Homologs in group_1927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14115 FBDBKF_14115 76.3 Morganella morganii S1 nuoL NADH-quinone oxidoreductase subunit L
EHELCC_08165 EHELCC_08165 76.3 Morganella morganii S2 nuoL NADH-quinone oxidoreductase subunit L
NLDBIP_08490 NLDBIP_08490 76.3 Morganella morganii S4 nuoL NADH-quinone oxidoreductase subunit L
LHKJJB_05775 LHKJJB_05775 76.3 Morganella morganii S3 nuoL NADH-quinone oxidoreductase subunit L
HKOGLL_05140 HKOGLL_05140 76.3 Morganella morganii S5 nuoL NADH-quinone oxidoreductase subunit L
F4V73_RS02820 F4V73_RS02820 77.1 Morganella psychrotolerans nuoL NADH-quinone oxidoreductase subunit L

Distribution of the homologs in the orthogroup group_1927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33607 0.0 895 72 1 601 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
Q9I0J1 0.0 781 68 3 602 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57262 0.0 587 48 2 613 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X7 0.0 561 46 1 610 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AT6 0.0 535 47 6 615 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1RKE6 1.51e-117 366 38 17 625 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
Q92G97 4.1e-116 363 37 16 625 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UK27 3.56e-113 355 38 14 584 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P9WIW1 1.54e-110 348 40 14 618 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 1.54e-110 348 40 14 618 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZCG1 7.88e-108 341 41 6 453 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q9K1B0 1.71e-107 341 35 20 670 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P50939 5.22e-107 341 43 6 478 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
Q9PMA7 8.9e-107 337 38 12 568 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2LCP6 1.14e-106 339 36 11 597 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
Q68VV7 1.43e-106 338 40 13 538 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9XAR5 1.83e-106 338 39 18 651 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9JX92 2.46e-106 338 35 20 670 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q34313 7.01e-106 337 35 10 592 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
P50366 1.33e-105 336 43 8 476 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q56227 2.19e-103 328 52 5 408 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B1X491 2.84e-102 327 35 15 651 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
P29924 4.26e-102 328 43 9 492 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P48920 5.73e-102 327 37 11 572 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
Q35099 1.05e-100 321 43 9 461 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q37680 1.92e-99 320 37 15 587 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
P29388 5.25e-98 316 37 13 586 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
P10330 5.92e-98 316 38 13 589 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
Q55429 3e-97 315 37 15 597 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8HHD2 9.79e-97 312 40 7 472 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
P31971 1.41e-96 312 37 16 592 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9MUK8 1.88e-96 311 37 14 564 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q9TKV7 3.42e-96 311 37 14 567 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q85T01 3.52e-96 311 33 10 628 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P26849 4.65e-96 311 36 12 583 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q8SHP7 5.31e-96 311 40 7 473 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
P0C328 7.66e-94 307 45 6 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 7.66e-94 307 45 6 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 7.66e-94 307 45 6 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 7.66e-94 307 45 6 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
P20679 1.23e-93 304 39 10 486 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
P05510 4.39e-93 305 40 6 449 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q32880 4.76e-93 304 44 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
A1EA56 1.43e-92 304 43 6 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
P50367 1.52e-92 301 35 12 585 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
Q01561 1.67e-92 301 37 8 487 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
A8Y9D4 2e-92 303 44 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
Q33066 3.95e-92 303 44 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
Q1ACF3 4.08e-92 300 35 12 594 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
Q32440 1.29e-91 301 44 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q6L3E3 1.43e-91 301 43 5 395 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q6ENQ0 1.57e-91 301 43 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
P46620 1.63e-91 301 43 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
F1SVK0 2.59e-91 298 40 12 516 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B3TN96 5.16e-91 300 45 6 391 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
P50365 5.61e-91 297 42 6 422 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q95H46 6.22e-91 299 44 5 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
Q859V1 7.01e-91 299 42 6 415 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
Q8M9U5 1.3e-90 297 40 10 472 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q6QU67 3.04e-90 295 38 9 479 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
B0Z5H4 4.44e-90 298 41 4 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 4.44e-90 298 41 4 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 4.44e-90 298 41 4 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 4.44e-90 298 41 4 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
Q9MTI4 5.95e-90 298 41 4 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q6YXQ6 2.6e-89 295 42 8 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
A0ZZ82 3.66e-89 295 42 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
P50368 4.51e-89 293 34 14 589 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
Q32384 4.56e-89 295 40 6 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q0G9R5 5.05e-89 294 40 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
Q31952 5.65e-89 293 41 6 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q2L960 6.15e-89 294 42 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q9TLC2 9.79e-89 294 41 4 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q2VED3 1.47e-88 293 41 6 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
P06264 1.51e-88 292 44 7 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q6V9D9 1.52e-88 291 38 7 477 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
Q8S8V0 1.61e-88 293 41 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
A7Y3K7 2.07e-88 292 39 7 438 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P51099 4.05e-88 292 41 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
Q0ZIX1 4.54e-88 292 39 7 463 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
Q0H8X0 4.78e-88 290 42 7 417 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q2MIE0 4.88e-88 292 41 6 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
Q32539 6.82e-88 291 41 7 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q68RV9 1.07e-87 291 41 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q49KV1 1.21e-87 290 41 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
P51098 1.48e-87 290 40 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
A4GGE3 1.86e-87 290 40 6 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
Q31849 2e-87 290 40 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
P51096 2.76e-87 290 40 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q3C1N9 2.88e-87 290 41 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
Q32516 3.27e-87 290 41 7 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
Q06GK2 3.74e-87 289 42 6 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
P51095 3.78e-87 290 40 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
Q32S06 4e-87 288 35 15 602 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q6EW03 4.15e-87 290 40 4 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q32091 4.2e-87 289 40 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q09FR3 4.42e-87 289 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
P06265 5.86e-87 289 41 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
P51097 6.71e-87 289 40 6 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q9TLA3 7.07e-87 288 41 4 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q33BX5 7.15e-87 288 41 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q32126 8.19e-87 288 40 6 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
Q2QD43 9.98e-87 288 41 5 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
B2LMQ1 2.12e-86 287 40 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
A0A382 3.18e-86 287 41 4 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
A9L9E4 3.49e-86 287 42 5 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
Q32007 3.56e-86 287 40 7 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
Q32131 3.88e-86 286 40 5 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q33113 3.98e-86 285 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
A1XG02 4.77e-86 286 39 4 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
Q32238 5.47e-86 286 40 7 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
P15958 6.66e-86 286 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
B1NWJ6 1.05e-85 286 41 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
Q06R83 1.09e-85 286 44 3 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
Q9M3J4 2.4e-85 285 42 5 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
Q32551 2.92e-85 285 40 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q9BBP6 4.43e-85 284 41 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q32RH9 4.74e-85 283 44 5 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
Q2PMM9 5.12e-85 284 42 4 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
A6H5N8 6.2e-85 283 42 6 397 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
Q06FL7 6.32e-85 283 41 6 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
A1XGU4 6.4e-85 283 42 4 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q9MVL6 8.81e-85 282 41 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
A4QLP4 1.04e-84 283 41 6 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q09MC9 2.83e-84 282 42 5 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
B2XWI8 4.14e-84 281 41 5 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
Q85FH9 4.41e-84 281 41 5 408 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
A4QL68 4.56e-84 281 41 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
B1VKJ3 5.18e-84 281 43 8 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
A4GYW4 5.55e-84 281 41 4 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q9MVK2 7.11e-84 280 41 5 389 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q37372 7.77e-84 279 35 11 568 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
Q14FB0 7.91e-84 281 41 4 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
Q3V4Y7 8.29e-84 280 41 5 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
A9LYE7 8.46e-84 280 41 5 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
B5LMS9 1.2e-83 280 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
A4QKP2 1.66e-83 280 41 5 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
A6MMR6 1.9e-83 280 41 4 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
P51100 2.02e-83 280 39 6 403 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
A4QJX9 2.33e-83 280 41 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
B1A981 3.69e-83 279 41 5 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
P56752 3.69e-83 279 41 6 394 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
A4QKF4 3.81e-83 279 41 5 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q09WX1 4.51e-83 279 42 4 390 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q09FZ9 7.86e-83 278 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
O79411 9.47e-83 274 38 6 434 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
A4QLY2 9.9e-83 278 41 4 392 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
A2T379 1.29e-82 278 42 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
A4QLF6 1.45e-82 277 41 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
P11628 2.03e-82 275 36 8 469 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
Q06GU9 2.07e-82 277 42 4 387 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
Q70XW6 3.7e-82 276 40 7 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
A4QK67 7.53e-82 275 41 5 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
A6MMZ2 1.22e-81 275 40 4 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
Q19V60 1.43e-81 272 34 13 577 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chlorokybus atmophyticus
A8SEF0 1.96e-81 274 41 4 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q9TL56 2.9e-81 274 42 5 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
Q0G9H2 3.32e-81 273 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q9ZZM3 4.63e-81 270 36 8 499 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
A4QKY1 7.89e-81 273 41 5 393 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
O03174 1.2e-80 269 34 12 505 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
P48176 3.32e-80 268 36 8 489 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
A6MMI0 3.65e-80 271 41 4 388 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
Q8W8H5 4.01e-80 271 40 6 395 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q9B8C9 4.91e-80 266 38 5 420 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8W9M6 6.69e-80 266 36 9 462 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q7YJT6 1.1e-79 270 40 4 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
P48919 1.45e-79 265 38 5 420 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
A6MM84 1.51e-79 269 40 5 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
Q9ZZ44 5.4e-79 265 39 6 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
Q94RJ2 6.55e-79 264 36 9 478 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q5SCZ9 8.31e-79 267 41 7 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
A4QJG3 1.61e-78 266 41 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
Q96069 1.75e-78 263 34 8 488 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
O21335 6.94e-78 261 35 9 465 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
A4QJP7 8.97e-78 264 41 6 394 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
P18940 1.04e-77 261 36 8 441 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
P34195 2.38e-77 260 39 6 412 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
P03920 2.62e-77 260 33 8 471 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q76LN2 4.84e-77 259 37 5 408 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q576B4 9.36e-77 258 33 8 471 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
Q34879 1.78e-76 258 34 10 476 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
Q4JQH7 1.92e-76 258 38 5 405 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
O47815 1.94e-76 257 33 6 481 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
Q1HK80 5.75e-76 256 35 7 471 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
P48921 8.29e-76 256 35 7 472 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
P55782 8.81e-76 256 38 5 393 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
Q9B6D3 1.89e-75 256 35 7 417 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q35813 4.72e-75 254 35 7 483 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
P03916 5.06e-75 254 35 12 486 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
P03921 5.2e-75 254 34 9 498 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q35648 8.35e-75 253 35 11 487 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q00542 8.42e-75 253 34 8 474 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
O78688 2.14e-74 252 37 9 462 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
P38602 3e-74 252 33 7 487 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
O78756 3.8e-74 251 35 4 404 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q9TA19 5.41e-74 251 34 8 489 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
P24978 6.39e-74 251 33 5 430 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
O79437 7.83e-74 251 33 12 531 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
Q9ZZ57 2.11e-73 249 35 7 471 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
Q38PR2 4.31e-73 249 34 8 488 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
P11661 4.58e-73 249 33 7 459 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q95918 7.97e-73 248 36 7 447 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
P03915 8.39e-73 248 37 10 451 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
Q35543 1.07e-72 247 34 8 459 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
A9RAH0 1.29e-72 247 36 6 420 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P48656 1.7e-72 247 34 7 483 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
Q2I3G4 2.59e-72 246 33 7 488 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
P92669 3.71e-72 246 34 7 461 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
O63908 4.25e-72 246 34 8 455 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q9ZZY1 6.11e-72 245 35 5 410 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
O03205 7.16e-72 245 32 6 481 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
P24979 7.39e-72 245 35 10 480 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
P92485 7.86e-72 245 32 7 515 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
Q9TDR1 1.35e-71 244 35 4 398 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
P41309 5.45e-71 243 32 8 492 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q95885 7.68e-71 243 37 8 391 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
P41299 1.03e-70 242 35 3 402 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
P03918 1.49e-70 242 38 6 394 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
Q9MIY0 1.78e-70 242 35 10 457 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
Q953I4 1.24e-69 239 36 7 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
P03919 1.36e-69 239 36 7 406 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
P08739 2.22e-69 237 40 7 405 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chlamydomonas reinhardtii
P92699 2.74e-69 238 38 6 384 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q37024 8.44e-69 238 37 6 389 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
P03917 1.29e-68 236 35 10 448 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
P03922 1.58e-65 228 36 6 410 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Xenopus laevis
Q9G2W8 2.65e-64 225 38 8 369 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Myxine glutinosa
P12776 4.26e-64 225 35 8 443 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
Q36459 4.79e-64 224 32 7 482 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
P11993 9.18e-64 224 36 4 377 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q9K2S2 3.1e-63 226 36 8 414 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
P15552 1.28e-62 221 37 7 381 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
O79422 1.93e-62 220 37 4 394 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
Q00232 1.3e-61 217 35 7 400 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Mytilus edulis
O79556 1.44e-61 217 33 12 480 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lycodon semicarinatus
P34854 6.19e-60 213 33 9 416 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
O47430 1.36e-59 212 36 5 389 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
B0FWD3 4.92e-59 210 34 8 416 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
P51899 7.04e-59 204 36 5 341 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
O79678 5.14e-58 208 35 7 398 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
P18932 2.13e-57 206 35 8 384 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
P33510 3.12e-57 205 33 9 407 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
P07706 1.12e-56 204 35 8 384 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
Q9RGZ5 1.28e-56 207 35 10 417 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q36428 1.44e-56 203 33 7 414 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
Q49W91 2e-55 204 32 13 524 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L4W7 5.13e-55 203 34 10 447 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
Q34947 8.93e-54 196 30 10 492 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
Q8CPU8 1.65e-53 199 34 6 395 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.65e-53 199 34 6 395 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GJ47 1.8e-51 193 33 10 417 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q9ZYM7 9.46e-51 187 33 10 374 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
Q8NXT2 2.58e-50 189 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 2.58e-50 189 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q0Q2K0 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2YST2 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2U8 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 9.61e-50 188 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
Q99VZ2 1.78e-49 187 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 1.78e-49 187 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 1.78e-49 187 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 1.78e-49 187 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 1.78e-49 187 33 9 409 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P60675 2.13e-49 187 34 9 419 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 2.13e-49 187 34 9 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 2.13e-49 187 34 9 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 2.13e-49 187 34 9 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 2.13e-49 187 34 9 419 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YWT4 3.8e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXF6 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 6.58e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
Q6GID6 6.64e-49 186 34 7 393 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
Q9ZNG6 6.71e-49 186 34 7 393 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q5HRB2 1.22e-48 185 33 11 431 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ50 1.48e-48 184 33 11 431 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q37710 1.9e-48 180 34 7 342 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
P77416 5.87e-48 177 33 11 415 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
P15584 9e-48 179 29 7 398 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paramecium tetraurelia
Q49VG9 1.75e-47 181 32 12 433 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L443 3.35e-46 177 33 12 421 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q52978 4.78e-45 175 31 14 510 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
P34855 1.74e-44 169 31 9 377 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Apis mellifera ligustica
P48918 2.95e-41 160 31 6 413 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Albinaria caerulea
B1X5V5 4.44e-41 161 27 14 604 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
Q32905 4.82e-41 148 59 0 122 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pisum sativum
D0KZ79 5.08e-41 160 34 3 300 3 dabB1 Probable inorganic carbon transporter subunit DabB1 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
P24896 4.85e-37 148 30 9 374 3 nduo-5 NADH-ubiquinone oxidoreductase chain 5 Caenorhabditis elegans
P24884 9.7e-34 139 29 8 334 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ascaris suum
Q35136 1.26e-31 132 35 5 246 3 NCU16011 Probable intron-encoded endonuclease 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q35639 5.16e-31 122 43 2 180 3 NDH5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Pisum sativum
P04540 2.48e-30 129 31 9 336 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trypanosoma brucei brucei
Q31696 4.17e-29 119 32 4 236 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles quadriannulatus
P23482 1.27e-28 124 32 11 356 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
Q5DUY0 1.79e-28 125 31 6 310 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Nyctotherus ovalis
Q31HC4 4.13e-27 119 30 3 274 1 dabB Probable inorganic carbon transporter subunit DabB Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P77437 1.23e-25 114 29 12 353 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
C6XAK0 2.89e-24 110 27 8 343 3 nuoN NADH-quinone oxidoreductase subunit N Methylovorus glucosotrophus (strain SIP3-4)
Q0A788 1.82e-23 107 27 8 383 3 nuoN NADH-quinone oxidoreductase subunit N Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q6GJ44 4.09e-23 106 26 12 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
Q2RU27 5.57e-23 106 26 10 365 3 nuoN NADH-quinone oxidoreductase subunit N Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
D0KWS8 2.46e-22 104 32 4 277 1 dabB2 Probable inorganic carbon transporter subunit DabB2 Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
Q8NXT1 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 2.62e-22 104 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 3.37e-22 103 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q3BRP2 3.89e-22 103 28 9 376 3 nuoN NADH-quinone oxidoreductase subunit N Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q7A725 4.63e-22 103 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 4.63e-22 103 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 4.63e-22 103 26 13 456 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
B1I6I5 4.94e-22 103 27 11 369 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q8MA16 1.45e-21 102 25 13 408 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chaetosphaeridium globosum
Q9RGZ2 1.5e-21 101 26 13 457 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9ZCG0 1.93e-21 101 23 15 473 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q8CQ47 2.1e-21 101 25 15 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRA9 2.16e-21 101 25 15 458 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q3M9C7 3.46e-21 100 25 11 382 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q02CT1 4.4e-21 100 26 8 408 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Solibacter usitatus (strain Ellin6076)
A1VM73 5.5e-21 100 28 12 362 3 nuoN NADH-quinone oxidoreductase subunit N Polaromonas naphthalenivorans (strain CJ2)
A4G631 6.88e-21 99 24 10 386 3 nuoN NADH-quinone oxidoreductase subunit N Herminiimonas arsenicoxydans
Q8YZV7 9.38e-21 99 25 11 382 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3E9V6 1.46e-20 98 26 10 378 3 nuoN NADH-quinone oxidoreductase subunit N Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A8M609 1.55e-20 99 25 9 386 3 nuoN NADH-quinone oxidoreductase subunit N Salinispora arenicola (strain CNS-205)
A7HY36 2.44e-20 98 26 10 343 3 nuoN NADH-quinone oxidoreductase subunit N Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q6YXR9 3.25e-20 97 25 11 347 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Physcomitrium patens
B8G6L3 4.15e-20 97 26 15 434 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aggregans (strain MD-66 / DSM 9485)
C1AZG0 5.43e-20 97 26 10 355 3 nuoN NADH-quinone oxidoreductase subunit N Rhodococcus opacus (strain B4)
B5YL23 6.83e-20 96 24 7 328 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q2JLH4 8.68e-20 96 26 14 413 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9I0J0 1.55e-19 95 28 20 447 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39755 1.67e-19 95 28 9 287 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus subtilis (strain 168)
Q68VV6 2.27e-19 95 23 15 464 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q3AC87 2.29e-19 95 25 12 368 3 nuoN NADH-quinone oxidoreductase subunit N Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0C1D1 2.41e-19 94 25 8 332 3 nuoN NADH-quinone oxidoreductase subunit N Hyphomonas neptunium (strain ATCC 15444)
A0A6L8Q027 3.68e-19 94 29 9 282 3 dabB Probable inorganic carbon transporter subunit DabB Bacillus anthracis
Q2JUG6 3.81e-19 94 27 13 388 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain JA-3-3Ab)
P72823 6.21e-19 94 24 18 454 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A1K5C1 7.95e-19 93 26 9 380 3 nuoN NADH-quinone oxidoreductase subunit N Azoarcus sp. (strain BH72)
Q2JWW3 8.45e-19 93 26 15 432 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q5N5W1 1.14e-18 93 25 11 381 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 1.14e-18 93 25 11 381 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L446 1.22e-18 92 28 12 371 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
F1SVH9 1.39e-18 92 26 12 381 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
C6XJX0 1.73e-18 92 25 9 363 3 nuoN NADH-quinone oxidoreductase subunit N Hirschia baltica (strain ATCC 49814 / DSM 5838 / IFAM 1418)
B1W506 1.85e-18 92 28 10 365 3 nuoN3 NADH-quinone oxidoreductase subunit N 3 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A7NEJ7 2.25e-18 92 24 8 402 3 nuoN NADH-quinone oxidoreductase subunit N Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q83BR8 2.3e-18 92 25 8 346 3 nuoN NADH-quinone oxidoreductase subunit N Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
F1SVL2 2.76e-18 91 26 9 386 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P0AFE8 3.09e-18 91 27 15 390 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 3.09e-18 91 27 15 390 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
A9B488 4.13e-18 91 24 12 439 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q1ACP1 4.74e-18 90 24 7 358 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chara vulgaris
Q92G96 7.91e-18 90 23 14 456 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B7J7T2 8.66e-18 90 26 7 330 3 nuoN NADH-quinone oxidoreductase subunit N Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
P16429 8.98e-18 90 31 9 290 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
Q5SCY2 1.01e-17 90 25 10 334 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Huperzia lucidula
B0JHK5 1.04e-17 90 25 11 371 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q111U1 1.15e-17 90 26 12 366 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichodesmium erythraeum (strain IMS101)
P06257 2.05e-17 89 26 12 374 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Marchantia polymorpha
Q39ZA5 2.27e-17 88 26 13 390 3 nuoN NADH-quinone oxidoreductase subunit N Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8IUV9 2.88e-17 88 24 12 382 3 nuoN NADH-quinone oxidoreductase subunit N Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q19V78 4.4e-17 88 24 12 373 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Chlorokybus atmophyticus
A5GQH5 4.5e-17 88 27 12 329 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
A4J650 4.77e-17 87 25 10 366 3 nuoN NADH-quinone oxidoreductase subunit N Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C1F223 6.5e-17 87 28 5 298 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q32RP6 6.53e-17 87 25 16 443 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Zygnema circumcarinatum
Q8DHX4 6.93e-17 87 25 16 418 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5N5T8 8.51e-17 87 24 13 368 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P29801 8.51e-17 87 24 13 368 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A5GD16 8.76e-17 87 25 12 376 3 nuoN NADH-quinone oxidoreductase subunit N Geotalea uraniireducens (strain Rf4)
Q92QN9 1.01e-16 86 25 8 336 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Rhizobium meliloti (strain 1021)
B2J565 1.08e-16 87 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q2W3J7 1.16e-16 86 25 11 354 3 nuoN NADH-quinone oxidoreductase subunit N Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2KUY6 1.45e-16 86 25 9 336 3 nuoN NADH-quinone oxidoreductase subunit N Bordetella avium (strain 197N)
A1USY0 1.6e-16 86 24 8 380 3 nuoN NADH-quinone oxidoreductase subunit N Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
C6D5D2 1.76e-16 86 24 7 342 3 nuoN NADH-quinone oxidoreductase subunit N Paenibacillus sp. (strain JDR-2)
A8I421 1.85e-16 85 23 7 372 3 nuoN NADH-quinone oxidoreductase subunit N Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6MGN8 2.12e-16 85 26 10 361 3 nuoN NADH-quinone oxidoreductase subunit N Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A1AVS5 2.53e-16 85 26 9 356 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
Q46GY3 2.8e-16 85 24 15 429 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain NATL2A)
P93401 2.95e-16 85 25 11 376 2 ND2 NADH-ubiquinone oxidoreductase chain 2 Oenothera berteroana
Q8K9X6 3.14e-16 85 23 17 490 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q31HE7 3.49e-16 85 23 10 423 3 nuoN NADH-quinone oxidoreductase subunit N Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B8J1C7 3.55e-16 85 28 10 328 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
P26846 3.69e-16 85 25 9 331 3 ND2 NADH-ubiquinone oxidoreductase chain 2 Marchantia polymorpha
A9B6Y0 4.11e-16 85 25 9 366 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B1WUS5 5.79e-16 84 23 12 374 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2JPJ1 6.2e-16 84 27 12 377 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
A2BPR7 6.5e-16 84 23 13 436 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain AS9601)
Q3AGZ9 6.7e-16 84 26 11 329 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
A6LXP5 7.03e-16 84 25 10 333 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P9WIW8 7.08e-16 84 24 11 385 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B0JS85 7.3e-16 84 26 11 331 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P9WIW9 8.23e-16 84 24 11 385 1 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A5M1 8.23e-16 84 24 11 385 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C1DCB6 8.33e-16 84 26 14 430 3 nuoN NADH-quinone oxidoreductase subunit N Laribacter hongkongensis (strain HLHK9)
A8G3E9 8.7e-16 84 23 13 436 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9215)
Q85BG0 8.93e-16 84 25 18 449 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
Q7U413 9.07e-16 84 24 16 465 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
Q7VDE7 9.35e-16 84 24 17 490 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B1XJL9 9.93e-16 84 24 13 401 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q1IS52 1.09e-15 84 26 12 391 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Koribacter versatilis (strain Ellin345)
Q1RKE5 1.17e-15 83 22 14 456 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
A8LC88 1.19e-15 83 27 9 365 3 nuoN NADH-quinone oxidoreductase subunit N Parafrankia sp. (strain EAN1pec)
Q0BSL5 1.54e-15 83 26 12 349 3 nuoN NADH-quinone oxidoreductase subunit N Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
O05000 1.8e-15 83 25 8 325 1 ND2 NADH-ubiquinone oxidoreductase chain 2 Arabidopsis thaliana
Q47HG3 1.86e-15 82 24 13 405 3 nuoN NADH-quinone oxidoreductase subunit N Dechloromonas aromatica (strain RCB)
Q31CA0 2.02e-15 82 23 11 384 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9312)
Q01UN3 2.04e-15 82 26 9 326 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Solibacter usitatus (strain Ellin6076)
Q3MB63 2.23e-15 82 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O05229 2.57e-15 82 23 8 383 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
Q6MDQ3 2.79e-15 82 23 17 470 3 nuoN NADH-quinone oxidoreductase subunit N Protochlamydia amoebophila (strain UWE25)
Q8DMR6 3.41e-15 82 24 12 359 1 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q1IS45 3.59e-15 82 24 9 359 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Koribacter versatilis (strain Ellin345)
B7K1G4 3.71e-15 82 25 13 367 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Rippkaea orientalis (strain PCC 8801 / RF-1)
B2JDL5 4.06e-15 82 23 11 377 3 nuoN NADH-quinone oxidoreductase subunit N Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
P56911 4.48e-15 81 24 9 341 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Rhizobium meliloti (strain 1021)
A3PBF7 4.63e-15 81 23 13 437 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9301)
B3DZT0 5.34e-15 81 24 12 393 3 nuoN NADH-quinone oxidoreductase subunit N Methylacidiphilum infernorum (isolate V4)
P0CD37 5.37e-15 81 25 7 320 3 ndhB2 NAD(P)H-quinone oxidoreductase subunit 2 B, chloroplastic Psilotum nudum
P0CD36 5.37e-15 81 25 7 320 3 ndhB1 NAD(P)H-quinone oxidoreductase subunit 2 A, chloroplastic Psilotum nudum
Q9MUM8 5.64e-15 81 22 14 455 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
Q8YMQ0 5.73e-15 81 25 12 362 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B8JAZ0 5.97e-15 81 25 10 371 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A7NPD6 6.13e-15 81 25 11 359 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q0APX7 6.14e-15 81 25 16 390 3 nuoN NADH-quinone oxidoreductase subunit N Maricaulis maris (strain MCS10)
P9WIW5 6.17e-15 81 26 8 301 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 6.17e-15 81 26 8 301 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8GNZ8 6.47e-15 81 24 10 421 3 nuoN NADH-quinone oxidoreductase subunit N Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B1ZRS0 6.56e-15 81 23 7 330 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
C5D978 6.66e-15 81 25 11 332 3 nuoN NADH-quinone oxidoreductase subunit N Geobacillus sp. (strain WCH70)
Q10ZG8 6.87e-15 81 25 13 393 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
Q28T49 6.91e-15 81 25 7 338 3 nuoN NADH-quinone oxidoreductase subunit N Jannaschia sp. (strain CCS1)
P9WIW3 7.81e-15 81 29 10 313 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 7.81e-15 81 29 10 313 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2BV95 7.86e-15 80 23 14 438 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus (strain MIT 9515)
Q9I0I9 1.37e-14 80 25 9 370 3 nuoN NADH-quinone oxidoreductase subunit N Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B9LGS9 1.57e-14 80 25 14 390 3 nuoN NADH-quinone oxidoreductase subunit N Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
P26848 1.75e-14 80 22 12 393 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
A9HRS3 1.76e-14 79 26 8 318 3 nuoN NADH-quinone oxidoreductase subunit N Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q7V2N8 1.8e-14 80 24 13 417 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q9ZD13 2.13e-14 79 23 10 366 3 nuoN NADH-quinone oxidoreductase subunit N Rickettsia prowazekii (strain Madrid E)
A5GP41 2.31e-14 79 24 19 468 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
Q2NA79 2.42e-14 79 26 10 361 3 nuoN NADH-quinone oxidoreductase subunit N Erythrobacter litoralis (strain HTCC2594)
A9QPJ1 2.52e-14 79 25 12 392 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
Q67KP6 2.53e-14 79 24 13 397 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q68WJ7 2.55e-14 79 23 10 366 3 nuoN NADH-quinone oxidoreductase subunit N Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P50974 2.68e-14 79 28 9 298 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
A5FX21 2.7e-14 79 28 12 344 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Acidiphilium cryptum (strain JF-5)
A7H9U1 3.17e-14 79 26 8 316 3 nuoN NADH-quinone oxidoreductase subunit N Anaeromyxobacter sp. (strain Fw109-5)
Q8YQ78 3.18e-14 79 24 15 386 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8KX56 3.42e-14 79 25 18 459 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q8DKY0 3.54e-14 79 24 16 439 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B7KEZ9 3.54e-14 79 23 9 370 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Gloeothece citriformis (strain PCC 7424)
Q85FH5 3.63e-14 79 22 18 444 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
Q5F629 3.72e-14 79 24 11 398 3 nuoN NADH-quinone oxidoreductase subunit N Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q2S2K9 4.07e-14 79 24 9 365 3 nuoN NADH-quinone oxidoreductase subunit N Salinibacter ruber (strain DSM 13855 / M31)
Q9BBP3 4.18e-14 78 26 7 229 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
Q0H8X6 4.22e-14 78 24 12 403 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
Q4UK26 4.47e-14 78 22 14 456 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9TKV8 5.09e-14 78 24 18 451 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
B3CUJ6 5.74e-14 78 30 6 226 3 nuoN NADH-quinone oxidoreductase subunit N Orientia tsutsugamushi (strain Ikeda)
A9L9E7 5.96e-14 78 25 19 443 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
Q7VE41 6.89e-14 78 26 10 323 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C5C0R4 7.18e-14 78 24 15 415 3 nuoN NADH-quinone oxidoreductase subunit N Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
A9BD08 7.47e-14 78 24 16 461 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
A4WCQ5 8.36e-14 77 25 11 369 3 nuoN NADH-quinone oxidoreductase subunit N Enterobacter sp. (strain 638)
A0LJL8 8.4e-14 77 25 8 344 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q5PN71 8.89e-14 77 25 7 277 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P29925 8.9e-14 77 28 9 292 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
B0BYP3 9.43e-14 77 24 14 366 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2 Acaryochloris marina (strain MBIC 11017)
C0QR92 9.93e-14 77 22 9 376 3 nuoN NADH-quinone oxidoreductase subunit N Persephonella marina (strain DSM 14350 / EX-H1)
B2IHV3 9.95e-14 77 23 8 327 3 nuoN NADH-quinone oxidoreductase subunit N Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
P93313 1.03e-13 77 24 13 421 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
Q11VC5 1.1e-13 77 25 12 378 3 nuoN NADH-quinone oxidoreductase subunit N Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q47LF7 1.12e-13 77 26 11 343 3 nuoN NADH-quinone oxidoreductase subunit N Thermobifida fusca (strain YX)
B1MAF7 1.15e-13 77 25 12 388 3 nuoN NADH-quinone oxidoreductase subunit N Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q0I6X0 1.18e-13 77 26 9 278 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q5GS15 1.27e-13 77 25 10 323 3 nuoN NADH-quinone oxidoreductase subunit N Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q9MUQ6 1.28e-13 77 24 11 336 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Mesostigma viride
O67342 1.3e-13 77 22 11 393 3 nuoN1 NADH-quinone oxidoreductase subunit N 1 Aquifex aeolicus (strain VF5)
B1X5D6 1.39e-13 77 25 11 366 3 ndhB NAD(P)H-quinone oxidoreductase subunit 2, organellar chromatophore Paulinella chromatophora
B5RCE1 1.39e-13 77 25 7 277 3 nuoN NADH-quinone oxidoreductase subunit N Salmonella gallinarum (strain 287/91 / NCTC 13346)
A2CD41 1.43e-13 77 27 12 329 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q85FP1 1.45e-13 77 25 9 327 2 ndhB NAD(P)H-quinone oxidoreductase subunit 2, chloroplastic Adiantum capillus-veneris

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08595
Feature type CDS
Gene nuoL
Product NADH-quinone oxidoreductase subunit L
Location 1876718 - 1878553 (strand: -1)
Length 1836 (nucleotides) / 611 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter
PF00662 NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1009 Energy production and conversion (C) C Membrane H+-translocase/NADH:ubiquinone oxidoreductase subunit 5 (chain L)/Multisubunit Na+/H+ antiporter, MnhA subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00341 NADH-quinone oxidoreductase subunit L [EC:7.1.1.2] Oxidative phosphorylation
Metabolic pathways
NADH:quinone oxidoreductase, prokaryotes

Protein Sequence

MNILYLTFVLPLLGFLLLAFSGGRWSENVSAWIGTGAVGLSALVTLWVGIDFFAHGQETEVLTLWTWMSAGNFTIPFTLVLDGLSLTMLGVITGVGFLIHMYASWYMRGEEGYSRFFAYTNLFIASMVVLVLADNMMLMYMGWEGVGLCSYLLIGFYYNNPANGAAAMKAFIVTRIGDVFLAIGMFILFDQLGTLSFREMAVLAPEQLTAGSSIINWAMLMVLGGAVGKSAQLPLQTWLADAMAGPTPVSALIHAATMVTAGVYLVARSHALFLMAPDILELVGIVGAVTLVLAGFAALVQTDIKRILAYSTMSQIGYMFLALGAQAWDGAIFHLMTHAFFKALLFLSAGSVIIACHHEQNIFKMGGLRKKIPFVYACFLIGGGALAALPLLTAGFFSKDEILWGAYANGHFNLMLAGLIGAFFTSLYTFRLIFIVFHGETKTEAHQVKGFTHTFPLAVLALLSTFIGALITQPLGDVFPESTVTHEGKYVLEILSGVVAIVGVAIAAWLYLKQRQLVSQVANTKTGRFFSTWWFHAWGFDALYEVLFVKPYKGAAWLIQNDPVNQFFNLFGCLFKGANKGLSFSENGLARWYAASLGLGAVLVIALLLLV

Flanking regions ( +/- flanking 50bp)

CATCGTCATCGCCAAAACCTCAATATTGATACAGTCAGTGAGATGCGCGGATGAATATACTCTATTTAACCTTTGTGCTACCACTGCTGGGATTTTTACTGCTCGCATTCTCAGGTGGTCGTTGGTCTGAAAATGTATCAGCATGGATTGGCACGGGCGCTGTTGGTTTATCAGCTTTAGTGACACTTTGGGTGGGGATAGATTTCTTTGCTCACGGACAAGAAACAGAAGTCTTAACACTCTGGACTTGGATGTCAGCGGGGAACTTTACTATCCCATTTACGTTGGTGCTTGATGGCCTATCATTAACCATGCTAGGTGTTATCACTGGCGTTGGTTTTCTTATTCATATGTATGCATCTTGGTATATGCGTGGTGAAGAAGGATATTCTCGCTTCTTTGCTTATACCAACTTATTTATCGCGAGTATGGTTGTTTTAGTATTGGCTGATAATATGATGCTGATGTATATGGGTTGGGAAGGGGTTGGTTTATGTAGTTACTTATTAATTGGTTTCTACTATAACAACCCAGCTAATGGCGCGGCAGCAATGAAAGCATTTATTGTTACCCGTATTGGTGATGTCTTCTTAGCTATCGGTATGTTTATCCTGTTTGATCAATTAGGTACGCTAAGTTTCCGCGAAATGGCGGTACTGGCTCCTGAACAACTGACCGCAGGATCAAGCATCATTAACTGGGCAATGTTAATGGTCTTAGGGGGTGCGGTAGGTAAATCAGCACAACTGCCATTACAAACTTGGTTAGCGGATGCGATGGCCGGTCCAACACCTGTTTCTGCGTTGATCCACGCCGCCACCATGGTTACCGCTGGTGTGTACTTAGTTGCCCGTAGTCATGCGCTATTCTTAATGGCACCTGATATCTTAGAATTAGTCGGTATCGTTGGTGCAGTGACATTAGTATTAGCGGGTTTTGCGGCTTTAGTACAAACCGATATCAAGCGTATTCTTGCTTACTCAACCATGAGCCAAATTGGTTATATGTTCTTGGCGTTGGGTGCTCAAGCATGGGATGGCGCAATTTTCCACTTAATGACTCACGCATTCTTTAAAGCATTACTGTTCTTATCTGCAGGTTCAGTGATTATTGCCTGCCATCATGAACAGAATATCTTTAAGATGGGCGGGTTACGTAAGAAGATCCCATTTGTTTATGCATGCTTTTTAATTGGTGGAGGTGCTTTAGCAGCATTACCACTGTTAACAGCAGGGTTCTTCAGTAAAGATGAAATCTTATGGGGTGCGTACGCAAACGGACATTTCAATTTAATGTTAGCAGGTTTAATTGGCGCATTCTTTACGTCACTTTATACCTTCCGTTTAATTTTCATCGTATTCCATGGTGAAACCAAAACCGAAGCACACCAAGTTAAAGGCTTCACTCATACTTTCCCATTAGCGGTATTAGCGTTGTTATCAACCTTTATTGGGGCGTTAATTACCCAACCGTTAGGCGATGTTTTCCCAGAAAGCACCGTTACTCATGAAGGTAAGTATGTATTAGAAATCCTTTCTGGTGTGGTAGCGATTGTAGGCGTTGCCATTGCAGCATGGTTATACCTGAAACAGCGTCAACTTGTTTCTCAGGTGGCAAATACCAAAACAGGGCGTTTCTTCTCAACATGGTGGTTCCACGCATGGGGATTTGATGCACTGTATGAGGTGCTGTTTGTCAAACCTTATAAAGGTGCGGCATGGCTTATCCAAAATGATCCTGTTAACCAATTCTTTAATCTCTTTGGTTGTCTCTTTAAAGGCGCCAATAAAGGCTTGAGTTTCAGTGAAAACGGATTAGCGCGTTGGTATGCGGCTTCTCTCGGTTTAGGTGCAGTGCTGGTTATCGCTCTGCTGCTTCTGGTTTAATTAAGGGACACATTGCGCCATGTTATTACCCTGGCTAATACTTATTCCCT