Homologs in group_701

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02025 FBDBKF_02025 87.3 Morganella morganii S1 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
EHELCC_02495 EHELCC_02495 87.3 Morganella morganii S2 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
NLDBIP_00965 NLDBIP_00965 87.3 Morganella morganii S4 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
LHKJJB_01070 LHKJJB_01070 87.3 Morganella morganii S3 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
HKOGLL_01110 HKOGLL_01110 87.3 Morganella morganii S5 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
PMI_RS05375 PMI_RS05375 72.8 Proteus mirabilis HI4320 cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB

Distribution of the homologs in the orthogroup group_701

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_701

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N556 0.0 523 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A6TB40 0.0 517 75 1 325 3 cmoB tRNA U34 carboxymethyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XPZ5 0.0 517 75 1 325 3 cmoB tRNA U34 carboxymethyltransferase Klebsiella pneumoniae (strain 342)
Q8ZNV1 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q2E3 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella paratyphi C (strain RKS4594)
A9MUB3 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57N91 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella choleraesuis (strain SC-B67)
B4SVF6 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella newport (strain SL254)
B4T804 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella heidelberg (strain SL476)
B5R145 0.0 510 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella enteritidis PT4 (strain P125109)
B4ETP0 0.0 510 73 0 323 3 cmoB tRNA U34 carboxymethyltransferase Proteus mirabilis (strain HI4320)
Q8Z5W0 0.0 508 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella typhi
B5FSM5 0.0 508 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella dublin (strain CT_02021853)
B5F3I4 0.0 508 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella agona (strain SL483)
B5R8D1 0.0 508 74 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B4TYS9 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella schwarzengrund (strain CVM19633)
B1LD00 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B1J0L7 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A172 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O9:H4 (strain HS)
B7NS47 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1RAR3 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain UTI89 / UPEC)
B7NBM2 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P76291 0.0 506 73 1 323 1 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain K12)
A1AC32 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O1:K1 / APEC
B1XHD9 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain K12 / DH10B)
C4ZQF5 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MW65 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O81 (strain ED1a)
B5YR16 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCH5 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O157:H7
B7MBT0 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7USP8 0.0 506 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5BH49 0.0 505 74 1 324 3 cmoB tRNA U34 carboxymethyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PMY9 0.0 505 74 1 324 3 cmoB tRNA U34 carboxymethyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4WBM8 0.0 505 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Enterobacter sp. (strain 638)
Q8FGQ5 0.0 505 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGW1 0.0 505 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LPH3 1.12e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0T3Q7 2e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella flexneri serotype 5b (strain 8401)
A7ZMZ6 2.16e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z2P7 2.21e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella sonnei (strain Ss046)
B7M2G2 2.21e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli O8 (strain IAI1)
B7L7S4 2.21e-180 504 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain 55989 / EAEC)
B6I1E9 3.73e-180 503 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Escherichia coli (strain SE11)
Q322J0 3.86e-180 503 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U4X2 3.86e-180 503 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32H78 1.19e-179 502 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
A9MNC7 1.22e-179 502 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83R57 4.11e-179 501 73 1 323 3 cmoB tRNA U34 carboxymethyltransferase Shigella flexneri
A8AFH0 2.02e-177 496 73 2 323 3 cmoB tRNA U34 carboxymethyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1JLL9 1.22e-175 492 71 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TJK9 5.24e-175 490 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pestis (strain Pestoides F)
Q1CJH4 5.24e-175 490 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYY2 5.24e-175 490 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CIB6 5.24e-175 490 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pestis
Q1C824 5.24e-175 490 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AU8 1.33e-174 489 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K315 1.33e-174 489 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2VJC1 1.47e-174 489 73 2 322 3 cmoB tRNA U34 carboxymethyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1JRM4 1.91e-174 489 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FID4 2.54e-174 488 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GFJ8 9.31e-173 484 70 1 323 3 cmoB tRNA U34 carboxymethyltransferase Serratia proteamaculans (strain 568)
C5B836 9.52e-173 484 71 1 323 3 cmoB tRNA U34 carboxymethyltransferase Edwardsiella ictaluri (strain 93-146)
A7MEB0 9.57e-171 479 69 1 323 3 cmoB tRNA U34 carboxymethyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q2NTJ8 2.77e-170 478 70 1 324 3 cmoB tRNA U34 carboxymethyltransferase Sodalis glossinidius (strain morsitans)
C6DFE2 1.3e-169 477 72 1 323 3 cmoB tRNA U34 carboxymethyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D482 2.36e-167 471 71 1 323 3 cmoB tRNA U34 carboxymethyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A0KIF5 1.81e-162 459 64 1 325 3 cmoB tRNA U34 carboxymethyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SPN8 1.23e-161 456 64 1 325 3 cmoB tRNA U34 carboxymethyltransferase Aeromonas salmonicida (strain A449)
Q87QV5 3.86e-161 455 65 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N1I8 3.97e-160 452 65 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q7MJ71 1.04e-158 449 63 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio vulnificus (strain YJ016)
Q8DAP0 1.04e-158 449 63 1 323 1 cmoB tRNA U34 carboxymethyltransferase Vibrio vulnificus (strain CMCP6)
Q6LT56 1.87e-154 438 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Photobacterium profundum (strain SS9)
C3LLK9 1.92e-154 438 62 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KSU3 1.92e-154 438 62 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F277 1.92e-154 438 62 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A6VMT0 3.2e-154 437 64 2 323 3 cmoB tRNA U34 carboxymethyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B7VMH7 3.25e-154 437 62 1 323 3 cmoB tRNA U34 carboxymethyltransferase Vibrio atlanticus (strain LGP32)
Q5E6A4 2.09e-153 436 62 1 323 3 cmoB tRNA U34 carboxymethyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0I1M1 7.39e-153 434 64 2 323 3 cmoB tRNA U34 carboxymethyltransferase Histophilus somni (strain 129Pt)
B1KHH0 7.57e-153 434 64 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
B0UVK6 9.1e-153 434 64 2 323 3 cmoB tRNA U34 carboxymethyltransferase Histophilus somni (strain 2336)
B5FCP7 1e-152 434 61 1 323 3 cmoB tRNA U34 carboxymethyltransferase Aliivibrio fischeri (strain MJ11)
P44167 6.38e-152 432 62 2 323 1 cmoB tRNA U34 carboxymethyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B6EGI9 1.08e-151 431 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Aliivibrio salmonicida (strain LFI1238)
A5UBW0 1.18e-151 431 63 2 323 3 cmoB tRNA U34 carboxymethyltransferase Haemophilus influenzae (strain PittEE)
B3H1F1 1.21e-151 431 63 3 322 3 cmoB tRNA U34 carboxymethyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BP95 1.65e-151 431 63 3 322 3 cmoB tRNA U34 carboxymethyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0H4 1.65e-151 431 63 3 322 3 cmoB tRNA U34 carboxymethyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F571 2.56e-151 430 64 3 321 3 cmoB tRNA U34 carboxymethyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
A5UEI8 2.77e-151 430 62 2 323 3 cmoB tRNA U34 carboxymethyltransferase Haemophilus influenzae (strain PittGG)
Q65UH7 5.16e-151 429 63 2 323 3 cmoB tRNA U34 carboxymethyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A8FUW3 5.16e-151 430 63 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella sediminis (strain HAW-EB3)
A1SST4 6.19e-151 429 61 1 323 3 cmoB tRNA U34 carboxymethyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4QK61 1.05e-150 429 62 2 323 3 cmoB tRNA U34 carboxymethyltransferase Haemophilus influenzae (strain 86-028NP)
C4LBH9 3.32e-150 427 61 1 323 3 cmoB tRNA U34 carboxymethyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q8EEE6 8.73e-149 424 62 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TSA0 2.26e-148 423 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella halifaxensis (strain HAW-EB4)
A3QEQ0 1.42e-147 421 62 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8H552 1.62e-147 421 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8CNX4 1.67e-147 421 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0HIZ8 3.89e-147 420 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella sp. (strain MR-4)
A0KWL2 3.89e-147 420 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella sp. (strain ANA-3)
Q0HUY4 4.48e-147 420 61 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella sp. (strain MR-7)
Q9CNT5 1.94e-146 418 61 2 323 3 cmoB tRNA U34 carboxymethyltransferase Pasteurella multocida (strain Pm70)
Q12N03 6.39e-146 417 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9L3I4 9.7e-146 416 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella baltica (strain OS195)
A6WNQ9 9.7e-146 416 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella baltica (strain OS185)
B8EA68 9.7e-146 416 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella baltica (strain OS223)
A3D474 1.47e-145 416 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A4Y6S2 3.53e-145 415 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RJQ9 6.24e-145 414 60 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella sp. (strain W3-18-1)
A1S6P5 1.29e-144 414 61 1 324 3 cmoB tRNA U34 carboxymethyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7VL50 1.68e-144 413 61 3 321 3 cmoB tRNA U34 carboxymethyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q081N2 3.59e-143 410 59 1 325 3 cmoB tRNA U34 carboxymethyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q3IIQ3 4.84e-141 404 59 2 319 3 cmoB tRNA U34 carboxymethyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q483D0 5.27e-139 399 55 3 323 3 cmoB tRNA U34 carboxymethyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C4K5W3 3.55e-132 382 55 2 324 3 cmoB tRNA U34 carboxymethyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q15NL3 1.03e-131 380 55 2 320 3 cmoB tRNA U34 carboxymethyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B4S0J9 9.68e-129 373 54 1 312 3 cmoB tRNA U34 carboxymethyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q1QUG3 5.84e-125 364 58 4 313 3 cmoB tRNA U34 carboxymethyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5R0Q5 1.48e-122 357 53 3 324 3 cmoB tRNA U34 carboxymethyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1J4E4 3.56e-114 336 53 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas putida (strain W619)
A1U4B9 5.51e-114 336 54 3 306 3 cmoB tRNA U34 carboxymethyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
C3K6Z3 2.16e-113 334 52 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas fluorescens (strain SBW25)
Q0VQX6 2.84e-113 333 57 3 291 3 cmoB tRNA U34 carboxymethyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4K6X6 4.78e-113 333 52 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5W8E5 2.99e-112 331 53 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1I5M7 3.37e-112 331 53 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas entomophila (strain L48)
Q88MX8 3.68e-112 331 53 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3K7D4 1.5e-111 329 52 7 325 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas fluorescens (strain Pf0-1)
B0KV20 2.53e-111 328 52 6 324 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas putida (strain GB-1)
Q21JL7 3.77e-111 328 48 2 326 3 cmoB tRNA U34 carboxymethyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2SJW1 1.54e-110 327 52 4 325 3 cmoB tRNA U34 carboxymethyltransferase Hahella chejuensis (strain KCTC 2396)
Q4ZPE5 1.67e-110 327 52 7 325 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q4FQB2 3.8e-110 327 52 4 322 3 cmoB tRNA U34 carboxymethyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q48EV7 1.18e-109 324 52 7 325 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87XG5 2.24e-109 323 52 7 325 1 cmoB tRNA U34 carboxymethyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C1DQS9 9.98e-109 322 51 6 324 3 cmoB tRNA U34 carboxymethyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B5EIQ6 1.31e-108 322 47 4 326 3 cmoB tRNA U34 carboxymethyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q31JJ8 1.57e-108 322 50 3 324 3 cmoB tRNA U34 carboxymethyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1Q8I5 2.23e-108 323 49 4 335 3 cmoB tRNA U34 carboxymethyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5WC55 5.58e-108 321 49 4 325 3 cmoB tRNA U34 carboxymethyltransferase Psychrobacter sp. (strain PRwf-1)
C6E229 1.15e-107 320 48 3 318 3 cmoB tRNA U34 carboxymethyltransferase Geobacter sp. (strain M21)
A4VIY1 2.02e-107 319 55 4 288 3 cmoB tRNA U34 carboxymethyltransferase Stutzerimonas stutzeri (strain A1501)
A4XSD0 4.49e-107 318 53 5 308 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas mendocina (strain ymp)
B3E6X8 4.64e-107 318 47 3 318 3 cmoB tRNA U34 carboxymethyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A6VAK2 5.58e-107 318 51 6 310 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas aeruginosa (strain PA7)
Q39SM2 6.65e-107 317 49 2 305 3 cmoB tRNA U34 carboxymethyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q603L5 2.25e-106 316 50 4 324 3 cmoB tRNA U34 carboxymethyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q02HS6 3.44e-106 316 52 5 308 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYW8 3.44e-106 316 52 5 308 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas aeruginosa (strain LESB58)
Q9I5G4 4.19e-106 315 52 5 308 3 cmoB tRNA U34 carboxymethyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B3PFU1 1.68e-104 311 47 2 322 3 cmoB tRNA U34 carboxymethyltransferase Cellvibrio japonicus (strain Ueda107)
C0QJG7 1.54e-82 255 44 3 282 3 cmoB tRNA U34 carboxymethyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q3A8E9 4.87e-82 254 45 3 280 3 cmoB tRNA U34 carboxymethyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1AVT4 2.97e-81 252 39 4 325 3 cmoB tRNA U34 carboxymethyltransferase Ruthia magnifica subsp. Calyptogena magnifica
A5EVQ5 3.19e-72 229 41 6 288 3 cmoB tRNA U34 carboxymethyltransferase Dichelobacter nodosus (strain VCS1703A)
Q6AIL0 1.38e-69 222 41 5 271 3 cmoB tRNA U34 carboxymethyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q10V92 2.63e-68 219 37 3 283 3 cmoB tRNA U34 carboxymethyltransferase Trichodesmium erythraeum (strain IMS101)
B9L8G5 1.64e-67 216 39 9 317 3 cmoB tRNA U34 carboxymethyltransferase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q30SA5 2.08e-67 216 39 5 278 3 cmoB tRNA U34 carboxymethyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q7MS89 1.41e-66 213 41 3 278 3 cmoB tRNA U34 carboxymethyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A8EUD5 2.13e-66 213 40 3 253 3 cmoB tRNA U34 carboxymethyltransferase Aliarcobacter butzleri (strain RM4018)
A7ZEA2 6.1e-66 212 39 5 274 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter concisus (strain 13826)
A7I1I7 6.86e-66 211 38 4 275 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q7VGI1 1.98e-63 206 35 5 289 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A6Q7V3 9.71e-62 201 37 4 283 3 cmoB tRNA U34 carboxymethyltransferase Sulfurovum sp. (strain NBC37-1)
A0RPV3 1.74e-61 200 40 3 240 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
A6Q3V1 2.72e-60 197 40 3 239 3 cmoB tRNA U34 carboxymethyltransferase Nitratiruptor sp. (strain SB155-2)
A7GXW7 2.18e-58 192 36 3 249 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter curvus (strain 525.92)
A1VZW5 5.23e-58 191 36 2 248 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q0P9S6 5.29e-58 191 36 2 248 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HUI4 1.08e-57 191 36 2 248 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter jejuni (strain RM1221)
A7H361 2.16e-57 190 36 3 249 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FM27 1.05e-56 188 37 3 247 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B2UUE3 1.13e-56 187 41 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain Shi470)
O25173 2.46e-56 186 41 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
B5Z809 4.75e-56 186 40 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain G27)
B6JMM9 6.56e-56 185 40 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain P12)
Q17Y58 1.1e-55 184 40 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter acinonychis (strain Sheeba)
Q9ZKH1 4.41e-55 183 40 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q1CSN0 6.63e-55 182 40 2 233 3 cmoB tRNA U34 carboxymethyltransferase Helicobacter pylori (strain HPAG1)
B9KFR5 8.66e-53 178 34 3 265 3 cmoB tRNA U34 carboxymethyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q1GCH8 2.05e-06 51 34 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria sp. (strain TM1040)
Q5LWM6 1.88e-05 48 34 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A8LQ43 2.59e-05 48 30 4 136 3 ubiG Ubiquinone biosynthesis O-methyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A0A0A2IBN3 8.89e-05 47 28 7 165 1 cnsE O-methyltransferase cnsE Penicillium expansum
Q28VP7 9.7e-05 46 31 4 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Jannaschia sp. (strain CCS1)
Q13EZ9 0.000104 46 32 3 94 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain BisB5)
A4YKT6 0.000104 46 30 3 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium sp. (strain ORS 278)
P44074 0.000113 46 30 2 114 4 HI_0912 Uncharacterized protein HI_0912 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3QCF3 0.000158 46 32 3 94 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q6NC69 0.000158 46 32 3 94 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q08A71 0.000195 46 25 7 192 2 PRMT6 Probable protein arginine N-methyltransferase 6 Arabidopsis thaliana
O74421 0.000295 45 33 5 114 3 coq3 Ubiquinone biosynthesis O-methyltransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q2J419 0.00031 45 32 3 94 3 ubiG Ubiquinone biosynthesis O-methyltransferase Rhodopseudomonas palustris (strain HaA2)
B9KPP7 0.000311 45 29 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q16D32 0.000373 45 30 3 120 3 ubiG Ubiquinone biosynthesis O-methyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A4WW91 0.00041 44 30 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q3IYM5 0.000457 44 29 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNM3 0.000519 44 29 4 121 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q89XU2 0.000542 44 33 3 89 3 ubiG Ubiquinone biosynthesis O-methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04390
Feature type CDS
Gene cmoB
Product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
Location 929831 - 930808 (strand: -1)
Length 978 (nucleotides) / 325 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_701
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08003 Protein of unknown function (DUF1698)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2227 Coenzyme transport and metabolism (H) H 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15257 tRNA (mo5U34)-methyltransferase [EC:2.1.1.-] - -

Protein Sequence

MIDFSDFYQLIAKNERLSCWLETLPAQLAQWQRESLHGYYPGWVKSIENLPDMTPHTLDLKNSVTATRDPVLNEGETRRITNILRNLMPWRKGPFSLYGVEIDTEWRSDWKWERVLPHLSPLAGRTVLDVGCGSGYHMWRMVGVGAELVVGVDPTQLFLCQFEAVRKLLGNDQRAHLLPLGIQELPALKAFDTVFSMGVLYHRRSPLDHLWQLKDQLVSGGELVLESIVIEGDEHQCLIPGDRYAQMSNVYFIPSAKMLAVWLEKCGFVNVRIVDESVTGTDEQRRTEWMINESLADYLDPENKLLTVEGYPAPRRAVLIAQKQE

Flanking regions ( +/- flanking 50bp)

GTTCCAGTGCTTTAATTTCGGGTCGCTGCTGGCAGTAAAAGAGAAATAACATGATTGATTTCAGTGATTTTTATCAGTTAATTGCAAAAAATGAACGTCTGAGCTGCTGGCTGGAAACCCTCCCGGCGCAGTTGGCACAATGGCAGCGGGAGTCTCTGCACGGCTACTATCCGGGCTGGGTCAAATCCATTGAAAACCTGCCGGACATGACACCCCACACACTTGATCTCAAAAACAGCGTCACCGCAACACGCGACCCTGTGCTGAATGAGGGCGAAACCCGGCGGATAACGAATATCCTGCGTAACCTGATGCCGTGGCGCAAAGGCCCGTTCTCTCTCTATGGCGTGGAAATTGATACAGAATGGCGCTCGGATTGGAAGTGGGAACGTGTGCTGCCGCACCTCTCACCGCTGGCGGGACGCACCGTACTGGATGTCGGCTGCGGCAGTGGTTATCACATGTGGCGCATGGTAGGTGTTGGTGCGGAACTGGTGGTCGGTGTCGATCCGACACAGCTTTTTCTCTGTCAGTTTGAAGCAGTGCGTAAGCTGCTCGGCAATGATCAGCGCGCACATCTGCTGCCGCTGGGTATTCAGGAGCTTCCTGCCCTGAAAGCCTTTGATACTGTCTTCTCCATGGGTGTTCTGTACCACCGCCGTTCCCCGCTCGACCACCTCTGGCAGTTAAAAGACCAGTTGGTCAGCGGCGGTGAACTGGTGCTGGAAAGCATTGTTATTGAAGGTGATGAACACCAGTGCCTTATCCCGGGTGACCGCTACGCGCAGATGAGTAATGTGTATTTTATTCCGTCCGCGAAAATGCTCGCCGTCTGGCTGGAAAAATGCGGCTTTGTCAATGTGCGGATTGTTGATGAGTCCGTCACCGGCACAGATGAACAGCGCCGGACAGAATGGATGATCAATGAATCACTGGCGGATTATCTTGATCCTGAGAATAAACTGCTGACCGTTGAAGGTTATCCGGCTCCCCGCCGGGCGGTTCTGATCGCACAAAAACAGGAATAATCCACCGGTATCGTCATTTTATTCTGAGATACCCTGCTTTGCGGGGTATC