Homologs in group_2553

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02280 FBDBKF_02280 94.5 Morganella morganii S1 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
EHELCC_02750 EHELCC_02750 94.5 Morganella morganii S2 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
NLDBIP_00710 NLDBIP_00710 94.5 Morganella morganii S4 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
LHKJJB_01325 LHKJJB_01325 94.5 Morganella morganii S3 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
HKOGLL_01365 HKOGLL_01365 94.5 Morganella morganii S5 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG

Distribution of the homologs in the orthogroup group_2553

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2553

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57060 1.8e-94 280 53 1 248 4 HI_0095 Uncharacterized protein HI_0095 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9FR44 1.21e-14 76 28 5 181 1 NMT1 Phosphoethanolamine N-methyltransferase 1 Arabidopsis thaliana
A6VDI6 1.02e-13 72 37 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain PA7)
Q944H0 1.05e-13 73 27 4 181 1 NMT2 Phosphoethanolamine N-methyltransferase 2 Arabidopsis thaliana
Q1I3T0 1.46e-13 71 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas entomophila (strain L48)
Q9HUC0 1.48e-13 71 37 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02EV4 1.48e-13 71 37 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V3F6 1.48e-13 71 37 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain LESB58)
Q8KZ94 3.09e-13 71 31 1 127 1 rebM Demethylrebeccamycin-D-glucose O-methyltransferase Lentzea aerocolonigenes
B1J2S8 3.2e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain W619)
B0KM36 3.24e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain GB-1)
Q9Z439 4.4e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida
Q3KJC5 4.62e-13 70 35 4 134 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain Pf0-1)
C3K8U4 5.52e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain SBW25)
Q88D17 5.92e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WA45 5.92e-13 70 34 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C1DHS2 8.64e-13 69 35 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9C6B9 8.95e-13 70 28 5 180 1 NMT3 Phosphoethanolamine N-methyltransferase 3 Arabidopsis thaliana
A4XPM7 1.27e-12 68 37 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas mendocina (strain ymp)
Q9P3R1 1.3e-12 70 30 5 163 3 erg-4 Sterol 24-C-methyltransferase erg-4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9Z5E9 1.86e-12 67 34 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE (Fragment) Pseudomonas oleovorans
Q87UZ2 3.96e-12 67 36 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZZG3 4.12e-12 67 36 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. syringae (strain B728a)
Q48PJ4 4.12e-12 67 36 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8TJK1 5.06e-12 67 29 4 154 1 arsM Arsenite methyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A8G8B8 1.85e-11 65 32 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Serratia proteamaculans (strain 568)
I1RGC4 1.98e-11 66 30 5 179 2 FG02783.1 Sterol 24-C-methyltransferase ERG6A Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q21H69 2.53e-11 65 32 4 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
G0FUS0 2.78e-11 65 31 1 114 1 RAM_03320 27-O-demethylrifamycin SV methyltransferase Amycolatopsis mediterranei (strain S699)
Q9M571 2.93e-11 66 27 5 181 1 PEAMT Phosphoethanolamine N-methyltransferase Spinacia oleracea
A7MTX1 3.42e-11 65 33 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio campbellii (strain ATCC BAA-1116)
B4EWC9 3.54e-11 65 31 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Proteus mirabilis (strain HI4320)
C8YTM5 3.81e-11 66 24 4 178 1 PEAMT2 Phosphoethanolamine N-methyltransferase Triticum aestivum
Q87TH4 4.11e-11 64 32 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0A1D6NER6 4.17e-11 65 24 4 180 2 PEAMT1 Phosphoethanolamine N-methyltransferase 1 Zea mays
A4VGE5 4.71e-11 64 33 3 136 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stutzerimonas stutzeri (strain A1501)
A0A0E0SMA3 5.35e-11 65 31 4 134 2 ERG6B Sterol 24-C-methyltransferase ERG6B Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q88SI6 5.99e-11 63 30 3 140 3 menG Demethylmenaquinone methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A1SRS4 6.17e-11 64 33 4 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9KJ20 7.63e-11 65 30 1 110 1 None Glycine/sarcosine/dimethylglycine N-methyltransferase Actinopolyspora halophila
A1JIF2 1.04e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C1DCV3 1.13e-10 63 35 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Laribacter hongkongensis (strain HLHK9)
Q8VYX1 1.42e-10 64 25 5 182 1 PEAMT1 Phosphoethanolamine N-methyltransferase 1 Triticum aestivum
B1JP75 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FT0 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR39 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis (strain Pestoides F)
Q1CNB4 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R431 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Angola)
Q8D1I3 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis
B2K0Y4 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDE0 1.59e-10 63 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7NZD3 1.99e-10 62 34 4 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B0TZP1 2.25e-10 62 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q9RRT0 2.39e-10 62 38 3 106 3 menG Demethylmenaquinone methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
L0E172 2.51e-10 63 30 4 153 3 phqN Methyltransferase phqN Penicillium fellutanum
Q74EU2 2.63e-10 62 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q24W96 2.76e-10 62 32 2 111 3 menG Demethylmenaquinone methyltransferase Desulfitobacterium hafniense (strain Y51)
Q1CBG0 4.18e-10 62 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Antiqua)
Q72HI4 4.51e-10 61 36 3 111 3 menG Demethylmenaquinone methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
O34954 6.78e-10 60 27 6 185 3 yodH Uncharacterized methyltransferase YodH Bacillus subtilis (strain 168)
B8DBZ5 6.95e-10 61 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
A3QIE1 7.12e-10 61 27 8 196 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KR07 8.4e-10 60 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella woodyi (strain ATCC 51908 / MS32)
Q4W9V1 8.63e-10 61 29 3 122 1 erg6 Sterol 24-C-methyltransferase erg6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5QYG2 9.16e-10 60 33 2 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A8G0S7 9.52e-10 60 26 6 188 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sediminis (strain HAW-EB3)
A0AK43 9.94e-10 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8IDQ9 1e-09 60 24 2 161 1 PMT Phosphoethanolamine N-methyltransferase Plasmodium falciparum (isolate 3D7)
P67055 1.02e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71Y84 1.02e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KWN1 1.02e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
P67056 1.02e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7MQ33 1.04e-09 60 31 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain YJ016)
Q8DDP9 1.04e-09 60 31 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain CMCP6)
B9LZA9 1.09e-09 60 29 3 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
C3LPS5 1.24e-09 60 31 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ6 1.24e-09 60 31 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4E5 1.24e-09 60 31 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VTA1 1.3e-09 60 32 6 145 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Marinomonas sp. (strain MWYL1)
B3PH48 1.43e-09 60 31 5 141 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cellvibrio japonicus (strain Ueda107)
A0Q549 1.5e-09 60 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. novicida (strain U112)
B2SFA2 2e-09 60 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. mediasiatica (strain FSC147)
C5BCA4 2.06e-09 59 31 3 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Edwardsiella ictaluri (strain 93-146)
B8CI06 2.08e-09 59 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0BNE2 2.18e-09 59 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain OSU18)
Q2A524 2.18e-09 59 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain LVS)
A7NAA1 2.18e-09 59 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A0A0A2IBN3 2.44e-09 60 30 3 146 1 cnsE O-methyltransferase cnsE Penicillium expansum
Q67LE6 2.59e-09 59 31 4 116 3 menG Demethylmenaquinone methyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A4IXH9 2.7e-09 59 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain WY96-3418)
B0TJ16 3.27e-09 59 30 3 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella halifaxensis (strain HAW-EB4)
C6DI77 4.15e-09 58 27 7 193 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6N3Y0 4.2e-09 59 28 4 156 1 arsM Arsenite methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6G1I2 4.74e-09 58 33 3 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella quintana (strain Toulouse)
C5BRL2 5.55e-09 58 32 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q05197 5.84e-09 57 33 2 102 4 pmtA Phosphatidylethanolamine N-methyltransferase Cereibacter sphaeroides
Q2SN12 6.59e-09 58 30 3 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hahella chejuensis (strain KCTC 2396)
Q12S23 7.31e-09 58 32 5 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9KYL8 7.38e-09 58 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS195)
A6WIE9 7.38e-09 58 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS185)
A3D9F2 7.38e-09 58 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q6DAQ7 7.6e-09 58 27 7 193 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8H966 7.82e-09 58 28 3 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q088H8 7.82e-09 58 32 5 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella frigidimarina (strain NCIMB 400)
B8E6B6 7.82e-09 58 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS223)
Q6G577 7.87e-09 58 35 3 106 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q96WX4 9.17e-09 58 27 3 123 1 erg6 Sterol 24-C-methyltransferase Pneumocystis carinii (strain B80)
A0A075D657 9.51e-09 58 25 4 151 1 PiNMT Picrinine-N-methytransferase Vinca minor
B4RK11 1.14e-08 57 33 5 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria gonorrhoeae (strain NCCP11945)
Q5F9R9 1.14e-08 57 33 5 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9CKD6 1.15e-08 57 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pasteurella multocida (strain Pm70)
O52025 1.25e-08 58 27 4 147 2 arsM Arsenite methyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q6ANL3 1.26e-08 57 29 8 185 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9JV83 1.26e-08 57 32 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K075 1.32e-08 57 32 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8E9R7 1.34e-08 57 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9ILA7 1.42e-08 57 34 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella tribocorum (strain CIP 105476 / IBS 506)
A1KT06 1.48e-08 57 32 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q5NFE1 1.57e-08 57 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GU4 1.57e-08 57 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain FSC 198)
A4SM99 1.59e-08 57 32 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aeromonas salmonicida (strain A449)
A1SAJ8 1.63e-08 57 26 7 191 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A1RP78 1.7e-08 57 31 5 128 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain W3-18-1)
A4Y2Q5 1.7e-08 57 31 5 128 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HZP7 1.71e-08 57 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-7)
Q0HEA1 1.71e-08 57 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-4)
A0L1M4 1.71e-08 57 29 5 138 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain ANA-3)
Q7MZ81 2.18e-08 57 28 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VG41 2.33e-08 57 26 3 146 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1UUE1 3.28e-08 56 34 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6C2D9 3.29e-08 57 29 3 127 3 ERG6 Sterol 24-C-methyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9KJ21 3.75e-08 56 25 4 156 1 None Sarcosine/dimethylglycine N-methyltransferase Halorhodospira halochloris
A9M3A0 3.78e-08 56 32 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup C (strain 053442)
Q9TYP1 3.8e-08 56 26 2 120 1 strm-1 Sterol 4-C-methyltransferase strm-1 Caenorhabditis elegans
Q9RMN9 3.92e-08 56 35 6 120 3 mtf2 Fatty-acid O-methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A7MQL7 4.24e-08 56 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cronobacter sakazakii (strain ATCC BAA-894)
Q9ZSK1 4.67e-08 56 31 1 101 1 VTE4 Tocopherol O-methyltransferase, chloroplastic Arabidopsis thaliana
O31474 5.62e-08 55 29 6 155 1 ycgJ Uncharacterized methyltransferase YcgJ Bacillus subtilis (strain 168)
B2AH07 9.73e-08 55 32 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q9LM02 1.06e-07 55 28 3 141 1 SMT1 Cycloartenol-C-24-methyltransferase Arabidopsis thaliana
Q8FUZ3 1.09e-07 55 35 4 105 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella suis biovar 1 (strain 1330)
Q0KEH6 1.1e-07 54 32 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A0A8X8M501 1.14e-07 55 27 1 101 1 TMT4 Picrinine-N-methytransferase TMT4 Catharanthus roseus
P64842 1.16e-07 55 30 5 130 3 BQ2027_MB1440C Uncharacterized protein Mb1440c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY7 1.16e-07 55 30 5 130 1 Rv1405c Uncharacterized protein Rv1405c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY6 1.16e-07 55 30 5 130 3 MT1449 Uncharacterized protein MT1449 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2Y6R0 1.19e-07 54 31 6 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A9MCZ2 1.23e-07 55 35 4 105 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P9WLW8 1.31e-07 54 26 2 130 3 MT1546 Uncharacterised methyltransferase MT1546 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O14321 1.32e-07 55 27 3 122 2 erg6 Sterol 24-C-methyltransferase erg6 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q759S7 1.41e-07 55 29 3 127 3 ERG6 Sterol 24-C-methyltransferase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q8YDE4 1.48e-07 54 35 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMK3 1.48e-07 54 35 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella melitensis biotype 2 (strain ATCC 23457)
Q576Q0 1.48e-07 54 35 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus biovar 1 (strain 9-941)
Q2YJM4 1.48e-07 54 35 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus (strain 2308)
B2SC50 1.48e-07 54 35 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus (strain S19)
A0A8X8M4T9 1.9e-07 54 26 2 119 1 TMT2 Picrinine-N-methytransferase TMT2 Catharanthus roseus
P9WLW9 2.28e-07 53 27 2 129 1 Rv1498c Uncharacterised methyltransferase Rv1498c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P59911 2.69e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4WFY5 2.69e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Enterobacter sp. (strain 638)
Q3ED65 2.88e-07 53 29 4 144 1 MENG 2-phytyl-1,4-beta-naphthoquinone methyltransferase, chloroplastic Arabidopsis thaliana
P74388 3.06e-07 53 33 3 112 1 sll0418 2-methyl-6-phytyl-1,4-hydroquinone methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3IJV7 3.68e-07 53 28 3 133 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudoalteromonas translucida (strain TAC 125)
P25087 3.81e-07 53 29 3 127 1 ERG6 Sterol 24-C-methyltransferase ERG6 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
H2E7T9 3.92e-07 53 30 4 118 2 SMT-2 Sterol methyltransferase-like 2 Botryococcus braunii
Q1R477 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain UTI89 / UPEC)
Q8FBJ0 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAM1 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AI22 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O1:K1 / APEC
B7N2E1 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O81 (strain ED1a)
B7MHC0 3.93e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O45:K1 (strain S88 / ExPEC)
B7GHP8 4.08e-07 53 27 3 117 3 menG Demethylmenaquinone methyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A0PQX0 4.25e-07 53 31 3 110 3 MUL_2377 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase 1 Mycobacterium ulcerans (strain Agy99)
Q3YVD2 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella sonnei (strain Ss046)
P0A889 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella flexneri
Q0SZ25 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella flexneri serotype 5b (strain 8401)
Q32A11 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella dysenteriae serotype 1 (strain Sd197)
Q31UF3 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella boydii serotype 4 (strain Sb227)
B2TVI4 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LM21 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain SMS-3-5 / SECEC)
B6I4H5 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain SE11)
B7NFD6 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A887 4.36e-07 53 30 2 122 1 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12)
B1IW72 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6U0 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O9:H4 (strain HS)
B1XAJ7 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12 / DH10B)
C5A009 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12 / MC4100 / BW2952)
B7M638 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O8 (strain IAI1)
B7NV33 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YY82 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A888 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O157:H7
B7L996 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain 55989 / EAEC)
B7UNG3 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZU40 4.36e-07 53 30 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O139:H28 (strain E24377A / ETEC)
A6WYI0 4.62e-07 53 35 4 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q2RKY6 4.95e-07 53 31 3 116 3 prmA Ribosomal protein L11 methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q606J9 5.36e-07 52 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q81ZZ8 8.27e-07 52 33 6 130 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6ZIK0 8.31e-07 52 28 1 101 2 VTE4 Probable tocopherol O-methyltransferase, chloroplastic Oryza sativa subsp. japonica
A0A8X8M4W6 1.07e-06 52 25 1 112 2 TMT3 Gamma-tocopherol methyltransferase, chloroplastic Catharanthus roseus
B7LU01 1.11e-06 52 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q5N4X9 1.12e-06 51 29 3 125 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31P90 1.12e-06 51 29 3 125 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0A075D5I4 1.2e-06 52 25 1 101 1 PiNMT Picrinine-N-methytransferase Rauvolfia serpentina
Q9CD86 1.26e-06 52 31 3 110 3 ML0130 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium leprae (strain TN)
P0A2K5 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2K6 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella typhi
B4TNX9 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella schwarzengrund (strain CVM19633)
B5BIX9 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi A (strain AKU_12601)
C0Q3E1 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi C (strain RKS4594)
A9MY97 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKP4 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZ73 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella newport (strain SL254)
B4TBR3 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella heidelberg (strain SL476)
B5RFM8 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW73 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella enteritidis PT4 (strain P125109)
B5FNW6 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella dublin (strain CT_02021853)
Q57HN8 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella choleraesuis (strain SC-B67)
B5EZU8 1.34e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella agona (strain SL483)
A9MIY3 1.39e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A9AWD7 1.56e-06 51 23 3 163 1 Haur_2147 (+)-O-methylkolavelool synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
C6E4U6 1.61e-06 51 28 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geobacter sp. (strain M21)
Q1LRG9 1.63e-06 51 29 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A8ACY2 1.69e-06 51 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q98GV1 1.7e-06 51 33 3 107 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q02PX7 1.87e-06 51 32 5 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2KUG1 1.88e-06 51 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella avium (strain 197N)
Q5YPB0 1.91e-06 51 32 3 116 3 menG Demethylmenaquinone methyltransferase Nocardia farcinica (strain IFM 10152)
Q7W0H1 1.94e-06 51 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3N6 1.94e-06 51 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF12 1.94e-06 51 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B2IUM7 2.08e-06 50 28 2 125 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A9N9F4 2.23e-06 50 23 5 197 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 331 / Henzerling II)
Q6ZIX2 2.45e-06 51 25 1 151 2 Smt1-1 Cycloartenol-C-24-methyltransferase 1 Oryza sativa subsp. japonica
P46326 2.58e-06 50 24 1 104 3 yxbB Uncharacterized protein YxbB Bacillus subtilis (strain 168)
B2JCU8 2.59e-06 50 31 4 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q9HZ63 2.65e-06 50 32 5 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9WW74 2.67e-06 50 34 3 104 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella suis (strain ATCC 23445 / NCTC 10510)
Q7VRJ1 2.68e-06 50 27 2 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Blochmanniella floridana
B7V9J5 2.7e-06 50 32 5 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain LESB58)
Q5KXU0 2.74e-06 50 26 6 175 3 menG Demethylmenaquinone methyltransferase Geobacillus kaustophilus (strain HTA426)
Q2T139 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63XA0 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain K96243)
A3N5U8 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 668)
Q3JVZ6 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 1710b)
A3NRJ4 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 1106a)
A1V753 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain SAVP1)
Q62MP4 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain ATCC 23344)
A2S8L1 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain NCTC 10229)
A3MNT8 2.85e-06 50 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain NCTC 10247)
B6J676 2.87e-06 50 26 2 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuK_Q154)
Q83A90 3.06e-06 50 23 5 197 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KD75 3.06e-06 50 23 5 197 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain Dugway 5J108-111)
B6J3P6 3.06e-06 50 23 5 197 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuG_Q212)
B9JZF4 4.09e-06 50 34 3 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
P9WJZ1 4.12e-06 50 29 4 148 1 Rv3030 Probable S-adenosylmethionine-dependent methyltransferase Rv3030 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJZ0 4.12e-06 50 29 4 148 3 MT3114 Probable S-adenosylmethionine-dependent methyltransferase MT3114 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0D3MJQ5 4.24e-06 50 26 4 145 1 arsM Arsenite methyltransferase Clostridium sp.
Q8A005 4.79e-06 50 28 3 111 3 menG Demethylmenaquinone methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P64840 4.83e-06 50 31 5 132 3 BQ2027_MB1438C Uncharacterized protein Mb1438c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY9 4.83e-06 50 31 5 132 3 Rv1403c Uncharacterized protein Rv1403c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY8 4.83e-06 50 31 5 132 3 MT1447 Uncharacterized protein MT1447 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A8X8M505 5.17e-06 50 23 4 147 1 PeNMT Perivine-Nbeta-methyltransferase Catharanthus roseus
A0QUV5 5.44e-06 50 32 3 102 1 MSMEG_2350 Probable S-adenosylmethionine-dependent methyltransferase MSMEG_2350/MSMEI_2290 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A6TGL3 5.5e-06 49 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYI1 5.71e-06 49 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Klebsiella pneumoniae (strain 342)
B3QLI9 6.18e-06 49 31 2 103 3 menG Demethylmenaquinone methyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q8D382 6.18e-06 49 26 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Wigglesworthia glossinidia brevipalpis
B2SX35 6.2e-06 49 33 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A8GPI0 6.89e-06 49 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia akari (strain Hartford)
P0CT10 7.19e-06 50 31 5 124 3 ERG6 Sterol 24-C-methyltransferase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
L7IP31 7.19e-06 50 31 5 124 2 ERG6 Sterol 24-C-methyltransferase Pyricularia oryzae (strain Y34)
Q64XV8 7.36e-06 49 28 4 129 3 menG Demethylmenaquinone methyltransferase Bacteroides fragilis (strain YCH46)
Q5LH04 7.36e-06 49 28 4 129 3 menG Demethylmenaquinone methyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q145P0 7.76e-06 49 33 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia xenovorans (strain LB400)
P9WIN3 7.83e-06 49 30 3 107 1 Rv2952 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIN2 7.83e-06 49 30 3 107 3 MT3026 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6W0 7.83e-06 49 30 3 107 3 MRA_2979 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KMU6 7.83e-06 49 30 3 107 3 BCG_2973 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TXK3 7.83e-06 49 30 3 107 3 BQ2027_MB2976 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q92SK7 8.01e-06 49 31 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium meliloti (strain 1021)
A8GXR2 9.74e-06 49 26 3 140 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain OSU 85-389)
Q1RJY5 1.02e-05 48 26 3 140 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain RML369-C)
Q475X0 1.05e-05 48 30 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9AFC0 1.37e-05 48 31 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia multivorans (strain ATCC 17616 / 249)
A5GA37 1.53e-05 48 27 3 114 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geotalea uraniireducens (strain Rf4)
A1K8Q1 1.63e-05 48 30 5 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azoarcus sp. (strain BH72)
Q8KF69 1.74e-05 48 31 2 103 3 menG Demethylmenaquinone methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2T4P1 1.81e-05 49 33 2 84 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B5EFL1 2.18e-05 48 27 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q6CYB3 2.44e-05 48 23 2 132 3 ERG6 Sterol 24-C-methyltransferase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q0BBY4 2.47e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YWF9 2.47e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia ambifaria (strain MC40-6)
P30866 2.49e-05 47 31 3 101 3 yafE Uncharacterized protein YafE Escherichia coli (strain K12)
Q1BTN4 2.64e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia orbicola (strain AU 1054)
A0KAF5 2.64e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia cenocepacia (strain HI2424)
Q39227 2.88e-05 48 27 3 115 1 SMT2 24-methylenesterol C-methyltransferase 2 Arabidopsis thaliana
Q54I98 3e-05 48 22 3 168 1 smt1 Probable cycloartenol-C-24-methyltransferase 1 Dictyostelium discoideum
A8GT99 3.09e-05 47 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Sheila Smith)
B0BUT9 3.09e-05 47 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Iowa)
B1JYJ6 3.27e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia orbicola (strain MC0-3)
B4EBC4 3.27e-05 47 30 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q16DL1 3.28e-05 47 26 7 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A8F2G9 3.3e-05 47 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia massiliae (strain Mtu5)
Q31IM5 3.32e-05 47 28 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q74LY0 3.38e-05 47 28 2 101 3 menG Demethylmenaquinone methyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
C3PLF4 3.4e-05 47 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia africae (strain ESF-5)
Q92GT5 3.63e-05 47 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6FRZ7 3.69e-05 47 26 3 128 3 ERG6 Sterol 24-C-methyltransferase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A4JHS6 3.69e-05 47 31 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia vietnamiensis (strain G4 / LMG 22486)
O86169 3.73e-05 47 25 6 175 3 menG Demethylmenaquinone methyltransferase Geobacillus stearothermophilus
Q8YLP4 4.11e-05 47 26 2 119 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q478R6 4.28e-05 47 31 6 129 3 prmA Ribosomal protein L11 methyltransferase Dechloromonas aromatica (strain RCB)
O53732 4.31e-05 47 25 3 137 1 ufaA1 Tuberculostearic acid methyltransferase UfaA1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q1GC56 4.67e-05 47 28 3 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Ruegeria sp. (strain TM1040)
W5U2K2 4.75e-05 47 25 2 110 1 NMT 3-hydroxy-16-methoxy-2,3-dihydrotabersonine N-methyltransferase Catharanthus roseus
C4L423 4.91e-05 47 25 5 147 3 prmA Ribosomal protein L11 methyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q2NYW4 4.96e-05 47 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4UMW4 5.07e-05 47 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5P7U3 5.47e-05 46 30 5 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A0PQ29 5.63e-05 47 29 3 114 3 MUL_2009 Probable phthiotriol/phenolphthiotriol dimycocerosates methyltransferase 2 Mycobacterium ulcerans (strain Agy99)
P31049 5.95e-05 47 26 1 111 3 None Probable fatty acid methyltransferase Pseudomonas putida
Q9KCC4 6.11e-05 46 26 3 117 3 menG Demethylmenaquinone methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZCP3 6.27e-05 46 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia prowazekii (strain Madrid E)
O26249 6.3e-05 46 29 5 122 1 cbiT Probable cobalt-precorrin-6B C(15)-methyltransferase (decarboxylating) Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q94JS4 6.47e-05 47 26 3 127 2 SMT3 24-methylenesterol C-methyltransferase 3 Arabidopsis thaliana
Q1BZC1 6.6e-05 47 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain AU 1054)
A0K4C9 6.6e-05 47 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain HI2424)
H2E7T8 6.66e-05 47 27 4 117 2 SMT-1 Sterol methyltransferase-like 1 Botryococcus braunii
Q55423 6.73e-05 46 26 2 116 3 sll0829 Uncharacterized methyltransferase sll0829 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q39JS9 6.79e-05 47 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4E5V2 6.79e-05 47 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
C3LLV3 6.83e-05 46 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KSJ9 6.83e-05 46 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F1U0 6.83e-05 46 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8UIH5 7e-05 46 33 4 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q68W57 7.41e-05 46 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8EZP4 7.62e-05 46 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia canadensis (strain McKiel)
Q0AA73 7.72e-05 46 28 9 202 3 ubiG Ubiquinone biosynthesis O-methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8P558 8.04e-05 46 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A1V0M1 8.08e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain SAVP1)
Q62GX2 8.08e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S5P8 8.08e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MRB1 8.08e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10247)
A6UFF7 8.31e-05 46 29 3 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Sinorhizobium medicae (strain WSM419)
A3NDQ7 8.38e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 668)
Q3JNI0 8.38e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 1710b)
Q63QN9 8.54e-05 46 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain K96243)
B0RCZ0 8.86e-05 46 32 3 102 3 menG Demethylmenaquinone methyltransferase Clavibacter sepedonicus
C3MCY6 8.95e-05 46 31 3 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q39D13 9.1e-05 46 29 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O13871 9.37e-05 46 26 4 130 3 SPAC1B3.06c Uncharacterized methyltransferase C1B3.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O74198 9.48e-05 46 26 4 129 1 ERG6 Sterol 24-C-methyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
C3K6J1 9.9e-05 45 31 4 108 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain SBW25)
A4FG18 0.000101 46 26 4 121 1 SACE_3721 Geranyl diphosphate 2-C-methyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B2UFG8 0.000103 46 29 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Ralstonia pickettii (strain 12J)
Q3MD91 0.000105 45 26 2 119 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
E3G327 0.000112 45 31 5 102 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Enterobacter lignolyticus (strain SCF1)
Q49XS5 0.000113 45 23 7 185 3 menG Demethylmenaquinone methyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1IDA6 0.000136 45 31 4 108 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas entomophila (strain L48)
Q8EXJ3 0.000137 45 30 3 108 3 menG Demethylmenaquinone methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q75FL1 0.000137 45 30 3 108 3 menG Demethylmenaquinone methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B4SJ34 0.000145 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stenotrophomonas maltophilia (strain R551-3)
Q87DI1 0.000148 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0U6V1 0.000148 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain M12)
B2IA21 0.000148 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain M23)
Q9CZB3 0.000152 46 26 3 125 2 Thumpd2 THUMP domain-containing protein 2 Mus musculus
Q491V7 0.000166 45 27 4 142 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Blochmanniella pennsylvanica (strain BPEN)
A9AI41 0.000167 45 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
A4JBD7 0.000188 45 30 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8Y278 0.000245 45 28 5 135 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
H2E7U0 0.00025 45 29 7 130 2 SMT-3 Sterol methyltransferase-like 3 Botryococcus braunii
B1JVC0 0.000254 45 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain MC0-3)
B5ZYK8 0.000259 45 33 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3SM81 0.000278 44 28 5 130 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Thiobacillus denitrificans (strain ATCC 25259)
P54458 0.000296 44 27 5 119 3 yqeM Putative methyltransferase YqeM Bacillus subtilis (strain 168)
Q5ZHP8 0.000318 45 25 2 120 2 METTL2 tRNA N(3)-methylcytidine methyltransferase METTL2 Gallus gallus
P59912 0.000331 44 28 3 124 3 menG Demethylmenaquinone methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B7VK72 0.000435 44 35 4 89 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Vibrio atlanticus (strain LGP32)
A4VLX7 0.000455 43 29 4 118 3 ubiG Ubiquinone biosynthesis O-methyltransferase Stutzerimonas stutzeri (strain A1501)
B9J7S8 0.000462 44 29 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q73AY2 0.000467 43 25 3 117 3 menG Demethylmenaquinone methyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
A6LRN8 0.00048 44 23 4 126 3 prmA Ribosomal protein L11 methyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A7GN50 0.000499 43 25 3 117 3 menG Demethylmenaquinone methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1MME0 0.000531 43 33 3 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2QM69 0.000538 44 26 7 165 2 Os12g0615400 2-methyl-6-phytyl-1,4-hydroquinone methyltransferase 2, chloroplastic Oryza sativa subsp. japonica
Q81FQ6 0.000584 43 26 3 117 3 menG Demethylmenaquinone methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HHR7 0.000584 43 26 3 117 3 menG Demethylmenaquinone methyltransferase Bacillus cereus (strain B4264)
B7IP91 0.000584 43 26 3 117 3 menG Demethylmenaquinone methyltransferase Bacillus cereus (strain G9842)
B5XV15 0.000587 44 30 3 91 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Klebsiella pneumoniae (strain 342)
Q9PAM5 0.000695 43 30 4 111 3 ubiG Ubiquinone biosynthesis O-methyltransferase Xylella fastidiosa (strain 9a5c)
A4IR29 0.000701 43 25 3 140 3 prmA Ribosomal protein L11 methyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q2SZE1 0.000712 43 29 6 127 3 prmA Ribosomal protein L11 methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3A209 0.000729 43 28 3 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q0BIF9 0.000795 43 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A8FEK9 0.000801 43 22 6 179 3 menG Demethylmenaquinone methyltransferase Bacillus pumilus (strain SAFR-032)
P9WKL5 0.000823 43 24 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKL4 0.000823 43 24 4 127 3 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZU0 0.000823 43 24 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KG37 0.000823 43 24 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
B4EZ30 0.000831 43 28 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Proteus mirabilis (strain HI4320)
Q8KCD5 0.000833 43 29 8 162 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B0KTX4 0.000838 43 29 5 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas putida (strain GB-1)
B1YSW5 0.000862 43 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain MC40-6)
Q67S51 0.000863 43 23 3 142 3 prmA Ribosomal protein L11 methyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A6TD57 0.00089 43 29 3 91 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C4K2K3 0.001 43 27 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia peacockii (strain Rustic)
Q65I24 0.001 43 31 3 102 3 menG Demethylmenaquinone methyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q15NR8 0.001 43 32 2 85 3 Patl_3970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04655
Feature type CDS
Gene -
Product class I SAM-dependent methyltransferase
Location 981947 - 982717 (strand: -1)
Length 771 (nucleotides) / 256 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2553
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF13649 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2230 Lipid transport and metabolism (I) I Cyclopropane fatty-acyl-phospholipid synthase and related methyltransferases

Protein Sequence

MESTHTGHEAGHKFLARLGKKRLRPGGRIATEWLLSHSGLQSDSRVLEIACNMGTTAIEIAQRFQCHITGIDMDKQALANARKNILQNGLSHLVTVQEADASKLPFPDNHFDVVINEAMLTMYADKAKARLVQEYLRVLKPGGRLLTHDIALTTPREEECVTQEMQAAIHVKAQPMLSDDWLALFRDAGFCDVIRSEGAMTLMTPKGMLHDEGITGTLNIIRNALKKENRPQFLQMFRHFRANRDRLRYIAVVSTK

Flanking regions ( +/- flanking 50bp)

AAATGCTGCTGGTGATGTTACGCGAACCGGAAACCAAATAGGATAAACTGATGGAAAGCACACACACAGGTCATGAAGCCGGACACAAATTTCTGGCGCGGCTGGGCAAAAAACGTCTGCGTCCCGGCGGACGGATTGCTACTGAATGGCTGCTGTCGCACAGCGGGCTGCAATCTGACAGCCGCGTACTGGAAATTGCCTGCAATATGGGTACGACAGCCATTGAAATTGCACAGCGCTTTCAGTGTCATATCACCGGTATTGATATGGATAAACAAGCACTTGCCAATGCGCGGAAAAATATTCTGCAAAACGGATTATCGCACCTGGTTACCGTGCAGGAAGCCGATGCCTCAAAACTGCCGTTTCCGGATAACCATTTTGATGTTGTGATTAATGAAGCAATGCTGACCATGTATGCAGATAAAGCCAAAGCACGTCTGGTACAGGAATATTTACGGGTACTGAAACCGGGCGGGCGTCTGCTGACACATGATATCGCCCTGACCACCCCGCGTGAGGAAGAGTGCGTCACACAGGAAATGCAGGCAGCAATCCACGTAAAAGCGCAGCCGATGCTCAGCGACGACTGGCTTGCCTTGTTCCGTGATGCCGGGTTTTGTGATGTGATCCGCTCTGAAGGTGCGATGACACTGATGACCCCGAAAGGCATGCTGCACGACGAAGGTATTACCGGTACACTGAACATAATCCGCAACGCACTGAAAAAAGAGAACCGCCCGCAGTTTTTACAGATGTTCCGCCACTTCCGGGCAAACCGCGACCGGCTGCGGTATATTGCGGTGGTCAGTACGAAGTAAGCCTGTGAAATATCGGGTTGTAAGGTAATATCAAAAAATAACAAATACAT