Homologs in group_1927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14115 FBDBKF_14115 100.0 Morganella morganii S1 nuoL NADH-quinone oxidoreductase subunit L
EHELCC_08165 EHELCC_08165 100.0 Morganella morganii S2 nuoL NADH-quinone oxidoreductase subunit L
NLDBIP_08490 NLDBIP_08490 100.0 Morganella morganii S4 nuoL NADH-quinone oxidoreductase subunit L
LHKJJB_05775 LHKJJB_05775 100.0 Morganella morganii S3 nuoL NADH-quinone oxidoreductase subunit L
F4V73_RS02820 F4V73_RS02820 94.3 Morganella psychrotolerans nuoL NADH-quinone oxidoreductase subunit L
PMI_RS08595 PMI_RS08595 76.3 Proteus mirabilis HI4320 nuoL NADH-quinone oxidoreductase subunit L

Distribution of the homologs in the orthogroup group_1927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33607 0.0 944 77 1 602 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q9I0J1 0.0 775 68 1 601 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57262 0.0 612 50 1 610 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X7 0.0 576 47 2 611 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AT6 1e-179 525 45 4 611 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1RKE6 9.69e-113 354 37 15 618 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q92G97 1.66e-109 346 36 12 601 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9K1B0 1.98e-108 343 34 17 676 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JX92 3.27e-108 343 34 18 677 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q56227 8e-108 340 47 9 499 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q4UK27 5.2e-106 336 37 15 597 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9PMA7 1.49e-104 331 39 10 513 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9ZCG1 6.43e-103 328 41 6 453 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q9XAR5 1.75e-102 327 40 15 595 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q68VV7 3.07e-101 324 44 6 395 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q55429 5.99e-100 322 36 17 623 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P50939 9.78e-100 322 41 6 485 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
P50366 1.07e-99 320 40 8 472 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q35099 7.18e-99 317 45 7 395 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q9MUK8 2.18e-98 317 36 10 566 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
P9WIW1 4.46e-98 315 39 18 624 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 4.46e-98 315 39 18 624 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P31971 1.51e-97 315 36 13 597 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P0C328 6.62e-97 315 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 6.62e-97 315 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 6.62e-97 315 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 6.62e-97 315 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
Q2LCP6 1.15e-96 313 34 12 598 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q32880 2.25e-96 313 44 8 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
P48920 2.53e-96 311 34 12 619 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
B1X491 3.32e-96 311 35 18 670 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
Q9TKV7 4.02e-96 311 37 13 565 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q34313 4.12e-96 311 39 7 483 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
P29924 4.21e-96 312 44 7 449 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
A0ZZ82 5.41e-96 313 44 7 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
A8Y9D4 5.98e-96 313 43 9 421 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q2L960 9.01e-96 312 44 7 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
A1EA56 1.58e-95 311 42 10 445 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q6ENQ0 3.52e-95 311 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q6L3E3 3.71e-95 310 44 8 409 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
P46620 3.99e-95 310 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
Q33066 4.87e-95 310 44 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q32440 5.48e-95 310 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
P26849 8.33e-95 308 35 11 595 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q37680 1.18e-94 307 34 14 635 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
Q95H46 2.34e-94 308 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
B3TN96 2.52e-94 308 44 8 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q8HHD2 4.15e-94 306 40 8 470 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q32516 1.92e-93 306 43 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
P20679 4.84e-93 303 41 10 472 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q2MIE0 5.34e-93 305 43 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q2VED3 6.25e-93 305 42 7 414 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q31952 6.87e-93 303 42 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q0G9R5 7.72e-93 305 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q85T01 8.56e-93 302 42 5 404 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q3C1N9 1.19e-92 304 43 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P06265 1.22e-92 304 43 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
B0Z5H4 1.36e-92 305 43 7 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 1.36e-92 305 43 7 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 1.36e-92 305 43 7 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 1.36e-92 305 43 7 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 1.75e-92 305 43 7 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
P10330 1.79e-92 301 35 9 591 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
P05510 1.88e-92 303 41 4 432 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q06GK2 1.98e-92 303 42 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q8S8V0 3.38e-92 303 42 7 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q68RV9 6.84e-92 302 40 8 439 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q8SHP7 8.8e-92 300 42 6 415 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
P29388 1.17e-91 300 40 6 456 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
Q01561 1.25e-91 299 39 7 471 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
A4GGE3 1.26e-91 301 42 4 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q09FR3 1.3e-91 301 42 6 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
Q33BX5 1.34e-91 301 42 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q49KV1 1.52e-91 301 42 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
Q32131 1.54e-91 300 41 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
A7Y3K7 2.11e-91 300 43 8 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P51099 2.13e-91 301 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q32091 2.36e-91 301 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
P51095 2.36e-91 301 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q9TLC2 2.58e-91 301 41 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
P51096 2.87e-91 300 40 10 447 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q6EW03 3.07e-91 300 41 7 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q2QD43 4.83e-91 300 42 6 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
Q8M9U5 6.72e-91 298 34 15 632 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q32539 9.01e-91 299 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q31849 9.6e-91 299 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51098 1.17e-90 299 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
Q9MVL6 2.2e-90 297 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q32126 2.24e-90 298 42 8 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q2PMM9 2.25e-90 298 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q3V4Y7 2.48e-90 298 41 9 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
Q0ZIX1 2.58e-90 298 41 7 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
A9LYE7 2.67e-90 298 41 9 434 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
P06264 2.94e-90 296 43 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q9MVK2 3.12e-90 297 41 7 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q32RH9 3.16e-90 296 36 19 662 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
A9L9E4 3.86e-90 297 42 6 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
P51097 4.51e-90 297 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q32384 4.66e-90 297 41 8 418 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
B1NWJ6 4.98e-90 297 43 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
P15958 5.46e-90 297 41 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
Q9TLA3 6.17e-90 297 41 5 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
A1XG02 7.46e-90 296 40 7 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q6YXQ6 7.73e-90 296 43 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q32238 1.41e-89 296 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
Q32007 1.46e-89 296 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q6QU67 1.66e-89 293 41 7 411 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q9M3J4 1.78e-89 296 42 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
A4QLP4 1.88e-89 296 42 6 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
B1VKJ3 2.1e-89 295 43 8 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
B2LMQ1 2.59e-89 295 41 8 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
A1XGU4 2.73e-89 295 44 7 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
A6H5N8 2.78e-89 295 45 8 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
Q1ACF3 2.85e-89 293 34 11 582 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q33113 3.61e-89 293 41 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
F1SVK0 4.3e-89 293 39 10 499 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q09MC9 4.47e-89 295 44 5 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
Q9BBP6 5.18e-89 295 42 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q859V1 5.3e-89 294 43 6 411 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
P50367 8.78e-89 291 41 5 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
P50365 9.72e-89 291 42 4 396 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
P51100 1.12e-88 293 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
A4QKP2 1.23e-88 293 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
A4QL68 1.33e-88 293 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
Q06GU9 1.57e-88 293 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
Q0G9H2 1.58e-88 293 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
B5LMS9 1.68e-88 293 41 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
Q19V60 1.78e-88 291 35 12 590 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
A0A382 2.45e-88 293 42 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
A6MMZ2 3.16e-88 293 42 10 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q32551 3.19e-88 292 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q6V9D9 3.79e-88 290 41 6 411 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
A4QJX9 4.01e-88 292 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
A4QKF4 5.26e-88 292 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
P56752 6.03e-88 291 42 5 395 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
Q09FZ9 6.29e-88 291 42 7 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
A4QLY2 7.43e-88 291 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
A6MMR6 1.23e-87 291 42 9 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
A4QLF6 1.45e-87 291 41 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
A4GYW4 1.48e-87 291 41 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q14FB0 3.03e-87 290 41 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
A2T379 3.24e-87 290 43 4 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
A4QK67 3.9e-87 290 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
Q70XW6 6.44e-87 289 41 8 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
B1A981 6.72e-87 289 42 7 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q7YJT6 8.27e-87 289 42 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
Q06FL7 8.81e-87 288 42 8 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
Q06R83 1.3e-86 288 44 4 354 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q9TL56 1.53e-86 288 43 8 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
A4QKY1 1.55e-86 288 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q09WX1 1.73e-86 288 42 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q0H8X0 2.13e-86 286 42 5 405 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
A6MMI0 2.53e-86 287 42 6 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
Q32S06 2.61e-86 285 40 9 449 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
B2XWI8 2.8e-86 287 42 8 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
Q85FH9 1.08e-85 285 42 5 412 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
A8SEF0 3.96e-85 284 43 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q8W8H5 5.64e-85 284 43 7 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
P11628 9.81e-85 281 37 9 470 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
P50368 2.13e-84 281 34 11 579 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
A4QJG3 8.9e-84 280 42 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
A6MM84 1.56e-83 280 40 6 408 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
A4QJP7 6.49e-83 278 38 7 440 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q5SCZ9 1.88e-82 277 43 6 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q37372 8.37e-82 274 36 13 547 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
O21335 2.17e-79 265 38 5 402 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q9ZZM3 1.01e-78 264 37 7 448 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
O79411 7.65e-78 261 36 5 433 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
Q8W9M6 1.55e-77 260 38 4 378 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q96069 2.16e-77 260 35 8 459 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
Q4JQH7 4.26e-77 259 38 5 396 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
P03921 5.37e-77 259 37 6 409 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q9ZZ44 6.87e-77 259 37 5 433 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
P34195 7.49e-77 259 37 5 399 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
Q34879 8.18e-77 258 36 8 413 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
P48176 1.4e-76 258 38 6 400 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
Q76LN2 1.55e-76 258 37 7 410 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
O03174 1.58e-76 258 37 5 387 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
P03916 2.75e-76 257 38 5 385 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
P48919 6.87e-76 255 37 5 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
Q35648 8.47e-76 256 35 10 456 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q94RJ2 8.96e-76 256 39 4 372 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q9B8C9 1.71e-75 254 38 5 413 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
P55782 2.39e-75 255 36 7 444 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
P18940 3.94e-75 254 36 7 428 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
Q9B6D3 4.99e-75 255 34 7 415 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
P11661 1.44e-74 253 35 3 384 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
P03915 1.76e-74 252 39 6 386 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
O63908 3.12e-74 252 35 7 428 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q1HK80 3.47e-74 251 38 4 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
O79437 4.54e-74 251 36 6 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
P03920 6.49e-74 251 35 6 410 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
O47815 1.3e-73 250 34 8 451 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P08739 1.52e-73 248 40 7 407 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
O03205 1.74e-73 250 36 5 407 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
Q9ZZY1 2.71e-73 249 37 4 388 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
Q576B4 2.78e-73 249 35 6 410 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
P03918 5.23e-73 248 38 4 382 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
O78756 6.66e-73 248 35 5 407 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
O78688 7.1e-73 248 37 4 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
P48656 2.09e-72 247 36 5 409 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
P24979 2.27e-72 247 37 5 389 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
Q95885 3.19e-72 246 36 4 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P48921 3.48e-72 246 34 5 436 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
P92699 3.54e-72 246 38 4 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q00542 3.67e-72 246 38 4 377 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
P03919 4.09e-72 246 35 9 451 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P38602 4.16e-72 246 35 8 461 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
Q9ZZ57 6.35e-72 246 37 4 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
P24978 1.09e-71 245 36 4 386 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
Q35813 1.56e-71 244 35 7 453 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
Q95918 1.86e-71 244 35 7 452 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
P92485 1.93e-71 244 35 6 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P03917 5.71e-71 243 38 7 388 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
Q35543 6.12e-71 243 36 4 391 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
Q9TA19 6.97e-71 243 36 3 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
Q38PR2 9.79e-71 242 37 3 377 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P92669 1.75e-70 242 36 7 402 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q9TDR1 2.2e-70 241 36 4 379 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q2I3G4 2.34e-70 241 36 3 379 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
Q953I4 3.58e-70 241 36 3 383 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P41309 4.35e-70 241 35 6 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
P15552 5.48e-70 241 35 13 488 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
P41299 3.28e-69 238 37 3 355 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
Q37024 8.3e-69 238 36 5 382 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
P12776 1.58e-68 237 38 5 384 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q9MIY0 9.43e-68 234 35 4 393 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
A9RAH0 4.16e-67 232 35 5 413 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9G2W8 9.51e-67 231 37 6 369 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
Q36459 6.46e-66 229 31 4 469 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
P03922 8.02e-66 229 35 4 379 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
P11993 1.16e-63 224 36 7 386 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
O79422 6.81e-62 218 39 5 341 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
B0FWD3 5.25e-60 213 33 7 411 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
P34854 6.91e-60 213 33 12 455 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
P51899 9.06e-60 207 37 7 345 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
O47430 4.05e-59 211 38 6 342 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
O79556 8.47e-59 210 34 7 400 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
Q36428 2.02e-58 208 33 9 425 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
Q00232 3.25e-58 208 33 6 401 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
P18932 3.88e-58 207 35 8 376 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
P07706 4.38e-58 207 35 6 373 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
P33510 1.09e-57 206 33 8 405 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
Q9K2S2 1.46e-56 207 34 10 420 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q34947 3.57e-55 199 33 10 435 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
O79678 3.95e-55 200 32 12 463 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
Q6GJ47 1.01e-54 202 33 14 502 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q4L4W7 7.48e-54 200 34 8 410 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q9RGZ5 1.83e-53 199 33 12 433 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8NXT2 3.6e-53 198 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 3.6e-53 198 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q0Q2K0 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 1.47e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q2YST2 1.96e-52 196 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q99VZ2 2.55e-52 195 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 2.55e-52 195 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 2.55e-52 195 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 2.55e-52 195 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 2.55e-52 195 33 11 438 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9ZYM7 5.34e-52 191 33 12 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
Q49W91 8.22e-52 194 32 9 480 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q37710 4.96e-51 187 35 12 375 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
Q8CQ50 5.16e-50 189 35 8 358 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRB2 6.69e-50 188 35 8 358 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P15584 8.69e-49 182 29 8 431 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q8CPU8 1.2e-48 185 30 7 471 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.2e-48 185 30 7 471 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YWT4 2.75e-47 181 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9ZNG6 5.85e-47 180 32 9 440 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q49VG9 6.01e-47 180 32 9 425 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NXF6 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 6.25e-47 180 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
P60675 6.5e-47 180 33 8 437 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 6.5e-47 180 33 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 6.5e-47 180 33 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 6.5e-47 180 33 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 6.5e-47 180 33 8 437 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GID6 1.77e-46 179 32 9 440 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q4L443 5.78e-46 177 32 12 437 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q52978 2.04e-45 176 33 13 454 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
P77416 1.64e-44 168 33 10 415 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
B1X5V5 1.97e-44 171 28 15 576 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
D0KZ79 4.68e-44 169 36 2 288 3 dabB1 Probable inorganic carbon transporter subunit DabB1 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
P34855 1.13e-43 167 31 9 379 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
Q32905 2.01e-41 149 58 0 124 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
P48918 4.58e-40 157 32 8 403 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
P24884 1.34e-36 147 31 5 335 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
P24896 2.76e-35 143 29 8 376 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
Q35639 8.74e-33 127 46 2 172 3 NDH5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Pisum sativum
Q35136 1.29e-32 135 40 1 183 3 NCU16011 Probable intron-encoded endonuclease 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5DUY0 5.24e-32 136 29 3 334 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
P04540 5.65e-31 131 30 10 343 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
Q31696 6.24e-30 122 34 6 240 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
P77437 6.82e-28 121 27 20 509 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
Q31HC4 6.26e-27 118 31 5 278 1 dabB Probable inorganic carbon transporter subunit DabB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P23482 9.21e-26 115 31 12 348 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
D0KWS8 1.82e-23 108 32 3 277 1 dabB2 Probable inorganic carbon transporter subunit DabB2 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
Q0A788 1.85e-23 107 28 8 383 3 nuoN NADH-quinone oxidoreductase subunit N Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
C6XAK0 2.15e-23 107 27 9 347 3 nuoN NADH-quinone oxidoreductase subunit N Methylovorus glucosotrophus (strain SIP3-4)
Q3BRP2 2.22e-23 107 30 13 375 3 nuoN NADH-quinone oxidoreductase subunit N Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A1VM73 1.88e-21 101 27 11 360 3 nuoN NADH-quinone oxidoreductase subunit N Polaromonas naphthalenivorans (strain CJ2)
B1I6I5 7.05e-21 99 29 13 372 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q8YZV7 8.12e-21 99 25 11 415 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5HRA9 1.32e-20 99 27 18 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ47 1.55e-20 99 27 18 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A4G631 1.83e-20 98 24 10 375 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
Q9RGZ2 2.03e-20 98 26 16 458 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q3M9C7 5.5e-20 97 24 11 415 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q2JWW3 8.4e-20 96 28 13 378 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q2RU27 1.17e-19 95 26 10 364 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q9ZCG0 1.46e-19 95 25 15 440 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
P39755 2.19e-19 95 29 7 284 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus subtilis (strain 168)
A8M609 3.91e-19 94 26 9 383 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
Q39ZA5 5.73e-19 93 27 10 362 3 nuoN NADH-quinone oxidoreductase subunit N Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B3E9V6 5.99e-19 94 26 12 393 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q02CT1 6.29e-19 93 25 8 403 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
Q3AC87 7.36e-19 93 24 13 398 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7HY36 7.73e-19 93 25 12 347 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q0C1D1 8.47e-19 93 27 11 328 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
F1SVL2 9.77e-19 93 25 7 373 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P72823 1.23e-18 93 25 17 451 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0Q2J7 1.72e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q8NXT1 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 1.76e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q7A725 2.26e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.26e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.26e-18 92 25 17 503 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ44 3.06e-18 91 25 17 464 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q83BR8 3.43e-18 91 26 10 361 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A0A6L8Q027 4.01e-18 91 27 8 295 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus anthracis
C1AZG0 4.29e-18 91 25 7 350 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
C1DCB6 5.24e-18 90 27 14 404 3 nuoN NADH-quinone oxidoreductase subunit N Laribacter hongkongensis (strain HLHK9)
B5YL23 7.92e-18 90 24 7 319 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P16429 9.22e-18 90 30 9 288 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
B8IUV9 1.98e-17 89 25 12 377 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A4J650 3.27e-17 88 25 12 386 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q5N5W1 3.69e-17 88 24 15 493 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 3.69e-17 88 24 15 493 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A9B488 4.42e-17 88 25 13 468 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P9WIW3 4.74e-17 88 30 11 342 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 4.74e-17 88 30 11 342 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B7J7T2 5.25e-17 87 26 7 329 3 nuoN NADH-quinone oxidoreductase subunit N Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q2JUG6 5.79e-17 87 25 13 393 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-3-3Ab)
Q2JPJ1 6.22e-17 87 28 12 377 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q4L446 7.25e-17 87 27 12 371 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q6MGN8 9.25e-17 87 25 8 362 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8MA16 9.5e-17 87 26 11 358 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
P0AFE8 1.02e-16 87 27 21 492 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 1.02e-16 87 27 21 492 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q2JLH4 1.65e-16 86 26 11 381 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q31HE7 1.78e-16 85 25 12 402 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q68VV6 1.82e-16 86 25 15 406 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B8G6L3 1.86e-16 85 24 13 419 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aggregans (strain MD-66 / DSM 9485)
A1USY0 2.09e-16 85 26 7 326 3 nuoN NADH-quinone oxidoreductase subunit N Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P9WIW8 2.5e-16 85 24 10 382 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q01UN3 2.95e-16 85 26 9 328 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
P9WIW9 3.08e-16 85 24 10 382 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 3.08e-16 85 24 10 382 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0H8X6 4.12e-16 85 25 15 443 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
F1SVH9 4.4e-16 85 26 19 411 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B1XJL9 4.69e-16 85 25 14 393 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A1K5C1 4.77e-16 84 25 7 331 3 nuoN NADH-quinone oxidoreductase subunit N Azoarcus sp. (strain BH72)
A9B6Y0 5.07e-16 84 26 10 353 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8DHX4 5.13e-16 84 26 13 377 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A5GD16 5.29e-16 84 26 13 380 3 nuoN NADH-quinone oxidoreductase subunit N Geotalea uraniireducens (strain Rf4)
Q6YXR9 5.57e-16 84 26 14 342 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
B1W506 6.12e-16 84 26 9 364 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A7NEJ7 6.4e-16 84 24 8 367 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
C6D5D2 6.78e-16 84 24 9 371 3 nuoN NADH-quinone oxidoreductase subunit N Paenibacillus sp. (strain JDR-2)
B0JS85 8.84e-16 84 27 12 331 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0BSL5 1.05e-15 83 26 14 348 3 nuoN NADH-quinone oxidoreductase subunit N Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B2J565 1.07e-15 84 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7VE41 1.6e-15 83 27 13 384 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q5F629 1.78e-15 82 25 11 431 3 nuoN NADH-quinone oxidoreductase subunit N Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B0JHK5 1.84e-15 83 24 10 384 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A2CD41 2.15e-15 83 27 14 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q3AGZ9 2.16e-15 82 27 18 473 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q5SCY2 2.35e-15 82 24 9 332 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
Q7V4E4 2.84e-15 82 27 14 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
A8LC88 2.87e-15 82 26 10 365 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
Q2KUY6 3.34e-15 82 25 8 331 3 nuoN NADH-quinone oxidoreductase subunit N Bordetella avium (strain 197N)
A5GQH5 4.2e-15 82 25 10 328 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
C1F223 4.46e-15 81 27 6 300 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A9QPJ1 4.87e-15 81 26 13 415 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q92G96 5.16e-15 81 24 15 405 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2W3J7 6.08e-15 81 25 10 366 3 nuoN NADH-quinone oxidoreductase subunit N Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B8GNZ8 7.71e-15 80 27 14 393 3 nuoN NADH-quinone oxidoreductase subunit N Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C6XJX0 8.94e-15 80 24 9 361 3 nuoN NADH-quinone oxidoreductase subunit N Hirschia baltica (strain ATCC 49814 / DSM 5838 / IFAM 1418)
B2JDL5 9.14e-15 80 22 13 417 3 nuoN NADH-quinone oxidoreductase subunit N Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
P26846 1.11e-14 80 25 8 331 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Marchantia polymorpha
P50974 1.28e-14 80 28 10 292 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q19V78 1.49e-14 80 23 9 364 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chlorokybus atmophyticus
P93401 1.83e-14 79 25 8 327 2 ND2 NADH-ubiquinone oxidoreductase chain 2 Oenothera berteroana
Q7U413 1.83e-14 80 26 18 469 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q111U1 2.08e-14 79 25 10 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
B7K1G4 2.51e-14 79 25 13 388 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q5N5T8 2.56e-14 79 23 11 373 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 2.56e-14 79 23 11 373 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q28T49 2.62e-14 79 25 8 337 3 nuoN NADH-quinone oxidoreductase subunit N Jannaschia sp. (strain CCS1)
B1WUS5 2.72e-14 79 23 11 365 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
P56911 3.06e-14 79 25 12 351 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
A8I421 3.1e-14 79 24 8 349 3 nuoN NADH-quinone oxidoreductase subunit N Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6MDQ3 3.18e-14 79 23 16 457 3 nuoN NADH-quinone oxidoreductase subunit N Protochlamydia amoebophila (strain UWE25)
P06257 3.51e-14 79 25 11 335 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Marchantia polymorpha
A5GP41 3.77e-14 79 27 11 347 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
Q9I0J0 3.83e-14 79 28 22 468 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q46HM4 4.42e-14 79 24 20 528 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q0I6X0 5.02e-14 78 26 13 412 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q30PJ2 5.2e-14 78 27 5 262 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A2BZX6 5.37e-14 78 24 19 524 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
A7NPD6 5.46e-14 78 22 10 360 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A1AVS5 5.58e-14 78 26 12 352 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
B3QXM3 6.06e-14 78 22 12 364 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A7H9U1 6.33e-14 78 27 10 317 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
C0QR92 6.84e-14 78 25 9 307 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
Q1IS52 7.73e-14 77 26 12 360 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Koribacter versatilis (strain Ellin345)
Q3B063 7.74e-14 78 27 18 473 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q1RKE5 7.94e-14 77 23 17 408 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q11VC5 9.01e-14 77 24 8 359 3 nuoN NADH-quinone oxidoreductase subunit N Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q32RP6 9.64e-14 77 24 10 331 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Zygnema circumcarinatum
A5FX21 1.08e-13 77 26 12 344 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidiphilium cryptum (strain JF-5)
A9BD08 1.13e-13 77 27 13 384 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
Q1ACP1 1.19e-13 77 24 7 332 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chara vulgaris
Q4UK26 1.23e-13 77 23 16 439 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3MAR0 1.25e-13 77 25 14 389 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A7Y3L2 1.27e-13 77 25 17 384 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
Q8YM86 1.3e-13 77 26 15 391 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3CUJ6 1.62e-13 76 31 5 219 3 nuoN NADH-quinone oxidoreductase subunit N Orientia tsutsugamushi (strain Ikeda)
Q2NA79 1.84e-13 76 25 12 341 3 nuoN NADH-quinone oxidoreductase subunit N Erythrobacter litoralis (strain HTCC2594)
C5C0R4 1.98e-13 76 23 14 482 3 nuoN NADH-quinone oxidoreductase subunit N Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
A6QCE9 2.01e-13 76 26 14 388 3 nuoN NADH-quinone oxidoreductase subunit N Sulfurovum sp. (strain NBC37-1)
Q8KX56 2.08e-13 76 25 14 416 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O67391 2.18e-13 76 25 10 404 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Aquifex aeolicus (strain VF5)
B4EZ47 2.33e-13 76 25 20 429 3 nuoN NADH-quinone oxidoreductase subunit N Proteus mirabilis (strain HI4320)
O05000 2.43e-13 76 24 8 325 1 ND2 NADH-ubiquinone oxidoreductase chain 2 Arabidopsis thaliana
Q2S2K9 2.56e-13 76 25 9 331 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
Q47LF7 2.62e-13 76 26 9 340 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
Q2PMN2 2.64e-13 76 24 13 333 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
Q9I0I9 2.73e-13 76 27 7 283 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9LYF0 2.82e-13 76 25 17 387 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
B7KEZ9 3.07e-13 76 23 8 359 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeothece citriformis (strain PCC 7424)
Q8YQ78 3.08e-13 76 25 13 381 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O05229 3.27e-13 75 22 11 422 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
B2IHV3 4.04e-13 75 23 8 325 3 nuoN NADH-quinone oxidoreductase subunit N Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1GTL2 4.06e-13 75 25 12 341 3 nuoN NADH-quinone oxidoreductase subunit N Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P9WIW5 4.51e-13 75 26 9 298 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 4.51e-13 75 26 9 298 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q67KP6 4.73e-13 75 23 13 401 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3V4Y4 4.96e-13 75 25 17 387 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
Q5PN71 5.26e-13 75 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9TKV8 5.32e-13 75 23 17 401 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
C5D978 5.53e-13 75 24 10 324 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
Q0G9R2 5.81e-13 75 24 18 448 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
A1JLL1 5.96e-13 75 28 8 252 3 nuoN NADH-quinone oxidoreductase subunit N Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7NGP8 6.24e-13 75 24 8 321 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q81K10 6.4e-13 75 27 10 330 3 nuoN NADH-quinone oxidoreductase subunit N Bacillus anthracis
B5RCE1 6.5e-13 75 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella gallinarum (strain 287/91 / NCTC 13346)
A4WCQ5 7.69e-13 74 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
O47497 7.7e-13 74 26 15 378 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
Q3MB63 9.02e-13 74 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A9MJA9 9.09e-13 74 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8DKY0 9.31e-13 74 25 13 378 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A7MHT8 9.41e-13 74 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Cronobacter sakazakii (strain ATCC BAA-894)
C1F9D0 9.64e-13 74 25 10 346 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A9L9E7 9.93e-13 74 24 16 385 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
B9L178 1.05e-12 74 26 7 314 3 nuoN NADH-quinone oxidoreductase subunit N Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q3MCB9 1.05e-12 74 25 15 384 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q47HG3 1.16e-12 74 23 11 353 3 nuoN NADH-quinone oxidoreductase subunit N Dechloromonas aromatica (strain RCB)
B5FPF7 1.19e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella dublin (strain CT_02021853)
Q7YJT3 1.23e-12 74 25 15 382 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
Q8Z530 1.24e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhi
B4TPJ8 1.24e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella schwarzengrund (strain CVM19633)
B4SYY7 1.24e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella newport (strain SL254)
B4TBI2 1.24e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella heidelberg (strain SL476)
Q8ZNE4 1.27e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N592 1.27e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R2Z7 1.27e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella enteritidis PT4 (strain P125109)
B5EZJ7 1.27e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella agona (strain SL483)
Q57M40 1.35e-12 73 26 7 269 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella choleraesuis (strain SC-B67)
Q10ZG8 1.37e-12 74 24 16 425 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
A4GGE6 1.64e-12 73 24 13 333 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
Q8YMQ0 1.65e-12 73 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A1SE40 1.76e-12 73 23 9 358 3 nuoN NADH-quinone oxidoreductase subunit N Nocardioides sp. (strain ATCC BAA-499 / JS614)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_05140
Feature type CDS
Gene nuoL
Product NADH-quinone oxidoreductase subunit L
Location 82015 - 83856 (strand: 1)
Length 1842 (nucleotides) / 613 (amino acids)
In genomic island -

Contig

Accession ZDB_682
Length 259781 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00341 NADH-quinone oxidoreductase subunit L [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways
NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MNLLFLTILLPLIGFLLLAFSRGRWSENVSATIGTGSVGLAALTALWAGMDFFANGGGVYQQTLWTWMDTASFSIPVTLVLDGLSLTMLGVVTGVGFLIHMYASWYMRGEEGYSRFFAYTNLFIASMVILVLADNMLLMYLGWEGVGLCSYLLIGFYYTNPANGAAAMKAFIVTRIGDVFLAIGMFILWDKLGTLSFRELAVLAPQHIAAGSDLIFWATLMILGGAVGKSAQLPLQTWLADAMAGPTPVSALIHAATMVTAGVYLIARTHELFLLSPEVLHLVGVVGAVTLVMAGFAALVQTDIKRVLAYSTMSQIGYMFLALGVQAWDAAIFHLMTHAFFKALLFLASGSVILACHHEQNIFKMGGLRKKIPFVYLCFLVGGAALAALPLITAGFYSKDEILWGAVVQGQNPLFIAGLVGAFMTSLYTFRMIFIVFHGKEHTQAHAVKGFTHTFPLLVLMVLSTAAGAFIPQPLHGVFPAETLTGSADGKLTTEIISGVVAVAGIVLAAMLWLGRRTLVTAVANSAPGRFFSAWWFRAWGFDDLYDAIFVKPFKAVGWLLQSDPLNSLMNLPALFARWSNKGLSLSENGQVRWYIASMGLGAVLVLALLFLV

Flanking regions ( +/- flanking 50bp)

CATCGTCAGCGTCAGGATCTGGATATTGATAAAGTCAGTGAGATGCGCGGATGAACTTACTCTTTTTAACCATTTTGCTGCCGCTGATTGGCTTTCTGTTATTAGCCTTTTCACGCGGCCGCTGGTCAGAAAATGTGTCAGCCACCATCGGCACCGGTTCGGTGGGACTGGCGGCACTCACAGCGCTGTGGGCGGGGATGGATTTCTTCGCTAACGGCGGCGGGGTGTATCAGCAGACACTGTGGACATGGATGGATACCGCTTCCTTCTCCATCCCGGTTACCCTGGTGCTGGACGGCCTGTCGCTGACCATGCTGGGTGTGGTTACCGGCGTCGGTTTCCTGATCCACATGTATGCTTCCTGGTATATGCGCGGTGAAGAGGGCTATTCCCGCTTCTTCGCCTACACCAACCTGTTTATCGCCAGTATGGTGATTCTGGTGCTGGCCGATAATATGCTGCTGATGTACCTCGGCTGGGAAGGGGTGGGGCTGTGCAGTTATCTGCTGATCGGCTTCTATTACACCAACCCGGCCAACGGCGCAGCGGCAATGAAAGCCTTTATCGTCACCCGTATCGGTGATGTGTTCCTGGCGATCGGCATGTTTATCCTGTGGGATAAACTGGGCACCCTGAGCTTCCGTGAACTGGCGGTTCTGGCTCCGCAGCATATTGCGGCCGGTTCTGACCTGATTTTCTGGGCGACTCTGATGATCCTCGGCGGTGCGGTCGGTAAATCCGCGCAGTTACCACTCCAGACCTGGCTTGCGGACGCTATGGCCGGTCCGACACCGGTTTCGGCACTGATCCACGCCGCAACCATGGTAACCGCAGGTGTGTATCTGATTGCCCGTACCCATGAGCTGTTCCTGTTATCACCGGAAGTGCTGCATTTAGTCGGCGTGGTCGGTGCTGTCACCCTGGTGATGGCCGGTTTTGCCGCGCTGGTGCAGACGGATATCAAACGTGTTCTTGCCTACTCCACCATGAGCCAGATTGGTTATATGTTCCTGGCGCTCGGTGTGCAGGCGTGGGATGCGGCGATTTTCCACCTGATGACCCATGCATTCTTCAAAGCCCTGTTATTCCTGGCCTCCGGCTCGGTGATCCTGGCCTGCCACCACGAGCAGAACATCTTTAAGATGGGCGGACTGCGGAAAAAAATTCCGTTTGTCTATCTCTGCTTCCTGGTGGGCGGTGCCGCACTGGCCGCACTGCCGCTCATCACCGCCGGTTTCTACAGTAAAGATGAAATCCTGTGGGGTGCGGTGGTTCAGGGGCAGAACCCGCTGTTTATCGCCGGTCTGGTCGGTGCCTTTATGACATCGCTCTATACCTTCCGGATGATTTTCATCGTGTTCCACGGCAAAGAGCATACACAGGCGCATGCGGTGAAAGGCTTTACCCATACTTTCCCGTTACTGGTGCTGATGGTGCTCTCCACTGCCGCCGGTGCCTTTATCCCGCAACCGCTGCACGGCGTGTTCCCGGCGGAAACCCTTACCGGTTCTGCTGACGGCAAACTGACTACCGAAATTATTTCCGGTGTGGTTGCTGTGGCGGGGATTGTGCTGGCCGCAATGCTCTGGCTGGGCCGTCGTACGCTGGTGACAGCGGTTGCGAATTCCGCGCCGGGACGCTTCTTCTCGGCCTGGTGGTTCCGCGCATGGGGCTTTGATGATCTGTATGATGCGATTTTTGTTAAGCCGTTCAAAGCGGTGGGCTGGTTGCTGCAGAGTGACCCGCTGAACAGCCTGATGAATCTGCCTGCGCTGTTTGCCCGCTGGAGTAACAAAGGACTGAGCCTGAGTGAAAACGGACAGGTCCGCTGGTATATCGCCTCTATGGGGCTGGGTGCAGTGCTGGTTCTCGCTCTGCTGTTTTTGGTTTAAATAAGGGACACATTGCGCCATGCTATTACCCTGGCTGATTTTACTTCCCT