin Rickettsia bellii (strain RML369-C)
Q5FWQ0 1.78e-13 66 50 2 86 2 fdx2 Ferredoxin-2, mitochondrial Xenopus laevis
Q6P4F2 5.65e-13 64 46 2 86 1 FDX2 Ferredoxin-2, mitochondrial Homo sapiens
P00257 7.58e-13 64 39 5 106 1 FDX1 Adrenodoxin, mitochondrial Bos taurus
Q05B51 8.09e-13 64 46 2 86 2 FDX2 Ferredoxin-2, mitochondrial Bos taurus
P29330 8.28e-13 63 39 5 106 1 FDX1 Adrenodoxin Ovis aries
P00258 4.79e-12 62 42 4 92 1 FDX1 Adrenodoxin, mitochondrial Sus scrofa
P59799 5.08e-12 60 35 4 103 1 fdx5 2Fe-2S ferredoxin-5 Aquifex aeolicus (strain VF5)
P10109 5.61e-12 62 39 5 106 1 FDX1 Adrenodoxin, mitochondrial Homo sapiens
P80306 2.89e-11 58 36 5 110 1 fdxE Ferredoxin-6 Rhodobacter capsulatus
P13216 4.45e-11 58 41 4 92 1 FDX1 Adrenodoxin, mitochondrial (Fragment) Gallus gallus
P24483 5.76e-11 59 37 4 102 2 Fdx1 Adrenodoxin, mitochondrial Rattus norvegicus
P46656 7.17e-11 59 38 3 88 1 Fdx1 Adrenodoxin, mitochondrial Mus musculus
D5IGG4 2.68e-10 56 41 2 75 1 carAc Ferredoxin CarAc Sphingomonas sp.
Q10361 8.71e-10 57 46 2 71 1 etp1 Heme A synthase-mitochondrial ferredoxin fusion protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
X5CWH9 1.03e-09 54 37 3 96 1 cndB2 Chloroacetanilide N-alkylformylase 2, ferredoxin component Rhizorhabdus wittichii (strain DC-6 / KACC 16600)
P00259 2.81e-09 53 36 5 106 1 camB Putidaredoxin Pseudomonas putida
Q8SZA8 8.64e-09 53 39 5 92 2 Fdx2 Adrenodoxin-like protein 2, mitochondrial Drosophila melanogaster
Q5S3I4 3.93e-07 47 35 3 94 1 ddmB Dicamba O-demethylase, ferredoxin component Stenotrophomonas maltophilia
P76081 1.91e-06 48 39 3 82 1 paaE 1,2-phenylacetyl-CoA epoxidase, subunit E Escherichia coli (strain K12)
P33007 2.37e-06 45 32 6 106 1 terPB Terpredoxin Pseudomonas sp.
P43493 4.24e-05 42 33 5 102 1 thcC Rhodocoxin Rhodococcus erythropolis
X5CFH4 9.52e-05 41 33 3 95 1 cndB1 Chloroacetanilide N-alkylformylase 1, ferredoxin component Rhizorhabdus wittichii (strain DC-6 / KACC 16600)
P23101 0.000259 42 36 4 82 3 xylZ Toluate 1,2-dioxygenase electron transfer component Pseudomonas putida
P07838 0.000478 39 38 1 63 1 None Ferredoxin Bryopsis maxima

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07180
Feature type CDS
Gene fdx
Product ISC system 2Fe-2S type ferredoxin
Location 1495113 - 1495451 (strand: -1)
Length 339 (nucleotides) / 112 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_598
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0633 Energy production and conversion (C) C Ferredoxin

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04755 ferredoxin, 2Fe-2S Benzoate degradation
Microbial metabolism in diverse environments
-

Protein Sequence

MPKIVFLPHEYLCPEGAVFDANEGESILDVALRNGIEIEHACEKSCACTTCHCIVREGFDSLRESTELEDDMLDKAWGLEPESRLSCQAKVTDEDLVVEMPKYTVNHAREHG

Flanking regions ( +/- flanking 50bp)

CCGTAAGGCACTCGCGGGTCACTCTGTGGATGAGATATAACGGGAAGATTATGCCTAAGATTGTTTTTTTACCGCATGAGTATTTATGCCCTGAAGGCGCGGTATTCGACGCAAATGAAGGTGAGTCAATTCTGGATGTTGCCTTGCGTAATGGTATCGAAATTGAACATGCCTGTGAGAAATCATGTGCCTGCACCACCTGTCACTGTATCGTCCGCGAGGGGTTTGACTCCCTCAGAGAGAGCACTGAGCTGGAAGATGACATGCTGGACAAAGCCTGGGGACTGGAGCCGGAAAGCCGTCTGAGCTGCCAGGCAAAAGTGACAGATGAAGACCTGGTTGTGGAAATGCCTAAGTACACTGTTAATCACGCGCGTGAGCACGGATAAAGGAACACAGATATGGGACTGAAATGGCAGGATACCCGGGAAATCGGCGA