Homologs in group_673

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01815 FBDBKF_01815 100.0 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
EHELCC_02285 EHELCC_02285 100.0 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_01175 NLDBIP_01175 100.0 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_00900 HKOGLL_00900 100.0 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
F4V73_RS04140 F4V73_RS04140 93.4 Morganella psychrotolerans - PLP-dependent aminotransferase family protein
PMI_RS06935 PMI_RS06935 74.5 Proteus mirabilis HI4320 - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_673

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_673

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77730 0.0 547 55 1 466 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
P39389 1.65e-96 301 35 6 482 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
Q5HJR1 1.15e-53 189 28 7 438 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 1.15e-53 189 28 7 438 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 1.15e-53 189 28 7 438 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 1.64e-52 186 28 8 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 1.64e-52 186 28 8 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q796Q6 4.75e-51 183 25 9 478 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
Q2YUS3 1.18e-50 181 28 8 439 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
P95957 1.27e-49 177 30 8 378 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q72LL6 1.23e-46 169 27 7 385 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
H3ZPL1 1.14e-44 164 27 6 398 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P96681 5e-41 156 24 9 485 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
Q08792 1.32e-35 140 26 7 386 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
P49309 4.14e-26 114 23 8 442 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
O07578 4.96e-26 113 24 11 439 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
P96669 6.29e-26 113 22 7 430 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
Q54K00 1.92e-25 111 23 9 393 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
Q8N5Z0 7.89e-25 109 25 8 324 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
Q5E9N4 4.02e-24 107 24 8 323 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
O14192 1.57e-23 106 24 7 346 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q64602 1.06e-21 100 24 7 301 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q9WVM8 1.62e-20 97 23 6 312 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
Q8NS92 2.28e-20 97 26 9 356 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q01856 2.43e-20 96 25 13 456 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P96663 1.46e-19 94 22 12 477 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
P94426 3.59e-19 93 22 10 416 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
D5AKX9 4.22e-19 93 26 9 396 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q9Y7S6 2e-18 91 26 7 268 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D4AU29 2.61e-18 90 25 11 340 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
O94570 8.66e-18 89 25 6 267 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P10356 2.99e-17 87 25 6 244 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0P0VI36 3.88e-17 87 22 10 347 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
Q60317 2.06e-16 84 23 9 328 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O52815 3.84e-16 84 26 11 339 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
Q795M6 1.18e-15 82 23 12 333 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q56232 3.49e-15 80 22 11 395 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q7T3E5 8.89e-15 79 23 15 397 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
E9F8L8 3.15e-14 78 26 6 253 1 swnA Aminotransferase swnA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P31531 3.95e-14 78 25 15 310 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Glycine max
E9L7A5 4.14e-14 77 24 14 339 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
O67781 4.43e-14 77 24 12 340 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
Q4J8X2 5.25e-14 77 22 10 314 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q0P5G4 5.4e-14 77 23 17 437 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
Q9SIE1 5.44e-14 77 23 12 336 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
F8P1W6 7.35e-14 77 25 9 326 2 amt1 L-tyrosine:2-oxoglutarate aminotransferase amt1 Serpula lacrymans var. lacrymans (strain S7.9)
P16524 1.16e-13 75 26 11 299 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q58FK9 1.31e-13 76 24 17 415 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
Q972A2 2.8e-13 74 21 11 353 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
O33822 2.88e-13 74 22 15 401 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q07262 2.89e-13 75 26 18 305 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
Q08432 2.95e-13 74 24 9 302 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
A7XRY8 4.63e-13 74 21 10 320 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P38840 1.83e-12 72 22 9 306 1 ARO9 Aromatic amino acid aminotransferase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01912 2.05e-12 72 25 16 311 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
Q9SUR6 2.34e-12 72 22 11 327 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
Q86AG8 2.88e-12 72 20 9 348 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
P23599 3.08e-12 72 25 13 300 2 ACS1 1-aminocyclopropane-1-carboxylate synthase CMW33 Cucurbita maxima
Q71RI9 3.72e-12 71 23 16 411 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
Q00379 4.36e-12 71 24 12 300 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
Q84CG1 5.2e-12 70 23 12 305 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q6YP21 5.25e-12 71 24 19 437 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
A0A0P0WIY3 7.06e-12 70 25 11 302 2 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Oryza sativa subsp. japonica
P17735 7.49e-12 70 22 3 176 1 TAT Tyrosine aminotransferase Homo sapiens
Q9ST03 1.01e-11 70 22 9 303 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
P14909 1.04e-11 70 20 10 313 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P27486 1.53e-11 70 27 16 298 2 ACS2 1-aminocyclopropane-1-carboxylate synthase Dianthus caryophyllus
Q9X0Y2 1.82e-11 69 22 12 355 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9ST02 2.01e-11 69 21 10 309 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
P04694 2.49e-11 69 22 3 176 1 Tat Tyrosine aminotransferase Rattus norvegicus
P23279 2.49e-11 69 24 13 300 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
Q8QZR1 2.62e-11 68 22 3 176 1 Tat Tyrosine aminotransferase Mus musculus
Q9HUI9 2.95e-11 68 24 6 295 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29535 4.65e-11 68 25 17 294 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
Q43309 5.52e-11 68 25 14 297 1 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Arabidopsis thaliana
Q9S9U6 5.82e-11 68 26 9 259 1 ACS11 1-aminocyclopropane-1-carboxylate synthase 11 Arabidopsis thaliana
Q67Y55 8.34e-11 67 23 6 228 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
Q58CZ9 9.22e-11 67 21 3 176 2 TAT Tyrosine aminotransferase Bos taurus
Q9MB95 1.57e-10 66 24 15 337 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
P53001 2.39e-10 65 22 10 325 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
Q60013 3.07e-10 65 21 11 360 3 aspC Aspartate aminotransferase Streptomyces virginiae
Q37001 4.33e-10 65 24 9 294 1 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Arabidopsis thaliana
P18485 5.15e-10 65 24 18 305 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q9V0L2 6.7e-10 64 21 11 385 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
B7STY2 7.94e-10 64 26 8 276 1 atrD L-tyrosine:2-oxoglutarate aminotransferase atrD Tapinella panuoides
P96847 8.12e-10 64 24 10 313 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q93703 8.36e-10 64 23 4 182 1 tatn-1 Tyrosine aminotransferase Caenorhabditis elegans
P53090 8.61e-10 64 23 9 314 1 ARO8 Aromatic/aminoadipate aminotransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O58489 1.22e-09 63 22 6 260 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9SNN8 1.22e-09 63 24 11 291 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
Q00257 1.62e-09 63 24 10 298 2 ACS2 1-aminocyclopropane-1-carboxylate synthase CMA101 Cucurbita maxima
P37821 1.89e-09 63 25 12 295 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
Q8KDS8 2.17e-09 62 20 10 329 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9M2Y8 2.84e-09 62 23 9 292 1 ACS9 1-aminocyclopropane-1-carboxylate synthase 9 Arabidopsis thaliana
Q9SAR0 2.85e-09 62 25 14 292 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
P58350 2.87e-09 62 22 13 328 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
A0A0P0UZP7 5.04e-09 62 30 7 206 2 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Oryza sativa subsp. japonica
P0A961 6.07e-09 61 26 8 219 3 alaA Glutamate-pyruvate aminotransferase AlaA Shigella flexneri
P0A959 6.07e-09 61 26 8 219 1 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli (strain K12)
P0A960 6.07e-09 61 26 8 219 3 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5F4K8 6.59e-09 61 24 14 318 1 AAT Aspartate aminotransferase Pinus pinaster
Q9SIV0 9.01e-09 61 19 5 221 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
Q54K95 1.02e-08 60 23 4 186 3 tat Tyrosine aminotransferase Dictyostelium discoideum
Q9T065 1.02e-08 60 23 11 292 1 ACS8 1-aminocyclopropane-1-carboxylate synthase 8 Arabidopsis thaliana
Q82DR2 1.35e-08 60 19 9 358 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P71348 1.38e-08 60 25 8 219 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6TBC4 1.79e-08 59 24 9 244 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9ML15 1.98e-08 59 25 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P77434 2.05e-08 59 22 18 371 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
Q06191 2.59e-08 59 21 13 333 1 aatB Aspartate aminotransferase Rhizobium meliloti
P47039 3.61e-08 59 23 9 262 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q06429 4.64e-08 58 24 12 295 1 ACS1 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Arabidopsis thaliana
O07587 6.35e-08 58 25 12 312 3 yhdR Putative aspartate aminotransferase YhdR Bacillus subtilis (strain 168)
P77806 6.97e-08 58 24 16 377 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
C6C2Z3 7.96e-08 58 21 11 310 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
B5FM42 7.97e-08 57 24 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
Q7NDX4 8.05e-08 57 27 9 199 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q30ZX9 8.24e-08 57 20 12 319 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A8AEK3 8.95e-08 57 24 7 221 3 hisC Histidinol-phosphate aminotransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q06402 1.28e-07 57 24 14 320 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
B8DJJ6 1.31e-07 57 21 19 383 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q57MS2 1.39e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B5BFB9 1.45e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP4 1.45e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0Q1K1 1.46e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
B4TMR6 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
A9MSC2 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SX42 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella newport (strain SL254)
B5RBR3 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 1.49e-07 57 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
Q8Z5J9 1.57e-07 57 24 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella typhi
Q9FN30 1.59e-07 57 24 4 188 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
Q9LVY1 1.79e-07 57 20 11 387 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
O87320 2.12e-07 56 24 17 307 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
B4T9N5 2.13e-07 56 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
P10369 2.18e-07 56 23 7 221 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5W6F9 2.38e-07 56 24 8 270 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Oryza sativa subsp. japonica
Q16773 2.59e-07 56 21 10 314 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q8FY98 3.02e-07 55 28 6 170 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 3.02e-07 55 28 6 170 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 3.02e-07 55 28 6 170 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 3.02e-07 55 28 6 170 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
Q8YJK3 3.48e-07 55 28 6 170 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q3Z0G4 3.78e-07 55 23 10 230 3 hisC Histidinol-phosphate aminotransferase Shigella sonnei (strain Ss046)
Q10DK7 4.45e-07 55 23 9 261 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 4.45e-07 55 23 9 261 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
B5XPE6 4.84e-07 55 23 9 242 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
P40193 5.01e-07 55 21 11 410 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1VDD3 5.39e-07 55 21 18 379 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
P9WPZ5 5.67e-07 55 25 16 327 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 5.67e-07 55 25 16 327 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q72BI1 6.96e-07 55 21 18 379 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q32EF0 7.71e-07 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Shigella dysenteriae serotype 1 (strain Sd197)
P23034 9.51e-07 54 21 11 327 1 None Aspartate aminotransferase Bacillus sp. (strain YM-2)
A7ZNJ3 9.89e-07 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IZ53 1.03e-06 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q81P62 1.06e-06 54 25 8 187 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
B7MWU0 1.06e-06 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O81 (strain ED1a)
Q1RA52 1.13e-06 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain UTI89 / UPEC)
Q8FG51 1.13e-06 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG66 1.13e-06 54 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A4WC70 1.27e-06 53 24 7 221 3 hisC Histidinol-phosphate aminotransferase Enterobacter sp. (strain 638)
A3PMF8 1.29e-06 54 23 11 265 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B7L9P8 1.34e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain 55989 / EAEC)
Q58097 1.34e-06 53 22 8 257 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7N6I1 1.37e-06 54 23 10 250 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5YU77 1.37e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q9S5G6 1.37e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O157:H7
B6I848 1.41e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SE11)
P06986 1.41e-06 53 23 8 229 1 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12)
B1X6V8 1.41e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / DH10B)
C4ZSB0 1.41e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M400 1.41e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O8 (strain IAI1)
B7UT58 1.44e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TYF9 1.56e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
C6BUK3 1.63e-06 53 20 13 305 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q59228 1.63e-06 53 21 10 328 3 aspC Aspartate aminotransferase Geobacillus stearothermophilus
A8A1P5 1.66e-06 53 23 9 222 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O9:H4 (strain HS)
B7NQG9 1.84e-06 53 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q83KJ6 2.36e-06 53 23 10 230 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri
Q0T3A6 2.36e-06 53 23 10 230 3 hisC Histidinol-phosphate aminotransferase Shigella flexneri serotype 5b (strain 8401)
B7MDH5 2.49e-06 53 23 8 229 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LUF2 2.75e-06 53 23 7 221 3 hisC Histidinol-phosphate aminotransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NC61 2.77e-06 53 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q2RP86 3.66e-06 52 26 7 220 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q63A05 3.77e-06 52 25 8 187 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q8BTY1 3.87e-06 52 21 14 385 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
Q9STR4 4.08e-06 52 25 12 288 1 ACS7 1-aminocyclopropane-1-carboxylate synthase 7 Arabidopsis thaliana
P9WQ91 4.5e-06 52 23 13 312 1 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ90 4.5e-06 52 23 13 312 3 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63499 4.5e-06 52 23 13 312 3 aspC Alanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0ACL4 4.8e-06 51 34 2 98 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 4.8e-06 51 34 2 98 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 4.8e-06 51 34 2 98 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7
B1LP20 5.21e-06 52 23 9 224 3 hisC Histidinol-phosphate aminotransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q93QC6 6.34e-06 52 21 10 297 1 metC Cystathionine beta-lyase Corynebacterium glutamicum
Q323J1 6.56e-06 52 23 8 221 3 hisC Histidinol-phosphate aminotransferase Shigella boydii serotype 4 (strain Sb227)
Q4WMJ9 8.56e-06 51 30 6 146 2 gliI Probable aminotransferase gliI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1JTV9 8.86e-06 51 25 11 227 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q08415 9.23e-06 51 24 8 254 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Rattus norvegicus
A7MJP4 9.81e-06 51 25 9 227 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q6GIR8 1.01e-05 51 28 8 188 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MRSA252)
O86331 1.34e-05 50 48 0 62 1 Rv0792c HTH-type transcriptional regulator Rv0792c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9X9E0 1.61e-05 50 32 1 97 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
A1ACN3 1.92e-05 50 23 10 230 3 hisC Histidinol-phosphate aminotransferase Escherichia coli O1:K1 / APEC
C6DF75 1.99e-05 50 24 13 255 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8NTR2 2.34e-05 50 23 10 274 1 Cgl0240 Aspartate aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6HHF6 2.71e-05 50 25 7 171 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
O93744 2.87e-05 49 25 13 226 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
D5FKJ2 3.01e-05 49 25 11 227 3 mrsB L-aspartate:5-guanidino-3-methyl-2-oxopentanoate transaminase Pseudomonas syringae pv. syringae
Q2NTX2 3.33e-05 49 23 11 277 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
Q81C43 3.79e-05 49 25 7 171 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A8YZZ5 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300 / TCH1516)
P67725 4.24e-05 49 26 7 187 1 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain N315)
P67724 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF32 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Newman)
Q5HHU9 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain COL)
A5IQS7 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH9)
Q2G087 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIR7 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain USA300)
A6TZK2 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain JH1)
A7WZL0 4.24e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7XQ85 4.29e-05 49 23 13 291 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Oryza sativa subsp. japonica
Q2W047 4.49e-05 49 29 10 215 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2YSI3 4.55e-05 49 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2NEQ0 4.87e-05 49 24 11 213 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q03VY3 6.99e-05 48 28 4 132 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q6D410 7.85e-05 48 24 13 260 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1LT68 8.19e-05 48 23 11 252 3 hisC Histidinol-phosphate aminotransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q4L4E7 8.21e-05 48 27 8 189 3 hisC Histidinol-phosphate aminotransferase Staphylococcus haemolyticus (strain JCSC1435)
Q8NXN3 8.84e-05 48 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MW2)
Q6GBA6 8.84e-05 48 26 7 187 3 hisC Histidinol-phosphate aminotransferase Staphylococcus aureus (strain MSSA476)
Q9CLM3 9.37e-05 48 23 13 269 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q65RB2 9.68e-05 48 24 12 259 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q45591 0.000129 47 37 0 69 1 yydK Uncharacterized HTH-type transcriptional regulator YydK Bacillus subtilis (strain 168)
Q3Z8H5 0.000139 47 20 16 326 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
O34817 0.000153 47 41 1 77 1 nagR HTH-type transcriptional repressor NagR Bacillus subtilis (strain 168)
Q9CBM9 0.000188 47 22 10 272 3 ML1794 Putative cystathionine beta-lyase Mycobacterium leprae (strain TN)
Q42881 0.000191 47 23 11 297 1 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Solanum lycopersicum
Q66C50 0.00025 47 25 12 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZM8 0.00025 47 25 12 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q02635 0.000264 47 20 12 307 1 aatA Aspartate/prephenate aminotransferase Rhizobium meliloti (strain 1021)
Q3J7H2 0.000358 46 26 11 237 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A7NFV2 0.000397 46 29 11 209 3 hisC Histidinol-phosphate aminotransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A4TKK4 0.000455 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis (strain Pestoides F)
Q1CGX0 0.000455 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K5 0.000455 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX6 0.000455 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis
Q1C9R1 0.000455 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pestis bv. Antiqua (strain Antiqua)
B1JPW1 0.000459 46 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P54590 0.000478 43 32 0 83 4 yhcF Uncharacterized HTH-type transcriptional regulator YhcF Bacillus subtilis (strain 168)
B1N009 0.000538 45 27 6 135 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
Q6Q887 0.000574 45 28 6 170 2 sirI Probable aminotransferase sirI Leptosphaeria maculans
A7FJH1 0.000598 45 25 13 236 3 hisC Histidinol-phosphate aminotransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q987C8 0.000782 45 24 8 189 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q73AX7 0.000867 45 25 10 201 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
M1W859 0.000897 45 24 2 124 2 tcpI Probable aminotransferase tcpI Claviceps purpurea (strain 20.1)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_00860
Feature type CDS
Gene aRO8
Product DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
Location 151111 - 152532 (strand: 1)
Length 1422 (nucleotides) / 473 (amino acids)
In genomic island -

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_673
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)
KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MTRYEQLAEQIKQQIEDDIWQVGDRLPSLRESARQSGLSLMTVVQSYQLLESQGWVVARPQSGYFVAKRAPAFAQAKGGLGMHLSENVEINASLFDVLQACKDPAIIPFGSAFPDPSLLVQPKLSKALGAVARRIAPQSAVVNMPPGNEKLRRNISRRYAAQGIHVSPDDIVITAGAMESLSLSLQAVTEPGDWVVIESPAFYGALQAIERLRLKAVAIKTDPQTGIDLDALEDVAGRYDIKACWLMTHFQNPLGGTMPPENKRRLVEILTRHEIALIEDDVYSELWFGSNAPQPAKSLDKDNNFFHCSSFSKCLAPGFRVGWVAAGKHARKIQQLQMMSTVSASMPTQQAIAEYLGQGGYDAHLKKLRQQLEQRQHRMLYAISEYFPSDVKVNCPQGGYFLWLEFEPPFDAVKLYRMALNEQISIAPGSMFSTSDQFNHAFRLNCSFEWNERLENAMKVLGQLCHVLKKTQG

Flanking regions ( +/- flanking 50bp)

AGTGACAATTAGTCATGAAATGTCCATAACAGTTTTACGGAGAGCGCTCCATGACACGCTACGAACAGTTAGCAGAGCAGATAAAACAGCAGATCGAAGATGATATCTGGCAGGTTGGTGACCGGCTGCCGTCATTACGGGAAAGTGCCAGACAGTCGGGACTGAGCCTGATGACTGTCGTACAGTCGTATCAGTTACTGGAGAGCCAGGGATGGGTGGTGGCCCGTCCGCAGTCCGGGTATTTTGTCGCCAAACGCGCCCCGGCGTTTGCTCAGGCCAAAGGTGGTCTGGGCATGCACCTGAGTGAAAATGTGGAGATCAACGCCTCGCTGTTTGATGTGCTACAGGCCTGCAAAGACCCGGCCATTATTCCGTTCGGGTCGGCATTCCCCGATCCTTCGCTGCTGGTACAACCGAAGCTCTCCAAAGCGCTGGGTGCAGTGGCCCGCCGCATCGCACCGCAGAGCGCGGTGGTCAATATGCCGCCCGGTAATGAAAAACTGCGGCGTAATATTTCCCGGCGCTATGCCGCACAGGGGATCCATGTCTCTCCGGATGATATTGTTATCACCGCCGGGGCTATGGAATCCCTGTCACTGAGCCTGCAGGCGGTCACGGAACCGGGGGATTGGGTGGTGATTGAATCACCGGCATTTTACGGTGCATTACAGGCGATTGAGCGTTTGCGCCTGAAAGCGGTGGCGATCAAAACCGATCCGCAGACCGGGATTGACCTTGATGCGCTGGAAGACGTCGCCGGGCGCTATGATATCAAAGCCTGCTGGCTGATGACGCACTTCCAGAACCCGCTCGGCGGTACCATGCCGCCGGAAAACAAGCGGCGGCTGGTGGAGATCCTGACGCGGCATGAAATCGCGCTGATAGAGGATGATGTCTACAGTGAGCTCTGGTTTGGCAGCAATGCGCCGCAACCGGCGAAAAGCCTGGATAAAGACAACAATTTCTTCCACTGCTCCTCGTTTTCCAAATGTCTGGCGCCGGGCTTCCGCGTCGGCTGGGTGGCGGCCGGTAAACATGCCCGGAAAATCCAGCAGTTACAGATGATGAGTACCGTATCCGCCAGTATGCCGACACAGCAGGCCATTGCGGAATATCTCGGCCAGGGCGGTTATGATGCGCATCTGAAAAAACTGCGTCAGCAGCTGGAGCAGCGCCAGCACCGGATGCTGTATGCCATCAGCGAATATTTTCCGTCAGATGTGAAAGTCAACTGCCCGCAGGGCGGCTATTTCCTCTGGCTGGAATTTGAACCGCCGTTTGATGCCGTCAAACTGTACCGTATGGCACTCAATGAGCAGATCAGTATCGCGCCCGGCTCGATGTTTTCCACCAGTGACCAGTTTAATCACGCCTTCCGCCTGAACTGCTCATTTGAATGGAATGAGCGGCTGGAGAACGCCATGAAAGTGCTGGGGCAGCTGTGTCATGTACTGAAGAAAACACAGGGGTGATTTGAACATCCGGTATGCATTGTCATAACTCAGGATCCGGGCTATTATCC