Homologs in group_600

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01815 FBDBKF_01815 93.4 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
EHELCC_02285 EHELCC_02285 93.4 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_01175 NLDBIP_01175 93.4 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
LHKJJB_00860 LHKJJB_00860 93.4 Morganella morganii S3 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_00900 HKOGLL_00900 93.4 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
PMI_RS06935 PMI_RS06935 72.8 Proteus mirabilis HI4320 - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_600

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_600

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77730 0.0 546 55 1 465 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
P39389 1.1e-89 284 33 0 466 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
Q5HJR1 1.36e-53 189 27 9 452 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 1.36e-53 189 27 9 452 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 1.36e-53 189 27 9 452 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 2.13e-52 186 27 10 453 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 2.13e-52 186 27 10 453 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUS3 1.49e-51 183 27 10 453 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
P95957 2.33e-48 174 29 8 378 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q72LL6 4.98e-48 173 28 8 387 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q796Q6 5.37e-47 172 25 9 455 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
H3ZPL1 4.41e-42 157 27 5 377 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P96681 2.39e-39 151 24 10 479 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
Q08792 6.37e-37 144 25 7 389 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
O07578 3.63e-28 120 24 11 440 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
P49309 5.37e-28 119 23 9 444 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
P96669 4.39e-27 116 22 7 430 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
Q54K00 4.07e-25 110 23 7 351 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
Q8N5Z0 1.55e-23 105 24 8 324 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
O14192 5.2e-23 105 25 8 336 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5E9N4 5.49e-23 104 24 8 323 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
D5AKX9 5.02e-21 99 25 11 459 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P94426 9.28e-21 98 23 10 445 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
Q8NS92 1.56e-20 97 28 12 364 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P96663 3.4e-20 96 22 12 477 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
Q64602 4.31e-20 95 24 8 324 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q9Y7S6 7.3e-20 95 24 9 331 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q01856 1.16e-19 94 25 13 462 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9WVM8 4.56e-19 92 22 7 314 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
D4AU29 1.82e-18 91 23 11 355 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q0P5G4 3.52e-17 87 24 15 401 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
Q58FK9 5.61e-17 86 27 21 437 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
P10356 7.09e-17 86 25 6 244 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O52815 8.06e-17 85 26 9 337 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
O94570 8.68e-17 86 24 7 288 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A0P0VI36 9.2e-17 86 21 8 324 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
Q7T3E5 5.44e-16 83 24 16 397 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
P16524 1.53e-15 81 26 11 311 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q56232 3.07e-15 80 22 10 344 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q6YP21 3.85e-15 80 25 20 437 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
A7XRY8 5.37e-15 80 22 9 313 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4J8X2 1.19e-14 79 25 13 316 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q71RI9 1.22e-14 79 24 18 430 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
Q07262 2.22e-14 79 26 16 304 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
Q795M6 4.7e-14 77 22 11 336 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q60317 5.53e-14 77 22 7 291 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
E9F8L8 5.62e-14 77 26 6 255 1 swnA Aminotransferase swnA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q9SIE1 6e-14 77 22 12 340 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
Q86AG8 9.21e-14 77 21 8 321 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
O67781 1.31e-13 75 23 13 341 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
Q08432 4.72e-13 73 24 9 302 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
E9L7A5 7.49e-13 73 23 14 336 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
A0A0P0WIY3 8.32e-13 73 25 14 344 2 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Oryza sativa subsp. japonica
P31531 9.4e-13 73 24 13 305 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Glycine max
Q9X0Y2 2.46e-12 72 24 9 293 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O33822 2.61e-12 71 22 13 388 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q972A2 3.07e-12 71 21 12 351 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
P23599 3.55e-12 72 25 13 300 2 ACS1 1-aminocyclopropane-1-carboxylate synthase CMW33 Cucurbita maxima
O58489 5.21e-12 70 22 10 302 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q00379 5.44e-12 71 24 12 300 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
Q37001 5.69e-12 71 25 10 300 1 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Arabidopsis thaliana
P14909 7.12e-12 70 21 15 373 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q01912 8.11e-12 70 25 14 306 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
P27486 9.47e-12 70 27 16 300 2 ACS2 1-aminocyclopropane-1-carboxylate synthase Dianthus caryophyllus
F8P1W6 9.7e-12 70 25 8 278 2 amt1 L-tyrosine:2-oxoglutarate aminotransferase amt1 Serpula lacrymans var. lacrymans (strain S7.9)
Q9HUI9 1.28e-11 69 23 7 299 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9V0L2 1.49e-11 69 22 11 378 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q84CG1 2.19e-11 68 23 12 305 1 vioD Capreomycidine synthase Streptomyces vinaceus
P23279 2.62e-11 69 24 13 300 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
Q9SNN8 3.07e-11 69 24 12 298 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
P29535 3.47e-11 68 23 15 331 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
P18485 3.51e-11 68 25 17 307 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q9M2Y8 3.57e-11 68 23 9 323 1 ACS9 1-aminocyclopropane-1-carboxylate synthase 9 Arabidopsis thaliana
P17735 3.98e-11 68 21 3 176 1 TAT Tyrosine aminotransferase Homo sapiens
Q43309 4.38e-11 68 24 14 295 1 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Arabidopsis thaliana
Q58CZ9 5.66e-11 68 20 3 176 2 TAT Tyrosine aminotransferase Bos taurus
P04694 6.31e-11 67 21 3 176 1 Tat Tyrosine aminotransferase Rattus norvegicus
Q8QZR1 6.37e-11 67 21 3 176 1 Tat Tyrosine aminotransferase Mus musculus
Q00257 9.24e-11 67 25 10 308 2 ACS2 1-aminocyclopropane-1-carboxylate synthase CMA101 Cucurbita maxima
Q9ST03 1.2e-10 67 21 9 299 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
P53001 2.46e-10 65 21 10 324 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
P38840 2.64e-10 66 21 10 336 1 ARO9 Aromatic amino acid aminotransferase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q67Y55 2.69e-10 65 23 6 228 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
P47039 2.87e-10 65 24 9 263 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9S9U6 3.48e-10 65 26 11 261 1 ACS11 1-aminocyclopropane-1-carboxylate synthase 11 Arabidopsis thaliana
Q9ST02 3.52e-10 65 20 9 299 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
P77434 8.79e-10 64 23 18 371 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
O87320 1.16e-09 63 24 19 348 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
A0A0P0UZP7 1.39e-09 63 30 7 206 2 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Oryza sativa subsp. japonica
Q9T065 1.42e-09 63 24 11 302 1 ACS8 1-aminocyclopropane-1-carboxylate synthase 8 Arabidopsis thaliana
B8DJJ6 1.64e-09 63 20 14 331 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
P9WPZ5 2.63e-09 62 24 14 329 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 2.63e-09 62 24 14 329 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A1VDD3 2.68e-09 62 22 16 331 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
P37821 2.98e-09 62 24 12 305 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
P53090 3.31e-09 62 22 10 317 1 ARO8 Aromatic/aminoadipate aminotransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7NDX4 3.31e-09 62 23 15 337 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q72BI1 3.54e-09 62 22 16 331 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q60013 3.96e-09 62 20 12 361 3 aspC Aspartate aminotransferase Streptomyces virginiae
Q93703 4.16e-09 62 20 11 328 1 tatn-1 Tyrosine aminotransferase Caenorhabditis elegans
Q9SAR0 4.2e-09 62 25 14 296 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
Q9SUR6 5.3e-09 61 20 11 327 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
Q30ZX9 6.37e-09 61 20 13 319 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B7STY2 8.5e-09 61 23 9 278 1 atrD L-tyrosine:2-oxoglutarate aminotransferase atrD Tapinella panuoides
Q9MB95 1.05e-08 60 24 11 295 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
Q9SIV0 1.11e-08 60 19 5 221 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
P96847 1.23e-08 60 28 4 180 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q16773 1.38e-08 60 24 12 317 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q06429 1.42e-08 60 24 11 295 1 ACS1 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Arabidopsis thaliana
Q54K95 1.62e-08 60 24 6 189 3 tat Tyrosine aminotransferase Dictyostelium discoideum
Q82DR2 1.92e-08 60 19 10 359 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q06402 1.92e-08 60 23 12 300 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
Q8KDS8 2.85e-08 59 19 10 312 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P0A961 3.77e-08 58 25 10 264 3 alaA Glutamate-pyruvate aminotransferase AlaA Shigella flexneri
P0A959 3.77e-08 58 25 10 264 1 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli (strain K12)
P0A960 3.77e-08 58 25 10 264 3 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5F4K8 3.99e-08 59 25 12 276 1 AAT Aspartate aminotransferase Pinus pinaster
Q9STR4 4.22e-08 58 26 13 295 1 ACS7 1-aminocyclopropane-1-carboxylate synthase 7 Arabidopsis thaliana
C6C2Z3 4.72e-08 58 22 11 309 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
Q8BTY1 5.9e-08 58 22 15 401 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
Q10DK7 5.93e-08 58 23 10 286 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 5.93e-08 58 23 10 286 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
Q5W6F9 6.68e-08 58 24 11 312 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Oryza sativa subsp. japonica
O07587 7.07e-08 58 23 8 311 3 yhdR Putative aspartate aminotransferase YhdR Bacillus subtilis (strain 168)
P58350 9.02e-08 57 22 10 264 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
Q9CBM9 1.33e-07 57 24 11 273 3 ML1794 Putative cystathionine beta-lyase Mycobacterium leprae (strain TN)
C6BUK3 1.45e-07 57 20 12 305 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
P40193 2.06e-07 56 22 18 444 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q06191 2.43e-07 56 21 12 319 1 aatB Aspartate aminotransferase Rhizobium meliloti
A3PMF8 3.16e-07 56 21 13 333 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q9SK47 3.3e-07 56 20 9 278 2 TAT3 Probable aminotransferase TAT3 Arabidopsis thaliana
Q8FY98 3.39e-07 55 28 6 171 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 3.39e-07 55 28 6 171 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 3.39e-07 55 28 6 171 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 3.39e-07 55 28 6 171 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
Q8YJK3 4.16e-07 55 28 6 171 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P23256 4.34e-07 55 21 9 308 1 malY Protein MalY Escherichia coli (strain K12)
Q9LVY1 5.26e-07 55 20 7 283 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q2RP86 5.74e-07 55 26 7 219 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B0K625 6.01e-07 55 25 17 320 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
A6TBC4 6.56e-07 55 25 8 224 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P71348 7.59e-07 55 23 10 264 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q17CS8 9.48e-07 54 21 19 367 1 KAT Kynurenine aminotransferase Aedes aegypti
B0K735 1.02e-06 54 24 16 320 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q81P62 1.27e-06 53 25 9 199 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
Q59228 1.51e-06 53 20 7 263 3 aspC Aspartate aminotransferase Geobacillus stearothermophilus
Q9FN30 1.86e-06 53 22 4 188 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
A9ML15 2.66e-06 53 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3MDN5 3.06e-06 53 21 18 369 3 dapL2 LL-diaminopimelate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q93QC6 3.23e-06 52 21 8 291 1 metC Cystathionine beta-lyase Corynebacterium glutamicum
Q08415 3.57e-06 52 24 8 253 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Rattus norvegicus
Q54KM6 3.92e-06 52 22 9 282 3 ccbl Kynurenine--oxoglutarate transaminase Dictyostelium discoideum
Q03VY3 4.49e-06 52 28 7 168 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A8AEK3 4.99e-06 52 23 7 221 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8VYP2 5.51e-06 52 18 10 334 2 At4g23590 Probable aminotransferase TAT4 Arabidopsis thaliana
Q63A05 5.72e-06 52 25 9 199 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q8YP73 7.02e-06 52 20 14 331 3 dapL2 LL-diaminopimelate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q02635 7.51e-06 51 20 11 286 1 aatA Aspartate/prephenate aminotransferase Rhizobium meliloti (strain 1021)
P9WQ91 1.01e-05 51 21 13 312 1 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ90 1.01e-05 51 21 13 312 3 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63499 1.01e-05 51 21 13 312 3 aspC Alanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B5FM42 1.05e-05 51 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
Q2NTX2 1.06e-05 51 24 11 278 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
C6DF75 1.31e-05 50 24 13 260 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P0ACL4 1.38e-05 50 36 0 73 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 1.38e-05 50 36 0 73 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 1.38e-05 50 36 0 73 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7
Q65RB2 1.42e-05 50 26 12 257 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B5XPE6 1.42e-05 50 24 8 224 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
A7NFV2 1.81e-05 50 28 10 208 3 hisC Histidinol-phosphate aminotransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B4TMR6 1.97e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 1.97e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 1.97e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 1.97e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
Q9X9E0 1.97e-05 49 32 2 98 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
Q8Z5J9 1.99e-05 50 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
O66630 2.04e-05 50 23 15 330 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
C0Q1K1 2.06e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
A9MSC2 2.08e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 2.08e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
B5BFB9 2.13e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 2.13e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57MS2 2.13e-05 50 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
Q2YSI3 2.45e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
O93744 2.53e-05 50 25 11 203 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A8YZZ5 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 2.58e-05 50 27 6 173 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 2.58e-05 50 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q58097 2.76e-05 50 22 9 258 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O86331 2.92e-05 49 46 0 62 1 Rv0792c HTH-type transcriptional regulator Rv0792c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B4T9N5 2.93e-05 49 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
P10369 2.98e-05 49 22 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q98G10 3.23e-05 49 28 5 174 3 hisC2 Histidinol-phosphate aminotransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6HHF6 3.57e-05 49 25 8 183 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q7N6I1 3.63e-05 50 23 10 247 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q42881 3.66e-05 49 23 11 303 1 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Solanum lycopersicum
Q6D410 4.15e-05 49 23 13 260 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7ZNJ3 4.37e-05 49 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z0G4 4.94e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
Q8NXN3 5.11e-05 48 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 5.11e-05 48 27 6 173 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
B1IZ53 6.06e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7UT58 6.11e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q81C43 6.11e-05 48 26 7 173 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1RA52 6.44e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 6.44e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 6.44e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7L9P8 6.67e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
P77806 6.81e-05 48 24 16 357 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
B6I848 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 6.91e-05 48 22 8 246 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
B5YU77 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 6.91e-05 48 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
B2TYF9 7.69e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q2NEQ0 8.05e-05 48 24 11 213 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B7NQG9 8.62e-05 48 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q45591 9.37e-05 47 37 0 69 1 yydK Uncharacterized HTH-type transcriptional regulator YydK Bacillus subtilis (strain 168)
Q58874 9.49e-05 48 20 4 193 3 MJ1479 Uncharacterized aminotransferase MJ1479 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q32EF0 0.0001 48 22 9 222 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
B4STN8 0.000105 48 22 10 299 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain R551-3)
Q5SHW0 0.000109 48 22 10 301 1 TTHA1620 Cystathionine beta-lyase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A5V022 0.000109 48 28 11 208 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
Q3Z8H5 0.000117 48 19 13 295 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q83KJ6 0.000122 47 22 8 246 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 0.000122 47 22 8 246 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B7MDH5 0.000138 47 22 8 246 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q9PBC6 0.000138 47 22 9 276 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
Q8DTM1 0.000157 47 19 8 316 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O34817 0.000173 46 41 1 77 1 nagR HTH-type transcriptional repressor NagR Bacillus subtilis (strain 168)
B7MWU0 0.000176 47 22 9 222 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
A4WC70 0.000177 47 23 7 221 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
A5FRC5 0.000185 47 20 12 296 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q4L4E7 0.000185 47 27 7 181 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
A8A1P5 0.000216 47 22 9 222 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
B9LNJ8 0.000272 46 27 7 161 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B2FPM0 0.000282 46 22 11 299 3 hisC Histidinol-phosphate aminotransferase Stenotrophomonas maltophilia (strain K279a)
Q3ZXC8 0.000297 46 21 13 296 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
B7LUF2 0.000336 46 22 7 221 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NC61 0.000357 46 22 9 222 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q323J1 0.000377 46 22 9 247 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
Q18F03 0.000434 46 27 8 165 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
P54590 0.000451 43 32 0 83 4 yhcF Uncharacterized HTH-type transcriptional regulator YhcF Bacillus subtilis (strain 168)
Q4WMJ9 0.00046 46 29 5 135 2 gliI Probable aminotransferase gliI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8NTR2 0.000466 46 20 10 286 1 Cgl0240 Aspartate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q987C8 0.000512 45 23 8 189 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
M1W859 0.000521 46 25 2 124 2 tcpI Probable aminotransferase tcpI Claviceps purpurea (strain 20.1)
A7MJP4 0.000522 45 25 9 227 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
H3ZPU1 0.000555 45 24 7 183 1 OCC_04737 Aromatic-amino-acid aminotransferase 2 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q7XQ85 0.000607 45 22 13 295 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Oryza sativa subsp. japonica
B1LP20 0.000628 45 22 10 247 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q9CLM3 0.000845 45 23 14 275 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q3J7H2 0.000855 45 25 9 217 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6Q887 0.000865 45 28 6 170 2 sirI Probable aminotransferase sirI Leptosphaeria maculans
A8HZS2 0.001 45 25 7 207 3 hisC Histidinol-phosphate aminotransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q73AX7 0.001 45 25 9 204 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04140
Feature type CDS
Gene -
Product PLP-dependent aminotransferase family protein
Location 874990 - 876411 (strand: 1)
Length 1422 (nucleotides) / 473 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_600
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MTRYEQLAEQIKQQIEDDIWQVGDRLPSLRESARQSGLSLMTVVQSYQLLESQGWVLARPQSGYFVAKRAPAFAQAKGGLGLHLTENVDINASLFDVLQACKDPAIVPFGSAFPDPTLLVQPKLSKALGAVARRIAPQSAVVNLPPGNEKLRRNISRRYASQGIHVSPEEIVITAGAMESLSLSLQAVTEPGDWVVIESPAFYGALQAIERLRLKAVAIKTDPQTGIDLDALEDVAGRYDIKACWLMTHFQNPLGGTMPVENKHRLVDILTRHNIALIEDDVYSELYFGNNAPQPAKSLDKENNFFHCSSFSKCLAPGFRVGWVAAGKHARTVQQLQMMSTVSASMPTQQAIAEYLGQGGYDAHLKKLRQQLEQRQHRMLYAVSEHFPSNVKVNCPQGGYFLWLEFEPPFDATKLYQMALNEQISIAPGSMFSTSEQFNHAFRLNCSFEWNERMDNAMKVLGRLCYVLQKTQS

Flanking regions ( +/- flanking 50bp)

TAGTTACAATTAATCAGTATATGTCTATAACAGTTTTCAGGGATCACGCTATGACACGCTACGAACAGTTAGCAGAACAGATAAAACAACAGATCGAAGATGATATCTGGCAGGTCGGTGACCGGCTGCCGTCATTGCGTGAAAGCGCCAGACAGTCGGGACTGAGTCTGATGACTGTCGTACAGTCCTATCAGTTACTGGAGAGTCAGGGCTGGGTTCTTGCCCGCCCGCAATCCGGCTATTTTGTCGCAAAACGCGCACCTGCGTTTGCTCAGGCAAAAGGTGGGTTAGGGTTACATCTTACTGAAAATGTTGATATAAACGCCTCACTTTTTGATGTGCTTCAGGCGTGCAAAGACCCGGCAATTGTGCCGTTCGGCTCAGCATTCCCTGATCCCACACTGTTGGTTCAGCCGAAACTGTCCAAAGCCCTGGGGGCGGTGGCACGGCGTATTGCACCACAAAGTGCGGTGGTTAACCTGCCGCCGGGCAATGAAAAACTGCGGCGTAATATTTCGCGGCGTTATGCATCACAGGGCATTCATGTGTCCCCGGAAGAAATCGTGATCACCGCCGGTGCCATGGAATCGCTGTCTCTCAGCCTTCAGGCGGTGACTGAGCCGGGTGACTGGGTTGTGATTGAATCTCCGGCATTTTACGGCGCATTACAGGCGATTGAACGTCTGCGCCTGAAAGCGGTGGCGATTAAAACCGACCCGCAGACGGGAATCGATCTTGATGCGCTCGAAGATGTCGCCGGGCGCTATGATATTAAAGCCTGCTGGCTGATGACGCATTTTCAGAATCCGCTCGGCGGAACAATGCCTGTGGAAAATAAACACCGGCTGGTGGATATCCTGACGCGCCATAATATTGCGCTTATTGAGGATGATGTTTACAGCGAACTGTATTTTGGCAATAACGCACCACAGCCCGCAAAAAGCCTGGATAAAGAGAACAATTTCTTTCATTGCTCCTCATTTTCCAAGTGTCTTGCACCCGGCTTTCGTGTTGGCTGGGTGGCGGCGGGTAAACATGCGCGGACAGTCCAGCAGTTGCAGATGATGAGTACCGTTTCTGCCAGCATGCCGACACAGCAGGCGATTGCGGAGTATCTGGGACAGGGTGGTTATGATGCGCACCTGAAGAAACTGCGCCAGCAGCTTGAACAGCGCCAGCACCGGATGCTCTATGCTGTCAGCGAGCACTTTCCGTCGAATGTGAAGGTTAACTGCCCGCAGGGCGGTTATTTTCTCTGGCTGGAATTTGAACCACCGTTTGATGCCACCAAGCTGTATCAGATGGCACTCAATGAGCAGATAAGTATCGCCCCCGGCAGTATGTTCTCGACCAGTGAGCAGTTTAATCACGCCTTCCGGCTGAATTGTTCTTTTGAATGGAACGAGCGCATGGATAATGCAATGAAAGTCCTGGGCAGGTTGTGTTATGTGCTGCAAAAGACACAATCATAATCGGGTCTGTGTGTACAAAAAATTGCCGGATTTAAGTCTGTAGTCTATTA