Homologs in group_2553

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_02750 EHELCC_02750 100.0 Morganella morganii S2 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
NLDBIP_00710 NLDBIP_00710 100.0 Morganella morganii S4 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
LHKJJB_01325 LHKJJB_01325 100.0 Morganella morganii S3 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
HKOGLL_01365 HKOGLL_01365 100.0 Morganella morganii S5 ubiE Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
F4V73_RS04655 F4V73_RS04655 94.5 Morganella psychrotolerans - class I SAM-dependent methyltransferase

Distribution of the homologs in the orthogroup group_2553

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2553

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q57060 3.18e-97 287 54 1 248 4 HI_0095 Uncharacterized protein HI_0095 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9FR44 2.02e-14 75 27 4 180 1 NMT1 Phosphoethanolamine N-methyltransferase 1 Arabidopsis thaliana
Q944H0 6.92e-14 74 26 4 178 1 NMT2 Phosphoethanolamine N-methyltransferase 2 Arabidopsis thaliana
Q9C6B9 1.35e-13 73 27 4 180 1 NMT3 Phosphoethanolamine N-methyltransferase 3 Arabidopsis thaliana
Q9P3R1 5.36e-13 71 30 5 163 3 erg-4 Sterol 24-C-methyltransferase erg-4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
C3K8U4 9.23e-13 69 39 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain SBW25)
Q8KZ94 1.39e-12 69 32 1 113 1 rebM Demethylrebeccamycin-D-glucose O-methyltransferase Lentzea aerocolonigenes
Q1I3T0 1.63e-12 68 38 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas entomophila (strain L48)
Q3KJC5 1.91e-12 68 39 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas fluorescens (strain Pf0-1)
A6VDI6 2.28e-12 68 37 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain PA7)
B0KM36 2.87e-12 68 38 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain GB-1)
C1DHS2 2.91e-12 68 36 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9Z439 2.98e-12 68 38 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida
B1J2S8 3.01e-12 68 38 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain W619)
A4XPM7 3.22e-12 67 39 4 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas mendocina (strain ymp)
Q9HUC0 3.22e-12 67 37 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02EV4 3.22e-12 67 37 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V3F6 3.22e-12 67 37 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas aeruginosa (strain LESB58)
Q4ZZG3 4.42e-12 67 40 4 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. syringae (strain B728a)
Q48PJ4 4.42e-12 67 40 4 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87UZ2 4.46e-12 67 40 4 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9KJ20 5.26e-12 68 31 1 110 1 None Glycine/sarcosine/dimethylglycine N-methyltransferase Actinopolyspora halophila
Q88D17 5.32e-12 67 38 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WA45 5.32e-12 67 38 2 111 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8TJK1 6.6e-12 67 28 4 154 1 arsM Arsenite methyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
I1RGC4 8.57e-12 67 28 7 224 2 FG02783.1 Sterol 24-C-methyltransferase ERG6A Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
C8YTM5 9.6e-12 67 24 4 178 1 PEAMT2 Phosphoethanolamine N-methyltransferase Triticum aestivum
Q9Z5E9 9.88e-12 65 37 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE (Fragment) Pseudomonas oleovorans
Q8IDQ9 1.17e-11 66 22 5 221 1 PMT Phosphoethanolamine N-methyltransferase Plasmodium falciparum (isolate 3D7)
A0A1D6NER6 2.23e-11 66 23 4 180 2 PEAMT1 Phosphoethanolamine N-methyltransferase 1 Zea mays
Q9RRT0 2.45e-11 65 41 3 103 3 menG Demethylmenaquinone methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A0A0E0SMA3 3.1e-11 66 31 4 134 2 ERG6B Sterol 24-C-methyltransferase ERG6B Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9M571 6.29e-11 65 25 5 181 1 PEAMT Phosphoethanolamine N-methyltransferase Spinacia oleracea
Q8VYX1 1.02e-10 64 24 4 178 1 PEAMT1 Phosphoethanolamine N-methyltransferase 1 Triticum aestivum
A7MTX1 1.13e-10 63 34 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio campbellii (strain ATCC BAA-1116)
A8G8B8 1.18e-10 63 31 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Serratia proteamaculans (strain 568)
B4EWC9 1.21e-10 63 31 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Proteus mirabilis (strain HI4320)
Q7NZD3 1.25e-10 63 36 4 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q72HI4 1.3e-10 62 36 3 111 3 menG Demethylmenaquinone methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q87TH4 1.35e-10 63 33 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q74EU2 1.57e-10 63 32 2 114 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
L0E172 1.59e-10 63 29 4 158 3 phqN Methyltransferase phqN Penicillium fellutanum
G0FUS0 1.65e-10 63 30 1 114 1 RAM_03320 27-O-demethylrifamycin SV methyltransferase Amycolatopsis mediterranei (strain S699)
Q67LE6 1.7e-10 63 32 5 127 3 menG Demethylmenaquinone methyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q24W96 3.41e-10 62 32 2 108 3 menG Demethylmenaquinone methyltransferase Desulfitobacterium hafniense (strain Y51)
B0TZP1 4.56e-10 61 32 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B9LZA9 5.23e-10 61 32 2 106 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q88SI6 5.61e-10 61 28 3 140 3 menG Demethylmenaquinone methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A1JIF2 6.85e-10 61 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B8DBZ5 7.36e-10 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
C1DCV3 8.23e-10 60 35 4 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Laribacter hongkongensis (strain HLHK9)
B1JP75 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FT0 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR39 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis (strain Pestoides F)
Q1CNB4 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Nepal516)
A9R431 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Angola)
Q8D1I3 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis
B2K0Y4 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDE0 8.4e-10 60 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4VGE5 8.54e-10 60 35 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stutzerimonas stutzeri (strain A1501)
Q4W9V1 9.39e-10 61 28 3 128 1 erg6 Sterol 24-C-methyltransferase erg6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O34954 9.91e-10 60 27 6 186 3 yodH Uncharacterized methyltransferase YodH Bacillus subtilis (strain 168)
A0AK43 1e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P67055 1.11e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71Y84 1.11e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KWN1 1.11e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
P67056 1.11e-09 60 32 3 114 3 menG Demethylmenaquinone methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q21H69 1.2e-09 60 28 4 167 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B3PH48 1.36e-09 60 33 3 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cellvibrio japonicus (strain Ueda107)
A0Q549 2.06e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. novicida (strain U112)
Q1CBG0 2.22e-09 59 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Yersinia pestis bv. Antiqua (strain Antiqua)
A1SRS4 2.36e-09 59 32 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B2SFA2 2.72e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. mediasiatica (strain FSC147)
Q6G577 3.27e-09 59 35 3 114 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5QYG2 3.33e-09 59 33 2 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0BNE2 3.36e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain OSU18)
Q2A524 3.36e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain LVS)
A7NAA1 3.36e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q96WX4 3.46e-09 60 26 8 196 1 erg6 Sterol 24-C-methyltransferase Pneumocystis carinii (strain B80)
C5BCA4 3.49e-09 59 34 3 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Edwardsiella ictaluri (strain 93-146)
A4IXH9 3.53e-09 59 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain WY96-3418)
Q7MQ33 3.7e-09 59 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain YJ016)
Q8DDP9 3.7e-09 59 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio vulnificus (strain CMCP6)
C3LPS5 3.92e-09 59 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain M66-2)
Q9KVQ6 3.92e-09 59 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4E5 3.92e-09 59 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VTA1 4e-09 58 29 3 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Marinomonas sp. (strain MWYL1)
A0A0A2IBN3 4.09e-09 59 29 3 147 1 cnsE O-methyltransferase cnsE Penicillium expansum
A1UUE1 4.79e-09 58 35 3 114 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6N3Y0 5.32e-09 58 30 3 124 1 arsM Arsenite methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A9ILA7 5.58e-09 58 35 3 114 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6G1I2 7.65e-09 58 33 2 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bartonella quintana (strain Toulouse)
Q9KJ21 9.61e-09 58 26 5 159 1 None Sarcosine/dimethylglycine N-methyltransferase Halorhodospira halochloris
A8G0S7 9.65e-09 57 29 2 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sediminis (strain HAW-EB3)
Q9LM02 1.1e-08 58 28 6 161 1 SMT1 Cycloartenol-C-24-methyltransferase Arabidopsis thaliana
B4RK11 1.11e-08 57 36 5 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria gonorrhoeae (strain NCCP11945)
Q5F9R9 1.11e-08 57 36 5 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B1KR07 1.14e-08 57 30 4 127 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella woodyi (strain ATCC 51908 / MS32)
Q9RMN9 1.31e-08 57 34 3 106 3 mtf2 Fatty-acid O-methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6C2D9 1.46e-08 58 28 3 127 3 ERG6 Sterol 24-C-methyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
A0A8X8M4T9 1.54e-08 57 28 4 132 1 TMT2 Picrinine-N-methytransferase TMT2 Catharanthus roseus
C6DI77 1.6e-08 57 31 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q12S23 1.75e-08 57 33 4 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q2SN12 1.85e-08 57 33 3 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hahella chejuensis (strain KCTC 2396)
Q5NFE1 2.06e-08 57 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14GU4 2.06e-08 57 28 4 180 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Francisella tularensis subsp. tularensis (strain FSC 198)
A4SM99 2.1e-08 57 33 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aeromonas salmonicida (strain A449)
Q9K075 2.32e-08 56 36 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A3QIE1 2.33e-08 57 31 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CI06 2.44e-08 56 30 4 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9JV83 2.51e-08 56 36 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KT06 2.68e-08 56 36 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q6DAQ7 2.68e-08 56 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C5BRL2 3.29e-08 56 32 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q8FUZ3 3.3e-08 56 34 4 113 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella suis biovar 1 (strain 1330)
A9MCZ2 3.36e-08 56 34 4 113 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q05197 3.57e-08 55 32 2 102 4 pmtA Phosphatidylethanolamine N-methyltransferase Cereibacter sphaeroides
A0A8X8M501 3.83e-08 56 28 1 101 1 TMT4 Picrinine-N-methytransferase TMT4 Catharanthus roseus
B0TJ16 3.85e-08 56 29 3 132 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella halifaxensis (strain HAW-EB4)
Q6ANL3 3.99e-08 56 32 3 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q7MZ81 4e-08 56 29 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A9KYL8 4.04e-08 56 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS195)
A6WIE9 4.04e-08 56 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS185)
A3D9F2 4.04e-08 56 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS155 / ATCC BAA-1091)
A1RP78 4.2e-08 56 32 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain W3-18-1)
A4Y2Q5 4.2e-08 56 32 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8E6B6 4.24e-08 56 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella baltica (strain OS223)
Q9CKD6 4.65e-08 56 30 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pasteurella multocida (strain Pm70)
Q9ZSK1 4.67e-08 56 31 1 101 1 VTE4 Tocopherol O-methyltransferase, chloroplastic Arabidopsis thaliana
Q8YDE4 4.91e-08 56 34 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RMK3 4.91e-08 56 34 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella melitensis biotype 2 (strain ATCC 23457)
Q576Q0 4.91e-08 56 34 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus biovar 1 (strain 9-941)
Q2YJM4 4.91e-08 56 34 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus (strain 2308)
B2SC50 4.91e-08 56 34 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella abortus (strain S19)
Q3ED65 5.02e-08 55 29 6 157 1 MENG 2-phytyl-1,4-beta-naphthoquinone methyltransferase, chloroplastic Arabidopsis thaliana
A9M3A0 5.17e-08 55 36 3 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Neisseria meningitidis serogroup C (strain 053442)
P9WLW8 5.39e-08 55 27 2 130 3 MT1546 Uncharacterised methyltransferase MT1546 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2Y6R0 6.33e-08 55 33 5 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9TYP1 7.49e-08 55 28 2 114 1 strm-1 Sterol 4-C-methyltransferase strm-1 Caenorhabditis elegans
Q8E9R7 7.86e-08 55 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P9WLW9 8.25e-08 55 27 2 130 1 Rv1498c Uncharacterised methyltransferase Rv1498c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O14321 8.64e-08 55 25 4 142 2 erg6 Sterol 24-C-methyltransferase erg6 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O52025 8.84e-08 55 27 3 127 2 arsM Arsenite methyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q0HZP7 1.03e-07 55 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-7)
Q0HEA1 1.03e-07 55 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain MR-4)
A0L1M4 1.03e-07 55 31 4 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella sp. (strain ANA-3)
Q6ZIX2 1.06e-07 55 25 1 151 2 Smt1-1 Cycloartenol-C-24-methyltransferase 1 Oryza sativa subsp. japonica
A9N9F4 1.09e-07 54 31 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 331 / Henzerling II)
A7MQL7 1.19e-07 54 31 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cronobacter sakazakii (strain ATCC BAA-894)
B2VG41 1.2e-07 54 29 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P9WEU0 1.24e-07 55 25 10 243 1 iliD S-adenosyl-L-methionine-dependent Diels-Alderase iliD Hypocrea jecorina (strain QM6a)
P25087 1.28e-07 55 29 3 127 1 ERG6 Sterol 24-C-methyltransferase ERG6 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A075D657 1.41e-07 55 25 3 131 1 PiNMT Picrinine-N-methytransferase Vinca minor
B6J676 1.52e-07 54 31 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuK_Q154)
Q83A90 1.59e-07 54 31 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KD75 1.59e-07 54 31 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain Dugway 5J108-111)
B6J3P6 1.59e-07 54 31 2 118 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Coxiella burnetii (strain CbuG_Q212)
Q088H8 1.63e-07 54 32 4 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella frigidimarina (strain NCIMB 400)
A6WYI0 1.82e-07 54 34 4 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B2AH07 1.97e-07 53 33 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q759S7 1.98e-07 54 27 3 127 3 ERG6 Sterol 24-C-methyltransferase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A8H966 1.99e-07 54 28 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0KEH6 2.1e-07 53 33 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
H2E7T9 2.62e-07 54 29 3 117 2 SMT-2 Sterol methyltransferase-like 2 Botryococcus braunii
A0PQX0 2.68e-07 53 32 4 116 3 MUL_2377 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase 1 Mycobacterium ulcerans (strain Agy99)
A9AWD7 4.15e-07 53 24 2 149 1 Haur_2147 (+)-O-methylkolavelool synthase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q3IJV7 4.66e-07 53 31 2 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Pseudoalteromonas translucida (strain TAC 125)
B7GHP8 4.84e-07 52 28 3 109 3 menG Demethylmenaquinone methyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q6MHQ3 5.76e-07 52 32 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A1SAJ8 5.79e-07 52 27 6 181 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5YPB0 6.02e-07 52 32 2 112 3 menG Demethylmenaquinone methyltransferase Nocardia farcinica (strain IFM 10152)
Q9CD86 6.32e-07 52 32 4 124 3 ML0130 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium leprae (strain TN)
P59911 6.95e-07 52 33 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5KXU0 7.52e-07 52 31 3 106 3 menG Demethylmenaquinone methyltransferase Geobacillus kaustophilus (strain HTA426)
A9WW74 7.65e-07 52 33 3 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Brucella suis (strain ATCC 23445 / NCTC 10510)
A4WFY5 8.28e-07 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Enterobacter sp. (strain 638)
P46326 8.58e-07 52 25 1 104 3 yxbB Uncharacterized protein YxbB Bacillus subtilis (strain 168)
Q5N4X9 9.82e-07 52 33 5 127 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31P90 9.82e-07 52 33 5 127 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q98GV1 9.87e-07 52 33 3 115 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3YVD2 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella sonnei (strain Ss046)
P0A889 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella flexneri
Q0SZ25 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella flexneri serotype 5b (strain 8401)
Q32A11 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella dysenteriae serotype 1 (strain Sd197)
Q31UF3 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella boydii serotype 4 (strain Sb227)
B2TVI4 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LM21 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain SMS-3-5 / SECEC)
B6I4H5 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain SE11)
B7NFD6 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A887 1.12e-06 52 32 2 112 1 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12)
B1IW72 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6U0 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O9:H4 (strain HS)
B1XAJ7 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12 / DH10B)
C5A009 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain K12 / MC4100 / BW2952)
B7M638 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O8 (strain IAI1)
B7NV33 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YY82 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A888 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O157:H7
B7L996 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain 55989 / EAEC)
B7UNG3 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZU40 1.12e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O139:H28 (strain E24377A / ETEC)
Q81ZZ8 1.17e-06 51 35 6 120 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1R477 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli (strain UTI89 / UPEC)
Q8FBJ0 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAM1 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AI22 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O1:K1 / APEC
B7N2E1 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O81 (strain ED1a)
B7MHC0 1.17e-06 52 32 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia coli O45:K1 (strain S88 / ExPEC)
C6E4U6 1.68e-06 51 31 2 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geobacter sp. (strain M21)
O31474 1.71e-06 51 29 6 144 1 ycgJ Uncharacterized methyltransferase YcgJ Bacillus subtilis (strain 168)
O66128 1.92e-06 51 28 4 124 3 menG Demethylmenaquinone methyltransferase Micrococcus luteus
A0A8X8M4W6 2.06e-06 51 25 1 107 2 TMT3 Gamma-tocopherol methyltransferase, chloroplastic Catharanthus roseus
Q94JS4 2.21e-06 51 27 3 121 2 SMT3 24-methylenesterol C-methyltransferase 3 Arabidopsis thaliana
P9WIN3 2.27e-06 51 31 3 107 1 Rv2952 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIN2 2.27e-06 51 31 3 107 3 MT3026 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6W0 2.27e-06 51 31 3 107 3 MRA_2979 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KMU6 2.27e-06 51 31 3 107 3 BCG_2973 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TXK3 2.27e-06 51 31 3 107 3 BQ2027_MB2976 Phthiotriol/phenolphthiotriol dimycocerosates methyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2RKY6 2.32e-06 51 31 3 116 3 prmA Ribosomal protein L11 methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6ZIK0 2.57e-06 51 30 3 103 2 VTE4 Probable tocopherol O-methyltransferase, chloroplastic Oryza sativa subsp. japonica
B9JZF4 2.64e-06 50 35 3 108 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B2JCU8 2.66e-06 50 31 4 129 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2T139 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63XA0 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain K96243)
A3N5U8 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 668)
Q3JVZ6 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 1710b)
A3NRJ4 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia pseudomallei (strain 1106a)
A1V753 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain SAVP1)
Q62MP4 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain ATCC 23344)
A2S8L1 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain NCTC 10229)
A3MNT8 2.71e-06 50 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia mallei (strain NCTC 10247)
P64842 2.74e-06 50 31 4 112 3 BQ2027_MB1440C Uncharacterized protein Mb1440c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY7 2.74e-06 50 31 4 112 1 Rv1405c Uncharacterized protein Rv1405c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY6 2.74e-06 50 31 4 112 3 MT1449 Uncharacterized protein MT1449 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q606J9 2.97e-06 50 30 2 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1LRG9 3.04e-06 50 30 4 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B7LU01 3.05e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1GC56 3.49e-06 50 30 3 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Ruegeria sp. (strain TM1040)
P0A2K5 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2K6 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella typhi
B4TNX9 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella schwarzengrund (strain CVM19633)
B5BIX9 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi A (strain AKU_12601)
C0Q3E1 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi C (strain RKS4594)
A9MY97 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKP4 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZ73 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella newport (strain SL254)
B4TBR3 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella heidelberg (strain SL476)
B5RFM8 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW73 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella enteritidis PT4 (strain P125109)
B5FNW6 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella dublin (strain CT_02021853)
Q57HN8 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella choleraesuis (strain SC-B67)
B5EZU8 3.79e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella agona (strain SL483)
Q16DL1 3.83e-06 50 28 3 121 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q92SK7 3.84e-06 50 31 3 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium meliloti (strain 1021)
A9MIY3 3.97e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q39227 4.03e-06 50 28 3 121 1 SMT2 24-methylenesterol C-methyltransferase 2 Arabidopsis thaliana
Q2KUG1 4.09e-06 50 31 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella avium (strain 197N)
A8GPI0 4.2e-06 50 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia akari (strain Hartford)
O86169 4.23e-06 50 30 3 106 3 menG Demethylmenaquinone methyltransferase Geobacillus stearothermophilus
Q74LY0 4.45e-06 50 30 2 101 3 menG Demethylmenaquinone methyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q55214 4.54e-06 49 31 4 131 1 dauC Aklanonic acid methyltransferase DauC Streptomyces sp. (strain C5)
A8ACY2 4.61e-06 50 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P0CT10 4.64e-06 50 28 4 123 3 ERG6 Sterol 24-C-methyltransferase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
L7IP31 4.64e-06 50 28 4 123 2 ERG6 Sterol 24-C-methyltransferase Pyricularia oryzae (strain Y34)
Q5WGT4 5.1e-06 49 31 3 109 3 menG Demethylmenaquinone methyltransferase Shouchella clausii (strain KSM-K16)
P30866 5.36e-06 49 34 3 100 3 yafE Uncharacterized protein YafE Escherichia coli (strain K12)
B3QLI9 5.47e-06 49 32 2 101 3 menG Demethylmenaquinone methyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A0A075D5I4 5.61e-06 50 24 1 101 1 PiNMT Picrinine-N-methytransferase Rauvolfia serpentina
B2SX35 6.03e-06 49 33 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q9CZB3 6.14e-06 50 28 3 125 2 Thumpd2 THUMP domain-containing protein 2 Mus musculus
Q2NYW4 7.44e-06 49 29 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q145P0 8.06e-06 49 33 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Paraburkholderia xenovorans (strain LB400)
Q22993 8.23e-06 50 27 4 146 1 pmt-2 Phosphoethanolamine N-methyltransferase 2 Caenorhabditis elegans
Q7W0H1 8.24e-06 49 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3N6 8.24e-06 49 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF12 8.24e-06 49 30 4 123 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8A005 8.31e-06 49 27 3 129 3 menG Demethylmenaquinone methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q64XV8 8.88e-06 49 27 3 129 3 menG Demethylmenaquinone methyltransferase Bacteroides fragilis (strain YCH46)
Q5LH04 8.88e-06 49 27 3 129 3 menG Demethylmenaquinone methyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B2IUM7 9.95e-06 48 29 4 135 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
C4L423 1.03e-05 49 25 4 147 3 prmA Ribosomal protein L11 methyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q54I98 1.1e-05 49 24 1 121 1 smt1 Probable cycloartenol-C-24-methyltransferase 1 Dictyostelium discoideum
Q8D382 1.16e-05 48 26 2 126 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Wigglesworthia glossinidia brevipalpis
Q6FRZ7 1.37e-05 49 26 3 128 3 ERG6 Sterol 24-C-methyltransferase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A5GA37 1.38e-05 48 29 2 102 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Geotalea uraniireducens (strain Rf4)
A9AFC0 1.45e-05 48 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia multivorans (strain ATCC 17616 / 249)
A8GXR2 1.52e-05 48 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain OSU 85-389)
B5XYI1 1.54e-05 48 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Klebsiella pneumoniae (strain 342)
Q1RJY5 1.54e-05 48 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia bellii (strain RML369-C)
A6TGL3 1.61e-05 48 31 2 112 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8F2G9 1.64e-05 48 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia massiliae (strain Mtu5)
A8GT99 1.79e-05 48 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Sheila Smith)
B0BUT9 1.79e-05 48 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia rickettsii (strain Iowa)
Q6CYB3 1.87e-05 48 22 2 132 3 ERG6 Sterol 24-C-methyltransferase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A0A0D3MJQ5 1.94e-05 48 26 4 145 1 arsM Arsenite methyltransferase Clostridium sp.
C3PLF4 1.96e-05 48 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia africae (strain ESF-5)
Q8KF69 2e-05 48 32 2 103 3 menG Demethylmenaquinone methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q475X0 2.03e-05 48 31 4 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q92GT5 2.09e-05 48 29 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B5EFL1 2.16e-05 48 30 2 110 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q86BS6 2.25e-05 48 24 9 233 1 Mettl2 tRNA N(3)-methylcytidine methyltransferase Mettl2 Drosophila melanogaster
Q54818 2.29e-05 48 30 4 131 1 dnrC Aklanonic acid methyltransferase DnrC Streptomyces peucetius
Q0P5A2 2.36e-05 48 33 3 103 2 COQ5 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial Bos taurus
Q0BBY4 2.43e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YWF9 2.43e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia ambifaria (strain MC40-6)
Q1BTN4 2.47e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia orbicola (strain AU 1054)
A0KAF5 2.47e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia cenocepacia (strain HI2424)
A4JHS6 3.04e-05 47 31 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1JYJ6 3.04e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia orbicola (strain MC0-3)
B4EBC4 3.04e-05 47 30 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q3MD91 3.08e-05 47 28 2 119 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4UMW4 3.15e-05 47 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A0QUV5 3.46e-05 47 30 3 102 1 MSMEG_2350 Probable S-adenosylmethionine-dependent methyltransferase MSMEG_2350/MSMEI_2290 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9ZCP3 3.56e-05 47 31 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia prowazekii (strain Madrid E)
P31049 3.67e-05 47 26 1 111 3 None Probable fatty acid methyltransferase Pseudomonas putida
A0PQ29 3.71e-05 47 30 4 124 3 MUL_2009 Probable phthiotriol/phenolphthiotriol dimycocerosates methyltransferase 2 Mycobacterium ulcerans (strain Agy99)
A0A8X8M505 3.82e-05 47 21 4 147 1 PeNMT Perivine-Nbeta-methyltransferase Catharanthus roseus
Q8YLP4 4e-05 47 27 2 119 3 menG 2-phytyl-1,4-naphtoquinone methyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C3MCY6 4.07e-05 47 32 3 117 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q478R6 4.2e-05 47 29 9 172 3 prmA Ribosomal protein L11 methyltransferase Dechloromonas aromatica (strain RCB)
O53732 4.31e-05 47 25 2 123 1 ufaA1 Tuberculostearic acid methyltransferase UfaA1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B0RCZ0 4.46e-05 47 31 4 119 3 menG Demethylmenaquinone methyltransferase Clavibacter sepedonicus
Q8P558 4.65e-05 47 28 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8UIH5 4.66e-05 47 33 4 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Agrobacterium fabrum (strain C58 / ATCC 33970)
A8EZP4 4.75e-05 47 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia canadensis (strain McKiel)
P64840 4.75e-05 47 31 4 114 3 BQ2027_MB1438C Uncharacterized protein Mb1438c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WLY9 4.75e-05 47 31 4 114 3 Rv1403c Uncharacterized protein Rv1403c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WLY8 4.75e-05 47 31 4 114 3 MT1447 Uncharacterized protein MT1447 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q68W57 5.16e-05 47 30 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A6V2Q4 5.45e-05 46 31 5 122 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas aeruginosa (strain PA7)
Q4K8M4 5.87e-05 46 30 5 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B5ZYK8 5.9e-05 47 29 6 173 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q31IM5 6.23e-05 46 28 2 116 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B4SJ34 7.53e-05 46 28 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Stenotrophomonas maltophilia (strain R551-3)
O74198 7.98e-05 47 25 4 129 1 ERG6 Sterol 24-C-methyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2T4P1 7.98e-05 47 33 2 84 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1HTA6 8.01e-05 46 26 3 122 3 menG Demethylmenaquinone methyltransferase Lysinibacillus sphaericus (strain C3-41)
P59912 8.38e-05 46 30 3 117 3 menG Demethylmenaquinone methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q39D13 8.77e-05 46 29 3 122 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8KCD5 9.02e-05 46 30 7 144 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
W5U2K2 9.04e-05 46 24 2 110 1 NMT 3-hydroxy-16-methoxy-2,3-dihydrotabersonine N-methyltransferase Catharanthus roseus
Q8PPP2 9.24e-05 46 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xanthomonas axonopodis pv. citri (strain 306)
O13871 9.45e-05 46 26 4 130 3 SPAC1B3.06c Uncharacterized methyltransferase C1B3.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0QRH1 9.53e-05 45 28 3 121 3 menG Demethylmenaquinone methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WJZ1 9.57e-05 46 29 6 154 1 Rv3030 Probable S-adenosylmethionine-dependent methyltransferase Rv3030 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJZ0 9.57e-05 46 29 6 154 3 MT3114 Probable S-adenosylmethionine-dependent methyltransferase MT3114 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6BRB7 0.000109 46 25 3 121 3 ERG6 Sterol 24-C-methyltransferase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q7VRJ1 0.000115 45 25 2 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Blochmanniella floridana
A8FEK9 0.000115 45 23 6 180 3 menG Demethylmenaquinone methyltransferase Bacillus pumilus (strain SAFR-032)
Q0AA73 0.000124 45 28 6 170 3 ubiG Ubiquinone biosynthesis O-methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0UPF4 0.000138 45 28 5 130 3 tam Trans-aconitate 2-methyltransferase Methylobacterium sp. (strain 4-46)
P46597 0.000143 46 26 6 166 1 ASMT Acetylserotonin O-methyltransferase Homo sapiens
A1K8Q1 0.000145 45 29 5 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Azoarcus sp. (strain BH72)
A1JLA0 0.000167 45 29 4 117 3 ubiG Ubiquinone biosynthesis O-methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q87DI1 0.000173 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2IA21 0.000173 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain M23)
Q3K8T6 0.000176 45 31 4 108 3 ubiG Ubiquinone biosynthesis O-methyltransferase Pseudomonas fluorescens (strain Pf0-1)
B0U6V1 0.000181 45 27 2 119 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Xylella fastidiosa (strain M12)
O26249 0.000196 44 28 5 122 1 cbiT Probable cobalt-precorrin-6B C(15)-methyltransferase (decarboxylating) Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
C3LLV3 0.000202 45 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KSJ9 0.000202 45 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F1U0 0.000202 45 32 4 104 3 ubiG Ubiquinone biosynthesis O-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P54458 0.000216 45 28 5 119 3 yqeM Putative methyltransferase YqeM Bacillus subtilis (strain 168)
A4WVR7 0.000225 45 28 4 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q9BTF0 0.000226 45 25 3 125 1 THUMPD2 THUMP domain-containing protein 2 Homo sapiens
H2E7T8 0.00024 45 27 3 111 2 SMT-1 Sterol methyltransferase-like 1 Botryococcus braunii
Q7MVR7 0.00025 45 27 2 108 3 menG Demethylmenaquinone methyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RJE9 0.000265 44 27 2 108 3 menG Demethylmenaquinone methyltransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q1MME0 0.000271 44 28 6 173 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A4IR29 0.000279 45 25 3 140 3 prmA Ribosomal protein L11 methyltransferase Geobacillus thermodenitrificans (strain NG80-2)
A6L3D5 0.000282 44 26 3 125 3 menG Demethylmenaquinone methyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B2UFG8 0.000285 44 30 5 131 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Ralstonia pickettii (strain 12J)
B9J7S8 0.000305 44 27 6 173 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q1BZC1 0.000383 44 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain AU 1054)
A0K4C9 0.000383 44 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain HI2424)
B4E5V2 0.000393 44 31 5 121 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q63QN9 0.000401 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain K96243)
Q3A209 0.000403 44 30 3 113 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1V0M1 0.000408 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain SAVP1)
Q62GX2 0.000408 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S5P8 0.000408 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MRB1 0.000408 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10247)
A3NDQ7 0.000431 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 668)
Q3JNI0 0.000431 44 31 6 131 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 1710b)
Q39JS9 0.000435 44 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5ZHP8 0.000449 44 25 2 120 2 METTL2 tRNA N(3)-methylcytidine methyltransferase METTL2 Gallus gallus
Q2KDB0 0.000458 44 28 6 173 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5P7U3 0.00046 43 26 6 173 3 ubiG Ubiquinone biosynthesis O-methyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4FG18 0.000461 44 25 4 121 1 SACE_3721 Geranyl diphosphate 2-C-methyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q3J8U2 0.000465 43 30 5 116 3 ubiG Ubiquinone biosynthesis O-methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8EXJ3 0.00051 43 29 3 108 3 menG Demethylmenaquinone methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q75FL1 0.00051 43 29 3 108 3 menG Demethylmenaquinone methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B7VK72 0.000522 44 35 4 89 3 rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD Vibrio atlanticus (strain LGP32)
U2ZU49 0.000561 44 27 6 134 1 arsM Arsenite methyltransferase Pseudomonas alcaligenes (strain ATCC 14909 / DSM 50342 / JCM 20561 / NBRC 14159 / NCIMB 9945 / NCTC 10367 / 1577)
C4K2K3 0.000562 43 28 2 109 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Rickettsia peacockii (strain Rustic)
P9WKL5 0.000585 43 25 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKL4 0.000585 43 25 4 127 3 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZU0 0.000585 43 25 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KG37 0.000585 43 25 4 127 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A8GGX8 0.00059 43 28 3 114 3 ubiG Ubiquinone biosynthesis O-methyltransferase Serratia proteamaculans (strain 568)
Q67S51 0.000594 43 25 4 142 3 prmA Ribosomal protein L11 methyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A8LNK7 0.000645 43 27 4 124 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A1RGR7 0.000861 43 30 6 157 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella sp. (strain W3-18-1)
A4Y9L4 0.000861 43 30 6 157 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WRS8 0.000893 43 30 6 157 3 rlmI Ribosomal RNA large subunit methyltransferase I Shewanella baltica (strain OS185)
Q3SM81 0.001 43 29 5 130 3 ubiE Ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE Thiobacillus denitrificans (strain ATCC 25259)
A9AI41 0.001 43 29 5 128 3 prmA Ribosomal protein L11 methyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
A0A482NB13 0.001 43 29 5 133 1 iccD S-adenosyl-L-methionine-dependent Diels-Alderase iccD Talaromyces variabilis

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02280
Feature type CDS
Gene ubiE
Product Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG
Location 143953 - 144723 (strand: -1)
Length 771 (nucleotides) / 256 (amino acids)
In genomic island -

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2553
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF13649 Methyltransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2226 Coenzyme transport and metabolism (H) H Ubiquinone/menaquinone biosynthesis C-methylase UbiE/MenG

Protein Sequence

MESTHTGHEAGHKFLARLGKKRLRPGGRTATEWLLTHSGLQTDSRVLEIACNMGTTAIEIAQRFQCHITGIDMDKQALANARKNILANGLSHLITVQEADASKLPFPDNHFDVVINEAMLTMYADKAKARLLQEYLRVLKPGGRLLTHDIALTERREDECVTQEMQAAIHVKAQPMLSDDWLALFRDAGFRDVIRSEGAMTLMTPKGMLHDEGLAGTLKIIRNALKKENRPQFLQMFRHFRQNRDRLRYIAVVSTK

Flanking regions ( +/- flanking 50bp)

AAATGCTGCTGGTGATGTTACGTGAACCGGAAAACAAACAGGACTGAATAATGGAAAGCACACATACCGGTCATGAAGCCGGACACAAATTTCTGGCGCGTCTGGGTAAAAAACGTCTGCGCCCGGGTGGCCGCACCGCCACAGAATGGCTGCTGACACACAGCGGGTTACAGACTGACAGCCGGGTGCTGGAAATTGCCTGCAATATGGGTACCACCGCGATTGAAATCGCCCAGCGTTTTCAGTGTCATATTACCGGCATTGATATGGATAAACAGGCACTTGCCAATGCGAGGAAAAATATCCTCGCTAACGGGTTGTCGCACCTCATCACCGTGCAGGAAGCGGATGCCTCAAAACTGCCGTTCCCGGATAATCATTTTGATGTGGTGATCAATGAAGCCATGCTGACCATGTATGCGGACAAAGCCAAAGCCCGTCTGTTACAGGAATATCTGCGGGTACTGAAACCCGGCGGCCGTCTGCTGACCCACGATATCGCGCTGACAGAGCGGCGTGAGGATGAGTGTGTCACGCAGGAAATGCAGGCTGCCATTCATGTCAAAGCACAACCGATGCTGAGTGATGACTGGCTGGCACTGTTCCGTGACGCAGGTTTCCGTGATGTGATCCGCTCGGAGGGTGCGATGACACTGATGACACCGAAAGGTATGCTGCACGATGAGGGACTTGCCGGCACACTGAAAATCATCCGCAACGCCCTGAAAAAAGAGAACCGCCCGCAGTTTTTACAGATGTTCCGCCATTTCCGGCAGAATCGTGATCGCCTGCGCTATATTGCCGTTGTCAGTACAAAATAATAAGCAGTGAGGAATGTCGTGAAAAATGCACCGGATATTTTTTTCCGGTG