Homologs in group_229

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00975 FBDBKF_00975 92.2 Morganella morganii S1 cysM cysteine synthase CysM
EHELCC_00570 EHELCC_00570 92.2 Morganella morganii S2 cysM cysteine synthase CysM
NLDBIP_02890 NLDBIP_02890 92.2 Morganella morganii S4 cysM cysteine synthase CysM
LHKJJB_04405 LHKJJB_04405 92.2 Morganella morganii S3 cysM cysteine synthase CysM
HKOGLL_02640 HKOGLL_02640 92.2 Morganella morganii S5 cysM cysteine synthase CysM
PMI_RS01140 PMI_RS01140 36.7 Proteus mirabilis HI4320 - cysteine synthase family protein
PMI_RS09035 PMI_RS09035 76.5 Proteus mirabilis HI4320 cysM cysteine synthase CysM

Distribution of the homologs in the orthogroup group_229

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_229

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16703 1.34e-156 441 71 0 293 1 cysM Cysteine synthase B Escherichia coli (strain K12)
P29848 4.09e-156 440 71 0 293 1 cysM Cysteine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I526 6.48e-138 394 66 0 290 3 cysM Cysteine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7DDL5 1.31e-76 239 44 5 303 1 cysK Cysteine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O01592 5.83e-76 238 43 4 298 1 cysl-3 Cysteine synthase 3 Caenorhabditis elegans
O32978 2.54e-75 235 43 3 301 3 cysK O-acetylserine sulfhydrylase Mycobacterium leprae (strain TN)
P31300 1.6e-74 235 46 4 293 2 None Cysteine synthase, chloroplastic/chromoplastic Capsicum annuum
Q00834 4.68e-74 233 44 4 300 1 None Cysteine synthase Spinacia oleracea
P32260 1.02e-73 234 44 4 300 1 CYSK Cysteine synthase, chloroplastic/chromoplastic Spinacia oleracea
P63872 1.65e-73 231 40 3 299 3 cysK Cysteine synthase Staphylococcus aureus (strain MW2)
Q6GBX5 1.65e-73 231 40 3 299 3 cysK Cysteine synthase Staphylococcus aureus (strain MSSA476)
Q6GJF8 1.65e-73 231 40 3 299 3 cysK Cysteine synthase Staphylococcus aureus (strain MRSA252)
P63871 1.65e-73 231 40 3 299 1 cysK Cysteine synthase Staphylococcus aureus (strain N315)
P63870 1.65e-73 231 40 3 299 3 cysK Cysteine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIG2 1.65e-73 231 40 3 299 3 cysK Cysteine synthase Staphylococcus aureus (strain COL)
Q43153 3.12e-73 232 44 4 301 1 CYSC Bifunctional L-3-cyanoalanine synthase/cysteine synthase, mitochondrial Spinacia oleracea
Q8CMT6 5.8e-73 229 40 3 298 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRP1 5.8e-73 229 40 3 298 3 cysK Cysteine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O45679 1.51e-72 229 42 4 297 1 cysl-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase Caenorhabditis elegans
O23733 2.68e-72 228 44 4 300 2 None Cysteine synthase Brassica juncea
O81155 7.07e-72 229 44 4 300 2 None Cysteine synthase, chloroplastic/chromoplastic Solanum tuberosum
Q43317 1.53e-71 226 44 4 300 1 None Cysteine synthase Citrullus lanatus
P48028 1.58e-71 221 66 0 162 3 cysM Cysteine synthase B (Fragment) Pseudomonas syringae pv. syringae
P47998 1.86e-71 226 44 4 300 1 OASA1 Cysteine synthase 1 Arabidopsis thaliana
Q9XEA8 3.77e-71 225 43 4 302 2 RCS3 Cysteine synthase Oryza sativa subsp. japonica
O23735 1.15e-70 224 43 4 300 2 None Cysteine synthase Brassica juncea
P9WP55 1.52e-70 223 42 3 301 1 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP54 1.52e-70 223 42 3 301 3 cysK1 O-acetylserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A535 1.52e-70 223 42 3 301 3 cysK O-acetylserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A1E3 3.06e-70 223 44 6 307 1 cysK Cysteine synthase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1E4 3.06e-70 223 44 6 307 3 cysK Cysteine synthase A Salmonella typhi
P0ABK5 3.37e-70 223 44 7 307 1 cysK Cysteine synthase A Escherichia coli (strain K12)
P0ABK6 3.37e-70 223 44 7 307 3 cysK Cysteine synthase A Escherichia coli O157:H7
Q5XAQ3 4.55e-70 222 41 3 299 1 cysK Cysteine synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P73410 9.62e-70 221 46 7 305 3 cysK Cysteine synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P80608 1.31e-69 221 43 4 300 1 None Cysteine synthase Zea mays
Q9XEA6 2.48e-69 220 42 4 300 2 RCS1 Cysteine synthase Oryza sativa subsp. japonica
O81154 4.59e-69 220 42 4 300 2 None Cysteine synthase Solanum tuberosum
Q93244 5.64e-69 220 42 4 297 1 cysl-1 Cysteine synthase 1 Caenorhabditis elegans
P37887 8.56e-69 219 43 3 299 1 cysK Cysteine synthase Bacillus subtilis (strain 168)
Q43725 1.39e-68 222 43 4 301 1 OASC Cysteine synthase, mitochondrial Arabidopsis thaliana
P38076 7.47e-68 217 41 4 300 2 CYS1 Cysteine synthase Triticum aestivum
Q1KLZ2 1.64e-67 218 42 5 303 1 CAS1 L-3-cyanoalanine synthase 1, mitochondrial Malus domestica
P47999 1.75e-67 218 43 4 299 1 OASB Cysteine synthase, chloroplastic/chromoplastic Arabidopsis thaliana
Q76MX2 3.41e-66 213 42 6 303 1 PCAS-1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial Solanum tuberosum
Q1KLZ1 9.52e-66 213 41 6 303 1 CAS2 L-3-cyanoalanine synthase 2, mitochondrial Malus domestica
O67507 1.02e-65 211 43 7 303 3 cysM Cysteine synthase Aquifex aeolicus (strain VF5)
D2Z027 2.45e-65 210 43 6 301 1 dcsD O-ureido-L-serine synthase Streptomyces lavendulae
Q9FS29 7.02e-65 210 40 5 302 1 PCAS-2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase 2, mitochondrial Solanum tuberosum
Q59966 2.15e-64 208 45 6 311 2 srpG Cysteine synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O34476 2.95e-64 207 42 6 307 3 ytkP Probable cysteine synthase Bacillus subtilis (strain 168)
O22682 2.22e-63 207 39 4 293 1 CS26 S-sulfo-L-cysteine synthase (O-acetyl-L-serine-dependent), chloroplastic Arabidopsis thaliana
Q9S6Z7 5.89e-63 204 41 4 299 1 CYSD1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D1 Arabidopsis thaliana
F4K5T2 7.95e-62 201 42 4 300 1 DES1 Bifunctional cystathionine gamma-lyase/cysteine synthase Arabidopsis thaliana
Q9S757 4.67e-61 201 40 4 299 1 CYSC1 Bifunctional L-3-cyanoalanine synthase/cysteine synthase C1, mitochondrial Arabidopsis thaliana
P71128 1.16e-59 195 37 5 301 3 cysM Cysteine synthase B Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9SXS7 2.45e-59 195 41 4 301 1 CYSD2 Bifunctional L-3-cyanoalanine synthase/cysteine synthase D2 Arabidopsis thaliana
P35520 9.26e-59 199 39 6 307 1 CBS Cystathionine beta-synthase Homo sapiens
P57171 5.41e-58 191 41 6 304 3 cysK Cysteine synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P32232 5.58e-58 197 39 6 307 1 Cbs Cystathionine beta-synthase Rattus norvegicus
Q59447 5.78e-58 191 40 3 254 3 cysK Cysteine synthase Flavobacterium sp. (strain K3-15 / DSM ID92-509)
Q58H57 6.98e-58 197 39 6 307 2 CBS Cystathionine beta-synthase Macaca fascicularis
Q91WT9 7.97e-58 197 39 6 307 1 Cbs Cystathionine beta-synthase Mus musculus
P56067 1.07e-56 187 36 5 303 1 cysM Cysteine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
P9WP51 1.88e-55 189 39 6 298 1 cbs Probable cystathionine beta-synthase Rv1077 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP50 1.88e-55 189 39 6 298 3 cbs Putative cystathionine beta-synthase MT1108 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45040 3.49e-55 184 40 7 306 1 cysK Cysteine synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O59701 1.93e-54 183 38 7 307 1 cys11 Cysteine synthase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O05393 4.88e-53 178 36 4 300 1 mccA O-acetylserine dependent cystathionine beta-synthase Bacillus subtilis (strain 168)
P9WP53 5.15e-53 178 38 4 302 1 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WP52 5.15e-53 178 38 4 302 3 cysM O-phosphoserine sulfhydrylase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63874 5.15e-53 178 38 4 302 3 cysM O-phosphoserine sulfhydrylase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54CN7 7.53e-53 179 36 8 313 3 cysK Cysteine synthase Dictyostelium discoideum
Q8KA48 3.65e-52 176 39 6 307 3 cysK Cysteine synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9N0V7 4.07e-52 182 40 6 307 2 CBS Cystathionine beta-synthase Oryctolagus cuniculus
Q2V0C9 1.71e-51 179 41 7 312 1 CBS Cystathionine beta-synthase Apis mellifera
Q9ZMW6 5.78e-51 172 36 6 306 3 cysM Cysteine synthase Helicobacter pylori (strain J99 / ATCC 700824)
P32582 1.05e-50 177 36 8 320 1 CYS4 Cystathionine beta-synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P46794 1.25e-50 177 36 5 307 2 cysB Cystathionine beta-synthase Dictyostelium discoideum
Q9LJA0 2.04e-50 167 48 2 177 5 OASA2 Putative inactive cysteine synthase 2 Arabidopsis thaliana
Q5BD67 1.01e-48 170 37 9 334 3 cysF Cysteine synthase 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P50867 2.11e-48 168 35 5 305 3 cysB Cysteine synthase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P87131 2.5e-48 168 32 8 327 3 cys12 Cysteine synthase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7A1Z6 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MW2)
A8YZ41 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD09 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MSSA476)
Q6GKI9 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA252)
Q932K9 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QDA0 4.07e-45 158 35 7 298 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Newman)
D0K799 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain ED98)
Q5HJQ3 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain COL)
A5INY7 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH9)
Q2G1N3 4.07e-45 158 35 7 298 1 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
D2N3G7 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain MRSA ST398 / isolate S0385)
D3ERF5 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain 04-02981)
Q2FKE3 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain USA300)
A6TXQ1 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain JH1)
A7WX68 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
D1GUM7 4.07e-45 158 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain TW20 / 0582)
Q7RYW6 7.33e-45 159 37 7 311 3 cys-17 Cysteine synthase 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q2YUU0 1.19e-44 157 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q99X99 1.15e-43 154 35 7 298 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Staphylococcus aureus (strain N315)
Q7SHQ1 2.12e-42 154 35 8 327 3 cys-12 Cysteine synthase 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q44004 2.22e-41 149 32 6 305 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8XSQ0 8.85e-41 147 35 8 301 3 sbnA N-(2-amino-2-carboxyethyl)-L-glutamate synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
G5EFH8 4.18e-39 148 36 8 287 1 cbs-1 Cystathionine beta-synthase cbs-1 Caenorhabditis elegans
G5EFH8 1.98e-12 70 27 11 296 1 cbs-1 Cystathionine beta-synthase cbs-1 Caenorhabditis elegans
P53206 8.51e-39 143 32 9 327 1 MCY1 Putative mitochondrial cysteine synthase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9N4K2 9.12e-39 147 36 8 292 2 cbs-2 Putative cystathionine beta-synthase cbs-2 Caenorhabditis elegans
Q9N4K2 3.82e-07 54 26 8 268 2 cbs-2 Putative cystathionine beta-synthase cbs-2 Caenorhabditis elegans
P55708 6.24e-33 126 31 7 305 3 NGR_a00730 Putative cysteine synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9YBL2 5.31e-23 100 31 10 287 1 cysO Protein CysO Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q79FV4 9.01e-21 94 30 9 300 1 cysK2 S-sulfocysteine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q59918 1.33e-20 89 32 3 149 3 cysK Cysteine synthase (Fragment) Staphylococcus haemolyticus
O69652 2.55e-14 75 24 8 316 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U908 2.55e-14 75 24 8 316 1 cds1 L-cysteine desulfhydrase Cds1 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q58860 3.78e-12 69 27 12 295 3 thrC Threonine synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P04990 8.71e-11 65 25 9 320 3 thrC Threonine synthase Bacillus subtilis (strain 168)
C1FW07 1.2e-09 62 26 14 319 1 ortB 2-amino-4-ketopentanoate thiolase beta subunit Unknown prokaryotic organism
P09123 4.15e-09 60 28 11 302 3 thrC Threonine synthase Bacillus sp. (strain ULM1)
Q9CKJ2 9.12e-09 59 25 4 203 3 ilvA L-threonine dehydratase biosynthetic IlvA Pasteurella multocida (strain Pm70)
Q9GZT4 9.45e-09 59 22 7 286 1 SRR Serine racemase Homo sapiens
Q8TQD4 9.73e-09 59 27 11 293 1 thrC Threonine synthase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P45837 1.32e-08 58 34 5 143 3 thrC Threonine synthase Mycobacterium leprae (strain TN)
A1B8Z2 1.63e-08 58 26 8 226 1 bhcB beta-hydroxyaspartate dehydratase Paracoccus denitrificans (strain Pd 1222)
A0JNI4 4.19e-08 57 23 7 283 2 SRR Serine racemase Bos taurus
Q19374 4.5e-08 57 22 14 338 1 F13B12.4 Putative pyridoxal-phosphate dependent protein F13B12.4 Caenorhabditis elegans
A0R220 1.05e-07 56 25 10 313 1 thrC Threonine synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0FKE6 1.24e-07 56 27 4 205 1 TD1 Threonine dehydratase 1 biosynthetic, chloroplastic Solanum lycopersicum
Q9K7E3 1.95e-07 55 24 9 308 3 thrC Threonine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O94634 3.31e-07 55 26 4 199 3 SPBC1677.03c Threonine dehydratase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36007 4.03e-07 54 23 7 286 1 SRY1 L-threo-3-hydroxyaspartate ammonia-lyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9WYJ1 4.56e-07 54 28 8 233 1 TM_0356 L-threonine ammonia-lyase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7A5L8 9.74e-07 53 25 10 297 1 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain N315)
Q99U50 9.74e-07 53 25 10 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWQ4 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain MW2)
Q6G9C4 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain MSSA476)
Q6GGX0 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain MRSA252)
Q5HFY5 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain COL)
Q2FYJ3 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH01 9.92e-07 53 24 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain USA300)
P9WG59 1.06e-06 53 33 4 139 1 thrC Threonine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG58 1.06e-06 53 33 4 139 3 thrC Threonine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66903 1.06e-06 53 33 4 139 3 thrC Threonine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54HH2 1.25e-06 52 23 10 284 1 srr Serine racemase Dictyostelium discoideum
Q10725 2.72e-06 51 25 5 203 1 psdht Phenylserine dehydratase Ralstonia pickettii
Q04513 2.86e-06 52 26 8 303 3 ilvA L-threonine dehydratase biosynthetic IlvA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P46493 4.27e-06 51 26 4 194 3 ilvA L-threonine dehydratase biosynthetic IlvA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25306 4.42e-06 51 25 5 197 1 TD2 Threonine dehydratase 2 biosynthetic, chloroplastic Solanum lycopersicum
Q9ZSS6 8.57e-06 50 27 5 204 1 OMR1 Threonine dehydratase biosynthetic, chloroplastic Arabidopsis thaliana
Q2YY67 1.38e-05 49 23 9 297 3 tdcB L-threonine dehydratase catabolic TdcB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9CC54 1.72e-05 49 27 14 341 3 trpB Tryptophan synthase beta chain Mycobacterium leprae (strain TN)
Q9AXU4 3.02e-05 48 26 5 199 1 TD Threonine dehydratase Nicotiana attenuata
Q39469 3.23e-05 48 26 6 201 2 None Threonine dehydratase biosynthetic, chloroplastic Cicer arietinum
P20506 5.67e-05 48 28 7 197 3 ilvA L-Threonine dehydratase biosynthetic IlvA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q74FW6 8.75e-05 47 28 5 194 1 tdcB L-threonine ammonia-lyase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8CNK9 9.76e-05 47 25 7 209 3 ilvA L-threonine dehydratase biosynthetic IlvA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMF5 9.76e-05 47 25 7 209 3 ilvA L-threonine dehydratase biosynthetic IlvA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
V5Y0V0 0.00011 47 24 6 204 3 AKTS1-1 Threonine dehydratase-like protein AKTS1-1 Alternaria alternata
P04968 0.000174 46 28 7 197 1 ilvA L-threonine dehydratase biosynthetic IlvA Escherichia coli (strain K12)
O59791 0.00036 45 21 6 228 1 sry1 Serine racemase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P37946 0.000399 45 25 4 204 3 ilvA L-threonine dehydratase biosynthetic IlvA Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS07050
Feature type CDS
Gene cysM
Product cysteine synthase CysM
Location 1463570 - 1464451 (strand: -1)
Length 882 (nucleotides) / 293 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_229
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00291 Pyridoxal-phosphate dependent enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0031 Amino acid transport and metabolism (E) E Cysteine synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12339 S-sulfo-L-cysteine synthase (O-acetyl-L-serine-dependent) [EC:2.5.1.144] Cysteine and methionine metabolism
Metabolic pathways
Biosynthesis of amino acids		 -

Protein Sequence

MASISNVIGNTPLIRLARLSEGTGAEILVKTEGNNPGGSVKDRAAKSMIEGAQARGEICPGDTLIEATSGNTGIALAMIAAVRGYKLKLLMPENMSAERQAAMRAYGAELVLVSRAQGMEGARDLAQQMAAAGEGYVLDQFNNPDNPLAHYQTTGPEIWQQTDGRITHFVSAMGTTGTISGVGRYLKEVAPQVNITGLQPAENSQIPGIRRWSPGYLPGIFQPQLVDDILDITQQEAESTMRQLAQQEGIFCGVSSGGAVAGALKIAQTQPGAVIVAIICDRGDRYLSTGVFG

Flanking regions ( +/- flanking 50bp)

CGGGGCTGTGGCAGTATGGTTTGAGCTTACTTATTCAGAGGCAGAAAAACGTGGCATCGATCAGTAATGTAATCGGCAATACCCCGCTTATCCGGCTCGCCCGGCTGAGTGAGGGCACCGGGGCAGAAATCCTGGTAAAAACAGAGGGTAATAACCCCGGTGGCTCAGTAAAAGATCGCGCGGCAAAAAGCATGATTGAAGGTGCGCAGGCGCGTGGTGAAATTTGTCCGGGAGATACCCTGATAGAGGCGACCAGCGGAAATACCGGGATTGCGCTGGCAATGATCGCGGCAGTCAGAGGCTATAAATTAAAGCTGCTGATGCCGGAAAACATGAGTGCGGAGCGCCAGGCGGCAATGCGTGCTTACGGCGCGGAGCTGGTGCTGGTCAGCCGTGCGCAGGGTATGGAAGGGGCGCGGGATCTCGCGCAGCAGATGGCGGCGGCGGGTGAGGGTTATGTGCTTGATCAGTTTAATAACCCGGATAACCCGCTGGCGCATTATCAGACAACCGGACCGGAAATCTGGCAGCAGACAGACGGGCGCATCACGCATTTTGTGTCTGCAATGGGTACCACCGGGACGATCAGTGGTGTGGGGCGTTACCTGAAAGAAGTCGCACCACAGGTGAATATTACCGGGCTGCAACCGGCAGAAAACAGCCAGATACCGGGGATCCGCCGCTGGTCGCCGGGTTACCTGCCCGGTATTTTTCAGCCACAACTGGTGGATGATATTCTGGATATCACACAGCAGGAGGCGGAAAGCACCATGCGTCAACTGGCGCAGCAGGAGGGGATTTTCTGTGGTGTAAGTTCCGGCGGGGCGGTTGCCGGTGCGCTGAAGATTGCACAAACACAGCCCGGAGCTGTGATTGTGGCGATTATCTGTGATCGCGGAGACCGCTATCTCTCAACCGGCGTTTTTGGCTGATAATCAGCGCAACAATCTGTTCCCGCTACTCAGTGCCGGTATTTCATGTG