Homologs in group_600

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01815 FBDBKF_01815 74.5 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
EHELCC_02285 EHELCC_02285 74.5 Morganella morganii S2 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_01175 NLDBIP_01175 74.5 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
LHKJJB_00860 LHKJJB_00860 74.5 Morganella morganii S3 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_00900 HKOGLL_00900 74.5 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
F4V73_RS04140 F4V73_RS04140 72.8 Morganella psychrotolerans - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_600

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_600

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77730 0.0 524 54 1 463 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
P39389 4.34e-91 288 33 2 467 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
P95957 1.31e-52 185 29 7 385 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q796Q6 7.67e-50 180 26 11 479 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
Q5HJR1 1.72e-46 170 25 11 456 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 1.72e-46 170 25 11 456 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 1.72e-46 170 25 11 456 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 2.21e-45 167 25 11 456 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 2.21e-45 167 25 11 456 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YUS3 4.41e-44 163 25 11 456 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
H3ZPL1 7.24e-44 162 27 5 391 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q72LL6 3.88e-40 152 28 10 389 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q08792 2.16e-39 150 27 7 389 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
P96681 3.36e-38 148 23 9 480 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
P96669 6.92e-33 133 25 10 468 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
P49309 3.31e-31 129 24 8 444 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
O07578 4.47e-28 119 25 15 443 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
Q54K00 1.04e-26 115 24 9 383 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
Q5E9N4 1.25e-21 100 23 11 402 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
Q9WVM8 1.57e-20 97 26 9 318 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
Q64602 1.01e-19 94 27 10 307 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q9Y7S6 1.38e-19 94 28 9 286 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8N5Z0 1.47e-19 94 25 8 294 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
O14192 8.07e-19 92 25 8 323 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D5AKX9 3.31e-18 90 24 13 479 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8NS92 3.38e-18 90 26 9 356 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q60317 1.47e-17 87 25 14 390 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P96663 2.81e-17 87 24 7 324 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
O52815 4.83e-17 86 27 12 322 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
D4AU29 1.36e-16 85 23 9 318 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
P53090 2.22e-16 85 25 9 317 1 ARO8 Aromatic/aminoadipate aminotransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P94426 3.35e-16 84 22 13 416 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
O94570 1.11e-15 82 25 7 288 3 SPBC1773.13 Aromatic amino acid aminotransferase C1773.13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q972A2 1.39e-15 82 24 11 349 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
P14909 3.8e-14 77 23 15 417 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P10356 4.01e-14 77 24 6 259 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q01856 3.77e-13 74 23 14 441 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q86AG8 4.61e-13 74 22 10 288 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
Q4J8X2 6.94e-13 73 22 12 388 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
E9F8L8 7.87e-13 73 24 7 263 1 swnA Aminotransferase swnA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0P0VI36 2.51e-12 72 21 8 322 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
O67781 2.77e-12 71 24 14 351 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
Q08432 3.86e-12 71 25 7 258 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
Q58CZ9 4.49e-12 71 20 6 273 2 TAT Tyrosine aminotransferase Bos taurus
Q84CG1 6.12e-12 70 24 11 323 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q56232 7.11e-12 70 22 11 367 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9SIE1 1.32e-11 70 24 12 315 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
O58489 1.77e-11 69 22 11 344 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P16524 3.4e-11 68 23 10 272 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
A7XRY8 3.7e-11 68 23 11 317 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P04694 7.47e-11 67 20 7 253 1 Tat Tyrosine aminotransferase Rattus norvegicus
E9L7A5 7.81e-11 67 23 11 307 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
P17735 2.02e-10 66 20 7 253 1 TAT Tyrosine aminotransferase Homo sapiens
Q9X0Y2 2.02e-10 65 21 12 366 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8QZR1 2.07e-10 66 20 7 253 1 Tat Tyrosine aminotransferase Mus musculus
Q9S9U6 2.58e-10 65 25 13 295 1 ACS11 1-aminocyclopropane-1-carboxylate synthase 11 Arabidopsis thaliana
Q0P5G4 2.85e-10 65 24 12 326 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
Q6YP21 4.13e-10 65 24 13 326 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
Q9HUI9 7.38e-10 64 23 13 330 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P40193 7.72e-10 64 24 20 450 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P96847 1.11e-09 63 25 14 340 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O33822 1.18e-09 63 22 13 378 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q9ST02 2.08e-09 63 23 13 346 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
F8P1W6 2.7e-09 62 25 9 283 2 amt1 L-tyrosine:2-oxoglutarate aminotransferase amt1 Serpula lacrymans var. lacrymans (strain S7.9)
Q43309 3.07e-09 62 25 14 298 1 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Arabidopsis thaliana
Q7T3E5 5.17e-09 62 24 14 325 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
Q5F4K8 5.48e-09 62 24 13 307 1 AAT Aspartate aminotransferase Pinus pinaster
Q9T065 5.83e-09 61 23 11 295 1 ACS8 1-aminocyclopropane-1-carboxylate synthase 8 Arabidopsis thaliana
P38840 1.25e-08 60 21 7 224 1 ARO9 Aromatic amino acid aminotransferase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ST03 1.42e-08 60 23 8 239 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
Q71RI9 1.45e-08 60 23 15 327 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
P37821 1.9e-08 60 23 14 302 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
B7STY2 2.35e-08 60 24 10 287 1 atrD L-tyrosine:2-oxoglutarate aminotransferase atrD Tapinella panuoides
Q58097 3.04e-08 59 23 13 300 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9SNN8 3.7e-08 59 26 11 269 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
Q93703 3.9e-08 59 22 4 182 1 tatn-1 Tyrosine aminotransferase Caenorhabditis elegans
Q01912 5.59e-08 58 23 10 299 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
P77806 5.75e-08 58 23 14 363 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
Q9V0L2 6.75e-08 58 23 14 355 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
A0A0P0UZP7 7.76e-08 58 26 7 212 2 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Oryza sativa subsp. japonica
Q10DK7 1.45e-07 57 23 11 330 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 1.45e-07 57 23 11 330 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
Q9SUR6 1.74e-07 57 20 10 313 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
Q58FK9 1.97e-07 57 26 18 333 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
P27486 2.73e-07 56 25 14 306 2 ACS2 1-aminocyclopropane-1-carboxylate synthase Dianthus caryophyllus
P18485 2.94e-07 56 23 13 294 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q795M6 4.83e-07 55 24 15 304 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q07262 4.94e-07 55 24 13 295 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
Q81P62 8.07e-07 54 25 8 196 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
Q00257 1.01e-06 54 22 12 344 2 ACS2 1-aminocyclopropane-1-carboxylate synthase CMA101 Cucurbita maxima
B0K735 1.02e-06 54 24 19 328 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
P23599 1.11e-06 54 24 11 297 2 ACS1 1-aminocyclopropane-1-carboxylate synthase CMW33 Cucurbita maxima
Q06402 1.34e-06 54 23 14 320 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
Q65RB2 1.5e-06 53 25 12 263 3 hisC2 Histidinol-phosphate aminotransferase 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q06191 1.52e-06 53 21 19 421 1 aatB Aspartate aminotransferase Rhizobium meliloti
Q45591 1.94e-06 52 33 1 83 1 yydK Uncharacterized HTH-type transcriptional regulator YydK Bacillus subtilis (strain 168)
O87320 2.79e-06 53 23 14 302 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
Q9LVY1 2.88e-06 53 23 9 258 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q9FN30 3.02e-06 53 24 4 181 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
Q63A05 3.16e-06 52 25 8 196 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
P58350 4.12e-06 52 21 19 421 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
Q37001 4.2e-06 52 24 10 273 1 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Arabidopsis thaliana
D5FKJ2 4.49e-06 52 24 11 261 3 mrsB L-aspartate:5-guanidino-3-methyl-2-oxopentanoate transaminase Pseudomonas syringae pv. syringae
Q18F03 4.64e-06 52 24 11 308 3 hisC Histidinol-phosphate aminotransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q9X9E0 6.38e-06 51 30 3 110 4 exuR Exu regulon transcriptional regulator Dickeya chrysanthemi
Q9M2Y8 6.98e-06 52 24 12 277 1 ACS9 1-aminocyclopropane-1-carboxylate synthase 9 Arabidopsis thaliana
O07587 7.6e-06 51 22 11 316 3 yhdR Putative aspartate aminotransferase YhdR Bacillus subtilis (strain 168)
Q54K95 1.53e-05 50 20 4 186 3 tat Tyrosine aminotransferase Dictyostelium discoideum
Q67Y55 1.58e-05 50 21 5 217 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
A9ML15 1.73e-05 50 22 7 226 3 hisC Histidinol-phosphate aminotransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A0A0P0WIY3 1.76e-05 50 23 7 242 2 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Oryza sativa subsp. japonica
Q00379 1.8e-05 50 23 11 297 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
P9WPZ5 1.95e-05 50 23 12 281 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 1.95e-05 50 23 12 281 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9STR4 1.96e-05 50 25 7 206 1 ACS7 1-aminocyclopropane-1-carboxylate synthase 7 Arabidopsis thaliana
Q6HHF6 2.01e-05 50 25 7 180 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P23279 2.07e-05 50 23 11 296 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
B9LNJ8 2.43e-05 50 27 8 161 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q8KDS8 2.47e-05 50 21 9 247 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q42881 2.63e-05 50 22 13 349 1 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Solanum lycopersicum
Q9SIV0 2.65e-05 50 20 8 271 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
Q9SAR0 3.02e-05 50 24 16 297 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
Q03VY3 3.28e-05 49 28 6 162 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P47039 4.18e-05 49 21 10 284 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39643 4.56e-05 49 22 12 340 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
Q5W6F9 4.93e-05 49 23 9 270 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Oryza sativa subsp. japonica
A3PMF8 5.17e-05 49 22 18 366 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q2UPB9 5.91e-05 48 29 7 179 3 aclI Probable aminotransferase aclI Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A6TBC4 5.97e-05 48 24 7 225 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P0A961 6.33e-05 48 25 13 283 3 alaA Glutamate-pyruvate aminotransferase AlaA Shigella flexneri
P0A959 6.33e-05 48 25 13 283 1 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli (strain K12)
P0A960 6.33e-05 48 25 13 283 3 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P71348 6.66e-05 48 25 11 267 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7NDX4 6.79e-05 48 23 12 311 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P09053 7.25e-05 48 25 6 197 1 avtA Valine--pyruvate aminotransferase Escherichia coli (strain K12)
Q81C43 7.57e-05 48 25 8 181 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9MB95 9.44e-05 48 21 11 292 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
O93744 0.000109 48 23 17 323 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q17CS8 0.000135 48 24 17 291 1 KAT Kynurenine aminotransferase Aedes aegypti
Q9CLM3 0.000135 47 25 12 243 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q2W047 0.000138 47 26 5 185 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q16773 0.000139 47 21 11 319 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
B8CX89 0.00015 47 21 15 337 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
O86331 0.000187 47 40 0 62 1 Rv0792c HTH-type transcriptional regulator Rv0792c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0ACL4 0.000188 46 27 1 109 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 0.000188 46 27 1 109 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 0.000188 46 27 1 109 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7
B5XPE6 0.000239 47 24 7 225 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
Q82DR2 0.000352 46 20 12 363 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
M1W859 0.000398 46 25 3 140 2 tcpI Probable aminotransferase tcpI Claviceps purpurea (strain 20.1)
P17736 0.000432 46 22 6 179 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8BTY1 0.00059 45 23 14 324 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
A7MJP4 0.000653 45 23 7 224 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
A5FRC5 0.000668 45 21 17 364 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q06429 0.000697 45 23 14 283 1 ACS1 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Arabidopsis thaliana
B5FM42 0.000819 45 22 9 234 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
B5BFB9 0.000863 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain AKU_12601)
C0Q1K1 0.000863 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
Q5PDP4 0.000863 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57MS2 0.000894 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
B4TMR6 0.001 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 0.001 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 0.001 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 0.001 45 22 9 235 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
Q6Q887 0.001 45 31 2 125 2 sirI Probable aminotransferase sirI Leptosphaeria maculans

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06935
Feature type CDS
Gene -
Product PLP-dependent aminotransferase family protein
Location 1516834 - 1518249 (strand: -1)
Length 1416 (nucleotides) / 471 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_600
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MTRYEQLAAQIRQQIEDNIWQSGDRLPSLRDTVKQSGLSLMTVLQSYQLLESQGWITARPQSGYYVAHRNTGFAQVTASKGLHMSENVEISASIFNVLQACKDPNIIPFGSAFPDPSLFIQPKLSRALASAARHLAPQSSVINLPPGNEKLRRNIAQRYALQGIHVSPDDIVITAGAMESLSFSLQAVTEPGDWVVIESPAFYGALQAIERLRLKAIAIKTDPVTGICLDELEKVVEQYDIKACWLMSHCQNPLGGTMPDENKIRLVEILAAKQITLIEDDVYGELYNSPKAPMPVKGFDKSNSVLHCASFSKCLAPGFRVGWVAAGKHATKIQQLQMMSTVSASMPTQQAIADYLSQGGYDGHLRRLRLLLEQRRYRMLQAIQTHLPKDVKVNIPVGGYFLWLEFEPSFDANSLYHFALERGVSIAPGAMFSTSSQFNHAFRLNSSFQWNGQTEKGMQIIGEGCRKLRRK

Flanking regions ( +/- flanking 50bp)

GACAATAAGTTTAAAAACGACTATAACAGTTTGAGGGTGAATAGGTAAATATGACTCGATATGAACAGCTTGCGGCACAGATACGCCAACAAATTGAAGATAATATTTGGCAATCAGGTGATCGTTTACCCTCATTACGGGATACGGTTAAACAATCAGGTTTAAGTTTAATGACCGTTTTACAATCTTATCAACTGTTAGAAAGTCAAGGGTGGATCACCGCTCGTCCGCAATCAGGTTATTATGTTGCACATCGCAATACAGGTTTTGCTCAAGTAACTGCCAGCAAAGGGCTACATATGAGTGAAAATGTTGAGATAAGCGCCTCTATATTCAATGTTCTTCAAGCCTGTAAAGATCCCAATATCATTCCGTTCGGTTCCGCCTTTCCAGATCCCAGTTTATTCATTCAACCTAAATTAAGCCGAGCATTAGCCTCTGCCGCTAGACATTTAGCCCCTCAAAGTTCAGTGATTAATTTACCTCCTGGTAATGAAAAACTACGTCGTAATATAGCCCAACGCTATGCACTGCAAGGTATTCATGTATCGCCTGACGATATTGTGATCACCGCAGGTGCGATGGAATCATTAAGTTTTAGTTTACAAGCTGTTACTGAGCCAGGAGATTGGGTTGTCATAGAATCTCCTGCTTTTTATGGCGCATTACAGGCGATAGAGCGTTTACGATTAAAAGCGATTGCCATCAAAACCGATCCGGTGACAGGCATTTGTTTAGATGAGTTAGAGAAGGTGGTAGAACAATACGACATTAAAGCGTGTTGGTTGATGAGTCATTGCCAAAATCCATTAGGTGGCACTATGCCTGATGAAAATAAAATCAGACTAGTAGAAATTTTAGCGGCAAAACAGATAACCTTAATTGAAGATGATGTCTATGGTGAACTGTATAATAGTCCAAAAGCGCCAATGCCTGTGAAAGGCTTTGATAAATCCAATAGCGTATTGCACTGCGCTTCTTTTTCTAAATGTTTAGCGCCAGGATTTCGAGTCGGGTGGGTCGCAGCCGGAAAACATGCGACTAAAATACAGCAGTTACAAATGATGAGTACTGTATCAGCGAGTATGCCAACACAACAAGCTATCGCTGACTATTTATCACAAGGGGGGTATGACGGGCACCTACGTCGCTTAAGATTATTATTAGAGCAGAGACGTTATCGTATGTTACAGGCCATACAAACGCATTTACCTAAAGATGTTAAAGTGAATATTCCTGTCGGAGGCTATTTCCTATGGTTAGAATTCGAGCCAAGCTTTGATGCTAATTCATTGTACCATTTTGCTCTCGAAAGAGGGGTGAGTATTGCACCAGGTGCTATGTTTTCGACCAGTTCACAGTTTAATCATGCTTTTCGTTTAAACTCTTCTTTTCAATGGAATGGTCAGACTGAAAAAGGAATGCAAATTATTGGTGAAGGGTGTCGAAAATTACGTCGTAAATAGAACATTAGCGTACGTATTCATCAGTTAAATGGTCATATTGCACGGCATTG