Homologs in group_1889

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14115 FBDBKF_14115 94.3 Morganella morganii S1 nuoL NADH-quinone oxidoreductase subunit L
EHELCC_08165 EHELCC_08165 94.3 Morganella morganii S2 nuoL NADH-quinone oxidoreductase subunit L
NLDBIP_08490 NLDBIP_08490 94.3 Morganella morganii S4 nuoL NADH-quinone oxidoreductase subunit L
LHKJJB_05775 LHKJJB_05775 94.3 Morganella morganii S3 nuoL NADH-quinone oxidoreductase subunit L
HKOGLL_05140 HKOGLL_05140 94.3 Morganella morganii S5 nuoL NADH-quinone oxidoreductase subunit L
PMI_RS08595 PMI_RS08595 77.1 Proteus mirabilis HI4320 nuoL NADH-quinone oxidoreductase subunit L

Distribution of the homologs in the orthogroup group_1889

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1889

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33607 0.0 949 78 1 602 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q9I0J1 0.0 781 68 1 601 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57262 0.0 611 51 4 616 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X7 0.0 576 47 2 612 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AT6 1.2e-180 528 46 5 613 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1RKE6 7.26e-113 354 37 16 622 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q9K1B0 3.42e-109 345 34 17 674 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JX92 4.06e-109 345 34 17 674 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q56227 4.91e-107 338 46 10 498 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q92G97 5.32e-107 339 36 14 604 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UK27 2.58e-106 337 41 11 486 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9PMA7 6.36e-106 335 40 10 515 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ZCG1 1.57e-102 328 41 6 453 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
P50939 1.92e-101 327 41 5 483 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q68VV7 1.33e-100 322 41 9 480 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P50366 1.66e-100 323 41 9 470 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q9XAR5 1.05e-99 320 42 11 512 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WIW1 1.17e-99 320 39 18 623 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 1.17e-99 320 39 18 623 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q35099 1.95e-98 315 42 10 458 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q9MUK8 2.73e-98 317 36 10 566 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q2LCP6 7.21e-98 316 35 12 594 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
P0C328 3.04e-97 316 44 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 3.04e-97 316 44 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 3.04e-97 316 44 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 3.04e-97 316 44 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
P29924 3.35e-97 315 43 7 480 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
Q55429 7e-97 313 37 17 618 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1X491 2.72e-96 311 36 17 612 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
P26849 4.28e-96 311 35 11 595 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
P48920 4.97e-96 311 35 10 573 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
Q34313 5.03e-96 311 39 7 479 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
P31971 5.9e-96 311 37 13 590 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q37680 8.63e-96 310 35 14 635 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
A0ZZ82 2.36e-95 311 44 7 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
Q32880 2.47e-95 310 44 8 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
Q2L960 4.37e-95 310 44 7 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
A8Y9D4 5.79e-95 310 41 11 454 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q85T01 6.46e-95 308 43 6 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
A1EA56 2.1e-94 308 42 11 446 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q6L3E3 2.97e-94 308 43 9 410 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 3.06e-94 308 43 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
P46620 5.76e-94 307 43 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q33066 5.88e-94 307 44 8 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q32440 8.5e-94 307 44 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q8HHD2 1.27e-93 304 41 8 470 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
P10330 1.82e-93 304 36 9 591 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
Q95H46 2.33e-93 306 43 9 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
B3TN96 2.51e-93 306 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q9TKV7 2.91e-93 303 36 13 571 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
B0Z5H4 3.21e-93 306 43 6 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 3.21e-93 306 43 6 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 3.21e-93 306 43 6 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 3.21e-93 306 43 6 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 3.49e-93 306 43 6 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q31952 1.39e-92 303 42 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
P20679 1.39e-92 301 40 9 472 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q32516 1.59e-92 303 43 8 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
P29388 2.12e-92 301 35 9 595 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q09FR3 2.14e-92 303 43 6 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q8S8V0 3.31e-92 303 42 8 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
P06265 3.72e-92 303 43 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q2VED3 4.04e-92 303 41 7 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q3C1N9 4.17e-92 303 43 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q0G9R5 6.29e-92 302 41 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q2MIE0 6.69e-92 302 42 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
P05510 8.17e-92 301 39 5 476 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q06GK2 8.51e-92 302 42 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q859V1 1.46e-91 301 44 7 408 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q8SHP7 2.29e-91 299 40 7 470 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
Q9TLC2 3.28e-91 300 41 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
P50365 4.41e-91 297 44 5 387 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q32RH9 4.48e-91 299 36 15 631 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
A4GGE3 5.77e-91 300 42 5 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q33BX5 5.79e-91 300 42 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q32131 7.77e-91 298 41 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q8M9U5 8.64e-91 297 34 17 636 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q2QD43 9.14e-91 299 42 5 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
P06264 1.09e-90 298 44 8 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q49KV1 1.14e-90 298 42 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q01561 1.6e-90 296 38 5 469 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
A9L9E4 1.72e-90 298 41 5 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q68RV9 2.1e-90 298 39 8 439 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q6EW03 2.29e-90 298 40 6 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
F1SVK0 2.79e-90 296 40 11 501 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q0ZIX1 3.35e-90 298 41 7 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A7Y3K7 3.51e-90 296 43 8 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
Q32091 3.63e-90 298 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q6YXQ6 3.75e-90 297 43 6 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
P51099 4.21e-90 297 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
P51095 6.32e-90 297 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q2PMM9 1.02e-89 296 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q32384 1.07e-89 296 40 8 418 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
P51096 1.33e-89 296 39 10 447 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q9MVL6 1.47e-89 295 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q9M3J4 1.49e-89 296 42 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q6QU67 1.66e-89 293 43 7 396 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q9MVK2 2.02e-89 295 41 7 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q9TLA3 2.43e-89 295 41 5 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q1ACF3 2.6e-89 293 34 12 584 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q32539 2.67e-89 295 41 6 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q32126 2.79e-89 295 42 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q31849 3e-89 295 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
Q33113 3.92e-89 293 41 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
P51098 5.06e-89 295 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
B1NWJ6 5.13e-89 295 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
P15958 5.75e-89 294 41 6 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
A1XG02 8.53e-89 294 40 6 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
A1XGU4 8.7e-89 294 43 7 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
P51097 1.32e-88 293 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
P50367 1.58e-88 291 41 5 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
Q9BBP6 2.19e-88 293 41 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q32238 4.31e-88 292 40 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q6V9D9 4.57e-88 290 41 6 411 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
Q32007 5.1e-88 292 40 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
A9LYE7 6.61e-88 291 40 9 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q3V4Y7 7.04e-88 291 40 9 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
A6MMZ2 7.12e-88 291 42 9 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q0G9H2 7.74e-88 291 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
B2LMQ1 8.32e-88 291 40 8 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
B1VKJ3 8.32e-88 291 43 8 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
A0A382 1.32e-87 291 41 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q09MC9 1.54e-87 290 43 5 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
Q06GU9 1.64e-87 291 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
Q06R83 1.69e-87 290 44 3 353 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
A4GYW4 1.71e-87 291 41 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
A4QLP4 2.09e-87 290 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q14FB0 2.51e-87 290 39 10 452 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
B5LMS9 3.07e-87 290 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
P51100 3.37e-87 290 40 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q32551 3.71e-87 290 40 6 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q09FZ9 4.2e-87 290 42 9 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
A4QLY2 4.86e-87 289 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
A4QL68 5.74e-87 289 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
B2XWI8 5.98e-87 289 42 7 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
A4QKP2 6.72e-87 289 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
A6MMR6 9.09e-87 288 42 7 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
Q19V60 1.04e-86 286 35 9 572 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
A2T379 1.1e-86 289 43 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
A4QJX9 1.48e-86 288 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
A4QKF4 2.66e-86 287 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
A6H5N8 3.28e-86 287 44 7 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P56752 3.83e-86 287 41 5 395 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
Q0H8X0 3.96e-86 285 44 5 386 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q7YJT6 5.29e-86 286 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q09WX1 5.39e-86 286 42 5 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q06FL7 6e-86 286 42 7 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
A4QLF6 8.82e-86 286 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q32S06 9.49e-86 284 40 9 450 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q70XW6 1.08e-85 286 40 8 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
A6MMI0 1.67e-85 285 42 6 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
B1A981 1.68e-85 285 41 6 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
A4QK67 2.48e-85 285 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q9TL56 2.58e-85 285 42 8 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
P11628 4.38e-85 282 40 8 415 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
P50368 6.46e-85 282 36 9 519 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
A4QKY1 8.02e-85 283 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q85FH9 9.82e-85 283 42 5 411 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
A8SEF0 7.61e-84 281 42 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q8W8H5 1.34e-83 280 42 7 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q37372 3.97e-83 277 36 15 546 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
A6MM84 4.28e-83 278 40 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
A4QJG3 4.42e-83 278 37 9 472 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q5SCZ9 4.41e-82 276 43 8 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
A4QJP7 6.06e-82 276 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q9B8C9 2.16e-80 266 39 6 422 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P48919 1.02e-79 265 39 5 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
O21335 1.85e-79 265 38 5 402 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
O79411 1.48e-78 263 37 6 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
Q8W9M6 1.07e-77 261 37 6 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q34879 7.6e-77 259 34 11 494 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q9ZZ44 7.62e-77 259 37 6 436 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
Q96069 1.22e-76 258 35 6 440 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q9ZZM3 2.13e-76 258 37 6 412 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q76LN2 6.35e-76 256 36 8 432 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
P03916 2.67e-75 254 38 5 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
P03921 3.71e-75 254 36 6 409 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q1HK80 3.94e-75 254 35 7 461 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q9B6D3 5.54e-75 255 34 6 415 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
P08739 9.33e-75 251 40 6 407 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
Q4JQH7 9.43e-75 253 37 3 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
Q94RJ2 1.05e-74 253 39 4 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
P48176 1.09e-74 253 36 8 455 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
O03205 1.39e-74 253 33 8 499 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
O03174 1.46e-74 253 37 5 387 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
P34195 1.48e-74 253 38 5 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
O79437 2.61e-74 252 34 9 465 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
P03920 2.94e-74 252 35 5 407 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q35648 3.02e-74 252 35 8 453 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
O63908 3.18e-74 251 35 6 428 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
O47815 3.23e-74 251 33 6 452 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P18940 5.9e-74 251 37 6 413 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q576B4 9.73e-74 250 35 5 407 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
O78688 1.25e-73 250 35 8 459 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
P11661 2.04e-73 249 37 6 384 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
P03915 4.91e-73 248 37 8 412 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
O78756 6.01e-73 248 35 5 410 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
P48656 7.85e-73 248 34 9 493 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P03918 8.61e-73 248 38 4 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
P55782 8.78e-73 248 38 4 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
Q9ZZ57 9.69e-73 248 35 7 461 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
Q9ZZY1 2.62e-72 246 37 4 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q00542 2.72e-72 247 34 6 460 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
P48921 3.51e-72 246 34 7 465 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
P92699 3.54e-72 246 38 4 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
P38602 8.16e-72 245 38 4 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
P92485 1.16e-71 245 33 10 519 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P24978 1.26e-71 245 35 6 411 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q9TDR1 2.3e-71 244 35 8 456 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q35813 2.32e-71 244 35 9 489 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q95885 3.03e-71 244 35 5 388 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P24979 4.03e-71 243 35 7 456 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
A9RAH0 7.48e-71 242 36 5 413 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9TA19 2.57e-70 241 36 3 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q38PR2 4.09e-70 241 37 3 377 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
Q953I4 6.81e-70 240 36 6 402 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P03917 8.28e-70 240 37 9 417 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
P03919 8.81e-70 240 35 8 433 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P41309 1.15e-69 239 36 7 409 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q2I3G4 1.2e-69 239 36 3 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
P41299 2.13e-69 239 36 5 380 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
Q35543 2.69e-69 238 36 3 378 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
Q95918 3.15e-69 238 36 5 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
P92669 4.16e-69 238 33 11 483 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
P15552 9.64e-69 238 37 9 416 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
Q37024 1.22e-68 238 36 5 386 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
P12776 2.59e-68 237 37 4 384 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q9MIY0 1.73e-66 231 33 7 478 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
Q9G2W8 3.05e-66 230 38 6 356 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
Q36459 6.81e-65 227 31 4 467 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
P03922 2.99e-64 225 33 8 449 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
P11993 1.2e-63 224 36 7 386 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
O79422 3.47e-62 219 39 5 341 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
Q36428 5.91e-60 213 34 10 426 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
B0FWD3 1.84e-59 211 33 9 415 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
O47430 2.78e-59 211 38 6 342 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
P51899 5.03e-59 205 37 7 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
P34854 1.1e-58 209 33 11 433 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
O79556 3.28e-58 208 34 8 400 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
Q00232 7.88e-58 207 34 5 381 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
P07706 1.53e-56 203 35 6 379 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
P18932 1.55e-56 203 35 10 381 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
P33510 7.94e-56 201 33 10 411 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
Q9K2S2 9.2e-56 205 34 8 415 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
O79678 7.61e-55 199 35 7 368 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q34947 8.44e-55 199 34 8 408 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
Q6GJ47 6.92e-54 200 31 13 502 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q4L4W7 1.05e-53 199 33 12 451 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q9ZYM7 1.35e-52 192 33 11 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
Q9RGZ5 5.31e-52 194 33 13 473 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8NXT2 9.11e-52 194 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 9.11e-52 194 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q49W91 9.15e-52 194 32 12 525 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q37710 1.64e-51 189 35 10 373 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
Q0Q2K0 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 3.41e-51 192 32 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q2YST2 4.26e-51 192 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q99VZ2 6.27e-51 191 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 6.27e-51 191 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 6.27e-51 191 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 6.27e-51 191 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 6.27e-51 191 31 10 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HRB2 8.35e-50 188 35 8 358 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 1.04e-49 188 35 8 358 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P15584 1.44e-49 184 30 7 395 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q8CPU8 1.65e-48 184 29 11 530 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.65e-48 184 29 11 530 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49VG9 1.87e-47 181 32 10 432 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YWT4 3.3e-47 181 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZNG6 4.19e-47 180 32 9 440 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q8NXF6 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 4.97e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q6GID6 1.41e-46 179 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
P60675 1.48e-46 179 32 8 437 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 1.48e-46 179 32 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 1.48e-46 179 32 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 1.48e-46 179 32 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 1.48e-46 179 32 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L443 2.25e-45 175 33 11 401 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
B1X5V5 3.97e-45 172 28 13 570 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
Q52978 4.33e-45 175 33 11 451 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
P77416 2.87e-44 167 33 13 415 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
D0KZ79 1.12e-43 167 36 2 288 3 dabB1 Probable inorganic carbon transporter subunit DabB1 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
P34855 1.4e-43 167 31 10 387 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
Q32905 3.28e-41 148 58 0 124 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
P48918 2.73e-39 155 31 10 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
P24896 2.95e-37 149 29 7 374 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
P24884 3.67e-36 145 31 4 302 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
Q35639 1.24e-32 127 46 2 172 3 NDH5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Pisum sativum
Q5DUY0 7.7e-32 135 28 10 409 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
P04540 9.05e-31 130 31 11 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
Q35136 1.45e-30 129 36 3 245 3 NCU16011 Probable intron-encoded endonuclease 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q31696 2.91e-29 120 33 6 240 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
P77437 4.93e-27 119 27 15 449 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
Q31HC4 4.97e-26 115 31 3 274 1 dabB Probable inorganic carbon transporter subunit DabB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P23482 2.59e-25 114 31 12 348 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
C6XAK0 9.74e-24 108 27 9 347 3 nuoN NADH-quinone oxidoreductase subunit N Methylovorus glucosotrophus (strain SIP3-4)
Q0A788 2.03e-23 107 28 8 383 3 nuoN NADH-quinone oxidoreductase subunit N Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
D0KWS8 3.54e-23 107 31 3 277 1 dabB2 Probable inorganic carbon transporter subunit DabB2 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
Q3BRP2 5.04e-23 106 28 9 380 3 nuoN NADH-quinone oxidoreductase subunit N Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A1VM73 1.1e-22 105 27 11 360 3 nuoN NADH-quinone oxidoreductase subunit N Polaromonas naphthalenivorans (strain CJ2)
Q5HRA9 1e-21 102 26 17 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ47 1.25e-21 102 26 17 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8YZV7 2.18e-21 101 24 13 467 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2JWW3 2.39e-21 101 28 13 379 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
B1I6I5 2.5e-21 101 29 13 372 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
A4G631 2.28e-20 98 24 9 372 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
Q3M9C7 2.4e-20 98 23 13 467 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A8M609 1.27e-19 96 25 9 383 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q9RGZ2 1.35e-19 95 26 18 487 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q2RU27 1.8e-19 95 25 12 380 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q39ZA5 2.19e-19 95 27 10 362 3 nuoN NADH-quinone oxidoreductase subunit N Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P72823 3.05e-19 95 25 18 451 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0C1D1 7.81e-19 93 27 11 328 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
P39755 9.84e-19 93 30 9 289 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus subtilis (strain 168)
F1SVL2 1.15e-18 92 25 7 373 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A7HY36 1.23e-18 92 25 12 347 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q02CT1 1.31e-18 92 25 7 379 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
A9B488 1.49e-18 92 24 15 530 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B5YL23 3.4e-18 91 24 7 321 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5N5W1 3.41e-18 91 24 16 508 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 3.41e-18 91 24 16 508 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9ZCG0 3.63e-18 91 25 15 440 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
B3E9V6 3.96e-18 91 26 13 390 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q6GJ44 5.41e-18 90 25 18 507 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
B7J7T2 5.99e-18 90 26 8 338 3 nuoN NADH-quinone oxidoreductase subunit N Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q2JPJ1 7.7e-18 90 27 12 377 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q4L446 8.65e-18 90 28 12 371 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
P16429 1.14e-17 90 31 9 288 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
Q3AGZ9 1.21e-17 90 27 18 485 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
B1XJL9 1.25e-17 90 25 16 451 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8NXT1 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 1.38e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 1.45e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q3AC87 1.52e-17 89 24 13 398 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2JLH4 1.63e-17 89 26 11 381 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
C1AZG0 2.06e-17 89 24 6 347 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
A1USY0 2.42e-17 89 27 9 329 3 nuoN NADH-quinone oxidoreductase subunit N Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q7A725 2.62e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.62e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.62e-17 89 25 17 500 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q83BR8 2.68e-17 88 26 8 337 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A0A6L8Q027 3.01e-17 88 26 8 295 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus anthracis
Q2JUG6 3.25e-17 88 26 14 394 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-3-3Ab)
C6D5D2 3.79e-17 88 25 10 372 3 nuoN NADH-quinone oxidoreductase subunit N Paenibacillus sp. (strain JDR-2)
A7NEJ7 4.64e-17 87 25 8 367 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q6MGN8 6.09e-17 87 24 6 349 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P9WIW3 7.15e-17 87 30 11 342 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 7.15e-17 87 30 11 342 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8IUV9 7.8e-17 87 24 12 377 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A5GD16 9.39e-17 87 27 14 382 3 nuoN NADH-quinone oxidoreductase subunit N Geotalea uraniireducens (strain Rf4)
Q8MA16 9.75e-17 87 27 8 328 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
Q8DHX4 1.1e-16 87 25 13 377 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
F1SVH9 1.4e-16 86 26 19 411 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q3B063 1.71e-16 86 28 19 489 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
C1DCB6 2.01e-16 85 27 13 377 3 nuoN NADH-quinone oxidoreductase subunit N Laribacter hongkongensis (strain HLHK9)
Q7U413 2.04e-16 86 27 18 483 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
B8G6L3 2.09e-16 85 24 12 414 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aggregans (strain MD-66 / DSM 9485)
A2CD41 2.13e-16 86 27 15 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q7V4E4 2.18e-16 86 27 15 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
P0AFE8 2.45e-16 85 27 23 497 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 2.45e-16 85 27 23 497 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
A1K5C1 3.65e-16 85 25 7 331 3 nuoN NADH-quinone oxidoreductase subunit N Azoarcus sp. (strain BH72)
Q5SCY2 4.53e-16 85 25 10 332 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
Q6YXR9 4.75e-16 84 24 16 385 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
Q0H8X6 5.67e-16 84 24 14 442 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
Q46HM4 5.9e-16 84 24 20 547 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
P26846 5.95e-16 84 25 8 331 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Marchantia polymorpha
P9WIW8 7.01e-16 84 24 9 380 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WIW9 7.13e-16 84 24 9 380 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 7.13e-16 84 24 9 380 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B0JS85 7.16e-16 84 26 11 331 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A5GP41 7.24e-16 84 27 19 487 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
Q01UN3 8.04e-16 84 26 9 328 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
A2BZX6 1.19e-15 84 26 16 461 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
A6QCE9 1.21e-15 83 26 12 387 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurovum sp. (strain NBC37-1)
Q31HE7 1.38e-15 83 24 11 378 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5N5T8 1.46e-15 83 23 10 385 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 1.46e-15 83 23 10 385 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A4J650 1.51e-15 83 24 12 385 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A8LC88 1.57e-15 83 26 11 391 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
Q5F629 2.1e-15 82 25 10 412 3 nuoN NADH-quinone oxidoreductase subunit N Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5GQH5 2.13e-15 83 26 13 376 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
Q8YQ78 2.58e-15 82 25 15 432 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7VE41 3.67e-15 82 28 11 345 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B2J565 3.74e-15 82 24 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A9B6Y0 3.76e-15 82 26 10 353 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q2W3J7 5.23e-15 81 25 9 364 3 nuoN NADH-quinone oxidoreductase subunit N Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q0I6X0 5.28e-15 81 27 10 346 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
B2JDL5 5.82e-15 81 22 14 450 3 nuoN NADH-quinone oxidoreductase subunit N Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q32RP6 6.04e-15 81 23 12 400 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Zygnema circumcarinatum
P9WIW5 6.05e-15 81 25 13 398 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 6.05e-15 81 25 13 398 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q68VV6 6.41e-15 81 24 15 406 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B0JPG4 6.6e-15 81 23 22 517 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A9QPJ1 7.45e-15 80 25 14 415 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q3MCB9 7.56e-15 81 25 17 435 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
C1F223 8.5e-15 80 26 5 298 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B1W506 9.83e-15 80 25 9 364 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q111U1 1.01e-14 80 24 11 379 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
Q92G96 1.06e-14 80 27 9 294 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A7H9U1 1.35e-14 80 27 10 317 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
P93401 1.49e-14 80 24 7 327 2 ND2 NADH-ubiquinone oxidoreductase chain 2 Oenothera berteroana
O05229 1.63e-14 80 23 11 422 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
A9BD08 1.74e-14 80 28 11 345 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q0BSL5 1.77e-14 79 25 14 348 3 nuoN NADH-quinone oxidoreductase subunit N Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q30PJ2 1.87e-14 79 26 10 343 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P50974 1.91e-14 79 28 8 287 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
A8I421 2.2e-14 79 23 7 349 3 nuoN NADH-quinone oxidoreductase subunit N Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q19V78 2.4e-14 79 23 10 364 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chlorokybus atmophyticus
C6XJX0 2.59e-14 79 23 9 361 3 nuoN NADH-quinone oxidoreductase subunit N Hirschia baltica (strain ATCC 49814 / DSM 5838 / IFAM 1418)
B0JHK5 2.8e-14 79 24 10 375 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A1AVS5 2.9e-14 79 25 12 352 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
Q8KX56 2.91e-14 79 24 15 453 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A7Y3L2 3.1e-14 79 26 17 384 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
Q10ZG8 3.29e-14 79 25 18 433 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
A9L9E7 3.6e-14 79 24 20 458 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
C5D978 4e-14 79 25 10 327 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
Q8KX53 4.1e-14 79 25 18 476 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q4UK26 4.38e-14 78 27 10 305 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P06257 4.42e-14 78 25 11 334 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Marchantia polymorpha
B8GNZ8 4.49e-14 78 26 12 387 3 nuoN NADH-quinone oxidoreductase subunit N Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A9LYF0 4.69e-14 78 25 17 387 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
Q2KUY6 4.82e-14 78 24 7 327 3 nuoN NADH-quinone oxidoreductase subunit N Bordetella avium (strain 197N)
Q2PMN2 5.31e-14 78 24 13 333 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
A7NPD6 6.12e-14 78 22 10 359 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q3MB63 6.31e-14 78 24 11 389 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B7K1G4 6.43e-14 78 23 11 390 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9I0J0 7.16e-14 78 28 23 467 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q31D31 7.61e-14 78 25 14 390 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
Q1ACP1 8.28e-14 77 24 7 332 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chara vulgaris
Q1IS52 8.44e-14 77 26 11 360 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Koribacter versatilis (strain Ellin345)
A5FX21 9.36e-14 77 26 12 345 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidiphilium cryptum (strain JF-5)
Q3V4Y4 9.65e-14 77 25 17 387 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
Q9TKV8 1e-13 77 24 16 389 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
P56911 1.05e-13 77 25 12 351 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
B3CUJ6 1.06e-13 77 28 9 323 3 nuoN NADH-quinone oxidoreductase subunit N Orientia tsutsugamushi (strain Ikeda)
Q7YJT3 1.11e-13 77 25 16 384 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
Q8DKY0 1.12e-13 77 24 15 432 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3MAR0 1.14e-13 77 26 15 380 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9MUQ6 1.22e-13 77 22 13 383 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
A8G2F5 1.32e-13 77 25 14 390 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
Q0G9R2 1.33e-13 77 25 14 382 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
O05000 1.33e-13 77 24 7 325 1 ND2 NADH-ubiquinone oxidoreductase chain 2 Arabidopsis thaliana
B2IHV3 1.4e-13 77 24 9 325 3 nuoN NADH-quinone oxidoreductase subunit N Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B1WUS5 1.48e-13 77 22 13 399 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q1GTL2 1.5e-13 77 25 12 341 3 nuoN NADH-quinone oxidoreductase subunit N Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q85BG0 1.5e-13 77 26 16 396 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q8YM86 1.55e-13 77 26 16 382 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2S2K9 1.59e-13 77 25 9 331 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
Q47HG3 1.74e-13 76 23 10 352 3 nuoN NADH-quinone oxidoreductase subunit N Dechloromonas aromatica (strain RCB)
A2BNU4 1.77e-13 77 25 14 388 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
B0C4B4 2.03e-13 76 24 16 437 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
A0LJL8 2.32e-13 76 25 17 480 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A3PAL7 2.47e-13 76 25 14 390 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q11VC5 2.5e-13 76 24 10 361 3 nuoN NADH-quinone oxidoreductase subunit N Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
C0QR92 2.5e-13 76 25 9 307 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
Q28T49 2.61e-13 76 25 8 334 3 nuoN NADH-quinone oxidoreductase subunit N Jannaschia sp. (strain CCS1)
Q9MUM8 2.64e-13 76 22 15 458 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
Q1RKE5 2.65e-13 76 25 12 310 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
O67391 2.95e-13 75 24 11 426 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
A4GGE6 3.38e-13 75 24 13 333 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
Q47LF7 3.56e-13 75 25 11 393 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
Q32S08 3.66e-13 75 25 18 436 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
C5C0R4 3.83e-13 75 22 14 482 3 nuoN NADH-quinone oxidoreductase subunit N Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q6MDQ3 4.19e-13 75 24 18 461 3 nuoN NADH-quinone oxidoreductase subunit N Protochlamydia amoebophila (strain UWE25)
Q06R80 4.39e-13 75 25 15 399 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
Q9BBP3 4.58e-13 75 23 11 330 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
Q2NA79 4.68e-13 75 24 10 340 3 nuoN NADH-quinone oxidoreductase subunit N Erythrobacter litoralis (strain HTCC2594)
Q67KP6 4.77e-13 75 23 13 401 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A1SE40 4.83e-13 75 23 10 364 3 nuoN NADH-quinone oxidoreductase subunit N Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8YMQ0 4.84e-13 75 23 11 389 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q81K10 5.14e-13 75 27 8 302 3 nuoN NADH-quinone oxidoreductase subunit N Bacillus anthracis
Q5N060 5.57e-13 75 24 19 516 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 5.57e-13 75 24 19 516 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P26848 6.04e-13 75 23 12 343 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
C1F9D0 6.16e-13 75 25 10 339 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q5PN71 6.22e-13 75 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B1XHP2 7.12e-13 75 27 17 447 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9I0I9 7.25e-13 74 26 7 283 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1ZRS0 7.41e-13 74 23 8 351 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
A1JLL1 7.69e-13 74 27 7 251 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q85FP1 7.86e-13 74 24 9 326 2 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Adiantum capillus-veneris

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02820
Feature type CDS
Gene nuoL
Product NADH-quinone oxidoreductase subunit L
Location 594803 - 596644 (strand: 1)
Length 1842 (nucleotides) / 613 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1889
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00341 NADH-quinone oxidoreductase subunit L [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways		 NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MNLLFLTILLPLIGFLLLAFSRGRWSENVSAIIGTGSVGLAALTALWAGMDFLANGGGLYEQTLWTWMSAGDFVIPVTLVLDGLSLTMLGVVTGVGFLIHMYASWYMRGEEGYSRFFAYTNLFIASMVILVLADNMLLMYLGWEGVGLCSYLLIGFYYTNPANGAAAMKAFIVTRIGDVFLAIGMFILWDKLGTLSFRELAVLAPQHFEAGSQIIFWATLMILGGAVGKSAQLPLQTWLADAMAGPTPVSALIHAATMVTAGVYLIARSHELFLLSPEVLHLVGVVGAVTLVMAGFAALVQTDIKRVLAYSTMSQIGYMFLALGVQAWDAAIFHLMTHAFFKALLFLASGSVILACHHEQNIFKMGGLRKKIPFVYICFLVGGAALAALPIITAGFYSKDEILWGAVAQGQNPLFIAGLVGAFMTSLYTFRMIFIVFHGKEHTQAHAVKGFTHTFPLLVLVILSTAAGAFIPQPLHGVFPAETIINTAADKTTTEITSGIVAVAGILLAAALWLGRRTLVTAIANSAPGRFFSAWWFRAWGFDALYDVIFVKPFKAVGWLLQSDPLNSLMNLPAVFARWSNKGLSLSENGQVRWYIASMGLGAVLVLALLLLV

Flanking regions ( +/- flanking 50bp)

CATCGTCAGCGTCAGGATCTTGATATTGATAAAGTCAGTGAGATGCGCGGATGAACTTACTCTTTTTAACCATTTTGCTGCCGCTGATTGGCTTTCTGTTATTAGCCTTTTCACGCGGACGCTGGTCAGAAAATGTGTCAGCCATCATCGGCACCGGTTCTGTCGGGCTGGCAGCACTTACGGCTCTGTGGGCGGGGATGGATTTCCTTGCCAACGGTGGCGGTTTGTATGAACAAACACTCTGGACATGGATGAGCGCGGGTGATTTCGTCATTCCGGTCACCCTGGTTCTGGACGGATTATCACTCACTATGCTGGGTGTGGTCACAGGTGTTGGTTTTCTTATCCACATGTATGCCTCCTGGTATATGCGCGGTGAAGAGGGCTATTCACGCTTCTTTGCGTACACCAACCTGTTTATCGCCAGTATGGTGATACTGGTGCTGGCAGATAACATGCTGCTGATGTACCTGGGCTGGGAAGGGGTGGGGCTGTGCAGTTATCTGCTGATCGGCTTCTATTACACCAATCCGGCAAATGGCGCGGCGGCAATGAAAGCCTTTATCGTCACGCGTATCGGTGATGTGTTCCTGGCAATCGGCATGTTTATCCTGTGGGACAAACTCGGCACCCTGAGCTTCCGTGAACTGGCGGTGCTGGCTCCTCAGCACTTTGAAGCCGGTTCTCAGATTATCTTCTGGGCGACACTGATGATTCTGGGCGGTGCGGTCGGTAAATCGGCGCAATTGCCGTTACAAACCTGGCTTGCTGATGCGATGGCAGGTCCGACGCCGGTTTCAGCACTGATCCACGCCGCAACCATGGTAACTGCGGGTGTGTATCTGATTGCCCGCAGCCATGAATTGTTCCTGTTATCACCGGAAGTGCTGCATTTAGTCGGCGTTGTCGGTGCTGTCACATTAGTGATGGCGGGCTTTGCCGCACTGGTTCAGACGGATATCAAACGTGTCCTTGCGTATTCGACCATGAGCCAGATTGGCTATATGTTCCTGGCGCTCGGCGTACAGGCATGGGATGCGGCAATTTTCCATCTGATGACCCATGCATTCTTTAAAGCCCTGTTATTCCTGGCGTCCGGCTCGGTTATCCTCGCCTGCCACCATGAACAAAACATCTTTAAGATGGGCGGACTGCGGAAAAAAATTCCGTTTGTGTATATCTGTTTCCTGGTCGGTGGTGCCGCGCTTGCTGCTCTGCCAATTATTACCGCCGGTTTCTACAGTAAAGATGAAATTCTGTGGGGCGCGGTGGCGCAGGGTCAGAATCCGTTGTTTATCGCCGGACTGGTTGGTGCCTTTATGACATCGCTGTACACCTTCCGTATGATTTTCATCGTGTTCCACGGTAAAGAGCATACACAGGCACACGCAGTGAAAGGCTTTACCCATACCTTCCCGTTACTGGTACTGGTTATCTTATCCACGGCGGCAGGGGCGTTTATCCCGCAGCCGTTACACGGGGTCTTCCCGGCTGAAACCATTATCAATACCGCGGCGGACAAAACCACGACAGAAATCACCTCAGGTATTGTGGCTGTTGCCGGTATCTTATTGGCTGCTGCTCTCTGGCTGGGTCGTCGTACGCTGGTGACAGCGATTGCGAATTCGGCACCGGGGCGTTTCTTCTCCGCCTGGTGGTTCCGAGCATGGGGCTTTGACGCCCTGTATGATGTGATTTTTGTTAAGCCGTTTAAAGCGGTGGGCTGGTTGCTGCAAAGTGATCCGCTTAACAGCCTGATGAATCTTCCGGCTGTGTTTGCGCGCTGGAGTAACAAAGGACTGAGCCTGAGTGAAAACGGGCAGGTTCGCTGGTATATCGCCTCTATGGGGCTGGGTGCAGTGCTGGTTCTCGCTCTGCTGCTTTTGGTTTAAATAAGGGACACACTGCGCCATGCTATTACCCTGGCTGATTTTAATTCCCT