Homologs in group_679

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02570 FBDBKF_02570 88.0 Morganella morganii S1 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
EHELCC_03040 EHELCC_03040 88.0 Morganella morganii S2 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
NLDBIP_00420 NLDBIP_00420 88.0 Morganella morganii S4 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
LHKJJB_01615 LHKJJB_01615 88.0 Morganella morganii S3 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
HKOGLL_01655 HKOGLL_01655 88.0 Morganella morganii S5 ssnA Cytosine/adenosine deaminase or related metal-dependent hydrolase
PMI_RS06080 PMI_RS06080 79.2 Proteus mirabilis HI4320 - amidohydrolase

Distribution of the homologs in the orthogroup group_679

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_679

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0LMI3 3.85e-114 345 41 4 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2LUH4 7.72e-108 330 40 4 443 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Syntrophus aciditrophicus (strain SB)
Q2LTB7 2.01e-103 318 36 3 436 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Syntrophus aciditrophicus (strain SB)
B5YLB7 6.34e-102 314 37 4 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8PUQ3 6.17e-98 304 39 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TRA4 5.39e-97 301 39 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B8DKS6 2.17e-96 300 38 6 439 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B1I2P4 9.16e-94 293 38 7 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforudis audaxviator (strain MP104C)
Q466Q9 6.19e-92 288 38 7 434 3 dadD 5'-deoxyadenosine deaminase Methanosarcina barkeri (strain Fusaro / DSM 804)
A5D1G6 4.67e-91 286 38 9 431 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B8J2Q8 5.04e-91 286 36 6 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q3AC64 5.19e-90 283 39 9 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B0K2W0 2.28e-89 281 36 6 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter sp. (strain X514)
B0K8R8 2.28e-89 281 36 6 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q12WS1 1.3e-88 280 38 8 428 3 dadD 5'-deoxyadenosine deaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q1MR44 4.05e-88 279 35 5 435 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Lawsonia intracellularis (strain PHE/MN1-00)
Q0AYV2 6.64e-88 278 36 7 433 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q72B14 3.55e-86 274 35 5 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VD37 6.13e-86 273 35 5 441 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Nitratidesulfovibrio vulgaris (strain DP4)
Q67NQ5 1.53e-85 272 38 8 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B6YUF8 1.67e-85 271 38 8 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus onnurineus (strain NA1)
O66851 3.37e-85 271 37 3 388 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Aquifex aeolicus (strain VF5)
Q8R9L4 4.09e-85 271 37 7 418 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A4J675 4.6e-85 271 36 6 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B8CX03 8.01e-85 270 37 11 424 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
O27549 9.95e-85 270 37 8 405 3 dadD 5'-deoxyadenosine deaminase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B5YDN9 9.1e-84 267 37 10 429 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q8TYD4 1.67e-82 264 34 7 425 3 dadD 5'-deoxyadenosine deaminase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q2NHL6 1.67e-82 264 38 7 389 3 dadD 5'-deoxyadenosine deaminase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
C1EPN0 2.44e-82 264 35 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain 03BB102)
B8E183 4.6e-82 263 40 6 380 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
C6A048 1.14e-81 261 37 8 411 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus sibiricus (strain DSM 12597 / MM 739)
A5UMN6 1.52e-81 261 35 8 438 3 dadD 5'-deoxyadenosine deaminase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A0RCM7 2.49e-81 261 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis (strain Al Hakam)
B7JJI0 6.75e-81 260 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH820)
Q81S14 6.75e-81 260 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis
C3L6N3 6.75e-81 260 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P768 6.75e-81 260 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus anthracis (strain A0248)
Q81F14 8.63e-81 259 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HMN9 1.04e-80 259 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain AH187)
O31352 3.74e-80 258 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HK87 5.49e-80 258 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63CU1 5.49e-80 258 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain ZK / E33L)
B7IS56 6.52e-80 257 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain G9842)
C5BSJ0 9.92e-80 257 34 4 436 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5JER0 2.51e-79 255 36 8 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B7HIQ2 5.72e-79 255 34 8 428 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cereus (strain B4264)
Q24UA2 4.77e-78 252 36 8 420 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain Y51)
A7GNR9 4.95e-78 253 33 8 426 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8FRL9 8.23e-78 252 36 8 420 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q2RJW1 1.21e-76 249 37 7 422 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q58936 3.44e-76 247 36 9 415 1 dadD 5'-deoxyadenosine deaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O59184 1.11e-73 241 35 4 377 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9V0Y5 7.22e-73 239 36 6 378 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus abyssi (strain GE5 / Orsay)
Q8U0P7 8.44e-73 238 35 6 382 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q21IS0 1.35e-72 239 33 4 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q891Y7 2.56e-71 235 32 7 423 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Clostridium tetani (strain Massachusetts / E88)
A4XJI3 2.7e-71 235 33 9 437 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A6VH76 3.61e-71 234 34 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A9A9H3 8.43e-70 231 35 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q9HN51 1.35e-69 230 36 9 443 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
A4FW32 1.43e-69 230 35 8 381 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A6UQD4 2.31e-69 229 34 8 381 3 dadD 5'-deoxyadenosine deaminase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q3ITF7 2.35e-68 227 35 12 432 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A3DEQ2 3.31e-68 227 32 6 434 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5UYR3 1.63e-67 225 35 9 424 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A7I6C5 1.78e-67 225 35 8 396 3 dadD 5'-deoxyadenosine deaminase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A6UUG9 2.27e-67 224 33 8 388 3 dadD 5'-deoxyadenosine deaminase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q6LX61 2.76e-67 224 34 8 382 3 dadD 5'-deoxyadenosine deaminase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q9KC82 5.57e-65 219 32 11 442 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0B7V2 5.74e-64 215 33 10 403 3 dadD 5'-deoxyadenosine deaminase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
Q2FRU6 1.9e-63 215 35 10 408 3 dadD 5'-deoxyadenosine deaminase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q5WGA8 4.49e-62 211 32 9 427 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Shouchella clausii (strain KSM-K16)
O29265 1.5e-60 206 33 13 427 3 mtaD2 5-methylthioadenosine/S-adenosylhomocysteine deaminase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O29701 7.25e-59 202 32 10 408 3 mtaD1 5-methylthioadenosine/S-adenosylhomocysteine deaminase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q18EV7 6.06e-58 200 32 11 440 3 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q92342 1.74e-54 191 28 11 456 3 SPAC1F8.04c Uncharacterized protein C1F8.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9X034 3.66e-53 186 31 9 383 1 mtaD 5-methylthioadenosine/S-adenosylhomocysteine deaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P72156 6.03e-51 182 28 7 440 1 atzA Atrazine chlorohydrolase Pseudomonas sp. (strain ADP)
Q9EYU0 1.2e-49 179 28 7 440 1 triA Melamine deaminase Paracidovorax citrulli
Q52725 9.29e-32 130 33 0 192 1 trzA S-triazine hydrolase Gordonia rubripertincta
Q9I6Z0 2e-29 123 26 8 390 1 PA0142 8-oxoguanine deaminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q07729 5.41e-28 119 27 7 340 1 GUD1 Probable guanine deaminase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Y2T3 1.67e-22 103 23 10 371 1 GDA Guanine deaminase Homo sapiens
Q9WTT6 2.54e-22 102 25 9 336 1 Gda Guanine deaminase Rattus norvegicus
Q5RAV9 6.24e-22 101 24 8 336 2 GDA Guanine deaminase Pongo abelii
Q9R111 8.1e-22 101 24 9 338 1 Gda Guanine deaminase Mus musculus
Q9VMY9 1.65e-21 100 25 12 391 1 DhpD Guanine deaminase Drosophila melanogaster
P95442 2.52e-21 99 25 15 460 1 atzB Hydroxydechloroatrazine ethylaminohydrolase Pseudomonas sp. (strain ADP)
O14057 6.26e-21 99 25 12 383 3 SPCC1672.03c Probable guanine deaminase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P76641 2.68e-19 93 23 16 428 1 guaD Guanine deaminase Escherichia coli (strain K12)
Q86AW9 2.8e-19 93 22 12 384 1 guaD Guanine deaminase Dictyostelium discoideum
P0CI72 1.68e-17 88 25 14 384 1 None Isoxanthopterin deaminase Unknown prokaryotic organism
Q9RYX4 2.69e-16 84 24 9 377 3 guaD Probable guanine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q46812 3.56e-16 84 23 16 437 1 ssnA Putative aminohydrolase SsnA Escherichia coli (strain K12)
Q9HU77 2.45e-09 62 21 14 400 1 hutF Formimidoylglutamate deiminase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6MJP9 2.15e-08 59 33 4 134 3 hutI Imidazolonepropionase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A4J872 2.33e-07 57 23 15 390 3 ade Adenine deaminase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q9RW45 8.09e-06 51 20 8 324 1 DR_0824 Aminodeoxyfutalosine deaminase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6KX92 9e-06 51 21 14 412 3 hutI Imidazolonepropionase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q6ANH2 1.37e-05 51 27 4 143 3 ade1 Adenine deaminase 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7GQZ8 2.84e-05 50 38 2 78 3 hutI Imidazolonepropionase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A3MA48 3.11e-05 49 22 14 402 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P42358 3.8e-05 49 28 5 138 3 hutI Imidazolonepropionase (Fragment) Streptococcus gordonii
B7GUU8 5.46e-05 48 22 14 402 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain AB307-0294)
B7I268 8.18e-05 48 22 14 402 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain AB0057)
Q73RN8 8.22e-05 48 29 6 130 3 hutI Imidazolonepropionase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8RFG1 0.00011 48 32 3 104 3 hutI Imidazolonepropionase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A9VPT6 0.000145 47 36 1 76 3 hutI Imidazolonepropionase Bacillus mycoides (strain KBAB4)
B7ISJ0 0.000178 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain G9842)
B2I2C1 0.00025 47 21 14 402 3 hutI Imidazolonepropionase Acinetobacter baumannii (strain ACICU)
Q81AC8 0.00025 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HFF1 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9IUG8 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain Q1)
B7HKI9 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH187)
B7JI78 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain AH820)
Q81Y47 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus anthracis
C3L984 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4M0 0.00028 47 38 1 76 3 hutI Imidazolonepropionase Bacillus anthracis (strain A0248)
Q733I0 0.000283 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ATCC 10987 / NRS 248)
C1EN91 0.00029 47 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain 03BB102)
A0RH37 0.00029 47 38 1 76 3 hutI Imidazolonepropionase Bacillus thuringiensis (strain Al Hakam)
Q18C47 0.000351 46 34 3 75 3 pyrC Dihydroorotase Clostridioides difficile (strain 630)
Q637I0 0.000423 46 38 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain ZK / E33L)
Q6AKP5 0.000471 46 30 5 135 3 hutI Imidazolonepropionase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B7HCC8 0.000526 45 36 1 76 3 hutI Imidazolonepropionase Bacillus cereus (strain B4264)
A8AZ63 0.000583 45 28 5 138 3 hutI Imidazolonepropionase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05000
Feature type CDS
Gene -
Product amidohydrolase
Location 1064977 - 1066377 (strand: -1)
Length 1401 (nucleotides) / 466 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_679
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01979 Amidohydrolase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0402 Nucleotide transport and metabolism (F)
General function prediction only (R)		 FR Cytosine/adenosine deaminase or related metal-dependent hydrolase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12960 5-methylthioadenosine/S-adenosylhomocysteine deaminase [EC:3.5.4.31 3.5.4.28] Cysteine and methionine metabolism
Metabolic pathways		 -

Protein Sequence

MSLSRSACVVTLLAAACSAYAATPADLMITDGTVLTMNPENQVIEHGTVVINANKIIAVGGPELADKYQAKKILNAEGDIVMPGLINTHTHGSMTVFRSLGDDVPDRLHRYIFPLENKLVSRDMVRIGANLANIEMIKGGVTTYVDMYYFEDEVAKTVDKIGLRAVLGETIINFPVADAKNADEGIAYAVRFIKEYKNHPRITPAFAPHAPYTNTTENLQKIAALSLELDVPVITHLAETDREKEEIAKRTGGKSPVQYMADIGVLNHKLLAAHVIMADDNDLALLKQYDVGVAHNISANTKSAKGVAPVTAMLEKGIRVGLGTDGPMSSNTLTTMNELGLVGKIHKLETKNRAAMPPLTVVEMATMGSARALHMEDKLGSLEPGKLADIIVVDTKAPNMVPMYNAFAALVYGANGANVRHTIVDGNILMEDRKLLTTDEASIIKDAQIFADKVRETVLASGEEVK

Flanking regions ( +/- flanking 50bp)

ACATAAGAGGCAATGGTATATTGGTTTTTTCAGCCCTGTTTGAGGTTTTTATGTCATTATCCCGCTCCGCCTGTGTTGTTACCCTGCTTGCCGCTGCCTGTTCTGCTTATGCTGCCACGCCCGCCGACCTGATGATCACTGACGGAACGGTTCTGACAATGAACCCGGAAAATCAGGTCATTGAACATGGCACGGTGGTAATTAATGCCAATAAAATAATTGCTGTCGGCGGACCGGAACTGGCGGATAAATATCAGGCAAAAAAAATCCTCAATGCAGAGGGCGATATTGTGATGCCGGGGCTTATTAATACCCACACTCACGGCTCAATGACGGTTTTCCGCTCCCTCGGGGATGATGTTCCTGATCGCCTGCACCGCTATATTTTTCCGCTGGAAAATAAACTGGTTTCCCGCGACATGGTGCGGATTGGCGCAAATCTTGCCAATATTGAAATGATCAAAGGCGGCGTAACAACTTACGTCGATATGTATTATTTTGAGGATGAAGTCGCTAAAACAGTAGATAAAATTGGTCTGCGGGCAGTTCTGGGTGAAACCATCATTAATTTCCCGGTTGCAGATGCCAAAAATGCCGATGAAGGCATTGCTTATGCGGTGCGCTTTATTAAAGAATACAAAAACCATCCGCGCATTACACCGGCCTTTGCGCCACATGCACCTTATACCAATACCACTGAAAACTTACAGAAAATCGCGGCTCTGTCTCTGGAACTGGATGTGCCGGTAATCACGCATCTGGCGGAAACCGATCGCGAAAAAGAAGAAATAGCCAAACGCACCGGTGGTAAAAGCCCGGTTCAGTATATGGCGGATATCGGTGTGCTGAACCATAAATTACTGGCAGCGCACGTTATTATGGCTGATGACAACGATTTGGCGCTGTTGAAGCAATATGATGTCGGTGTGGCGCATAATATCAGCGCCAATACCAAATCCGCCAAAGGGGTTGCGCCGGTAACCGCCATGCTGGAGAAAGGGATCCGTGTCGGGCTCGGTACGGATGGTCCTATGTCATCCAACACACTGACGACGATGAATGAACTCGGGCTGGTGGGTAAGATCCACAAACTGGAAACCAAAAACCGCGCTGCAATGCCGCCACTGACAGTGGTTGAAATGGCAACAATGGGCTCAGCCCGTGCACTGCACATGGAAGATAAACTCGGCTCGCTGGAACCGGGCAAGCTGGCAGACATCATTGTGGTGGATACCAAAGCGCCGAATATGGTTCCGATGTATAACGCGTTTGCTGCCCTGGTATACGGCGCAAACGGGGCGAATGTTCGTCACACCATTGTGGACGGCAACATTTTGATGGAAGACCGCAAATTACTGACCACAGATGAAGCATCCATTATTAAGGACGCACAGATTTTTGCCGACAAAGTCCGTGAAACTGTGCTGGCATCAGGGGAAGAGGTGAAATGACCGAAAAATTAAAGTGCGCATTGATTTATGATTTTGACGGCACATTAGCC