Homologs in group_1928

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14345 FBDBKF_14345 94.8 Morganella morganii S1 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
EHELCC_07935 EHELCC_07935 94.8 Morganella morganii S2 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
NLDBIP_08260 NLDBIP_08260 94.8 Morganella morganii S4 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
LHKJJB_06005 LHKJJB_06005 94.8 Morganella morganii S3 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
HKOGLL_04910 HKOGLL_04910 94.8 Morganella morganii S5 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
PMI_RS08840 PMI_RS08840 67.6 Proteus mirabilis HI4320 prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase

Distribution of the homologs in the orthogroup group_1928

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1928

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A293 3.42e-179 499 74 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A294 3.42e-179 499 74 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhi
P39199 1.2e-175 491 72 0 309 1 prmB Ribosomal protein uL3 glutamine methyltransferase Escherichia coli (strain K12)
Q32DK7 3.97e-175 489 71 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q0WDE1 8.07e-174 486 72 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Yersinia pestis
Q9KQ83 5.5e-160 451 67 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P39200 2.49e-159 449 67 0 308 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio anguillarum (strain ATCC 68554 / 775)
Q5E3U5 2.82e-157 444 65 0 309 3 prmB Ribosomal protein uL3 glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8ECQ4 1.12e-139 400 60 2 311 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P45106 7.02e-138 395 59 0 302 3 prmB Ribosomal protein uL3 glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNN7 1.38e-130 377 55 0 306 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q9I347 9.47e-115 336 55 0 296 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5NEL0 3.2e-106 315 49 1 301 3 prmB Ribosomal protein uL3 glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q7VXJ6 1.01e-92 280 47 1 290 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9JYC0 5.99e-91 276 47 4 301 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F783 6.06e-91 275 47 4 295 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JTA1 6.53e-91 275 47 4 301 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8P7Q8 8.4e-86 263 48 3 296 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q63SZ9 8.51e-84 258 43 3 296 3 prmB Ribosomal protein uL3 glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q9PDL1 4.92e-83 256 47 2 296 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q87DS5 5.98e-83 255 47 2 296 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q89DG5 3.99e-80 248 46 4 290 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8DPZ3 2.18e-34 129 36 4 210 3 prmC Release factor glutamine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8KCD5 1.28e-33 127 41 5 185 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q7ULT2 1.13e-30 120 37 6 209 3 prmC Release factor glutamine methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A9WBM9 1.6e-30 119 32 4 238 3 prmC Release factor glutamine methyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q68VR6 2.31e-28 117 34 5 233 3 prmC/trmB Bifunctional methyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RH40 2.4e-28 117 31 5 246 3 prmC/trmB Bifunctional methyltransferase Rickettsia bellii (strain RML369-C)
Q9PD67 2.46e-28 113 38 2 193 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q92G13 5.82e-28 116 31 3 241 3 prmC/trmB Bifunctional methyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2RFW1 1.09e-27 112 35 0 185 3 prmC Release factor glutamine methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q748B2 1.47e-27 111 35 3 189 3 prmC Release factor glutamine methyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7NJS7 3.6e-27 110 35 1 197 3 prmC Release factor glutamine methyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q87DF7 5.89e-27 109 37 2 193 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P45873 6.89e-27 109 32 8 268 3 prmC Release factor glutamine methyltransferase Bacillus subtilis (strain 168)
Q9ZCB3 1.79e-26 112 32 5 233 3 prmC/trmB Bifunctional methyltransferase Rickettsia prowazekii (strain Madrid E)
Q4UJU4 1.79e-26 112 33 3 217 3 prmC/trmB Bifunctional methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O51215 7.86e-26 107 32 4 192 3 prmC Release factor glutamine methyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8DHV7 2.09e-25 105 35 3 193 3 prmC Release factor glutamine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6F0I4 2.14e-25 106 32 5 193 3 prmC Release factor glutamine methyltransferase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q7W022 2.81e-25 105 37 2 180 3 prmC Release factor glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8PC99 6.77e-25 104 36 2 197 3 prmC Release factor glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8A1D7 1.15e-24 103 33 7 214 3 prmC Release factor glutamine methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5F5B4 3.27e-24 102 35 5 196 3 prmC Release factor glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B5YIQ8 1.67e-23 100 29 4 207 3 prmC Release factor glutamine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q8F987 2.73e-23 100 34 7 196 3 prmC Release factor glutamine methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q97F67 3.23e-23 99 30 2 187 3 prmC Release factor glutamine methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5NIA7 7.61e-23 99 28 5 266 3 prmC Release factor glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
O84027 8.89e-23 99 32 7 218 3 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0B9D1 8.89e-23 99 32 7 218 1 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q814U1 9.65e-23 98 30 7 234 3 prmC Release factor glutamine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81JX2 1.83e-22 97 30 7 234 3 prmC Release factor glutamine methyltransferase Bacillus anthracis
Q8R619 3.03e-22 98 31 6 235 3 prmC Release factor glutamine methyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8Y4A9 8.84e-22 95 35 3 181 3 prmC Release factor glutamine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3J2B7 3e-21 94 34 7 260 3 prmC Release factor glutamine methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1II29 3.8e-21 94 31 6 207 3 prmC Release factor glutamine methyltransferase Koribacter versatilis (strain Ellin345)
Q6MU88 4.14e-21 94 31 6 204 3 prmC Release factor glutamine methyltransferase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2FWE1 6.1e-21 93 30 6 218 3 prmC Release factor glutamine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9K4E3 7.93e-21 93 32 5 206 3 prmC Release factor glutamine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CHX0 9.28e-21 92 30 6 219 3 prmC Release factor glutamine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q83AD8 9.65e-21 92 32 3 204 3 prmC Release factor glutamine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9CG70 1.46e-20 92 33 4 204 3 prmC Release factor glutamine methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
O66506 1.66e-20 92 26 3 204 3 prmC Release factor glutamine methyltransferase Aquifex aeolicus (strain VF5)
Q32GZ5 5.87e-20 90 30 3 202 3 prmC Release factor glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
P40816 6.63e-20 90 34 2 184 3 prmC Release factor glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HVC8 1.13e-19 90 36 2 185 3 prmC Release factor glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0ACC2 1.14e-19 90 30 3 202 3 prmC Release factor glutamine methyltransferase Shigella flexneri
P0ACC1 1.14e-19 90 30 3 202 1 prmC Release factor glutamine methyltransferase Escherichia coli (strain K12)
Q7CIA2 1.15e-19 90 29 4 227 3 prmC Release factor glutamine methyltransferase Yersinia pestis
Q831F7 1.19e-19 90 28 4 197 3 prmC Release factor glutamine methyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
P74003 1.25e-19 90 29 4 199 3 prmC Release factor glutamine methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9WYV8 1.42e-19 89 29 5 203 1 prmC Release factor glutamine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q98G94 1.64e-19 89 32 4 195 3 prmC Release factor glutamine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8EAR4 1.79e-19 89 29 2 197 3 prmC Release factor glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9RXR2 6.45e-19 87 32 2 182 3 prmC Release factor glutamine methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q63QE9 7.77e-19 87 34 3 187 3 prmC Release factor glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q2S0V8 8.14e-19 88 32 3 171 3 prmC Release factor glutamine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q727D9 9.35e-19 87 31 6 255 3 prmC Release factor glutamine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9A9T7 1.74e-18 87 28 1 208 3 prmC Release factor glutamine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6H162 2.62e-18 86 31 7 211 3 prmC Release factor glutamine methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B8E004 2.78e-18 86 27 3 233 3 prmC Release factor glutamine methyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q2RWE0 1.13e-17 85 30 3 207 3 prmC Release factor glutamine methyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q89XT8 7.63e-17 82 30 5 211 3 prmC Release factor glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P45253 9.92e-17 82 31 4 200 3 prmC Release factor glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5HY34 1.87e-16 81 28 5 214 3 prmC Release factor glutamine methyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
Q89AT0 2.16e-16 80 28 2 194 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9KQ26 3.83e-16 80 30 4 193 3 prmC Release factor glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9Y5R4 9.27e-16 80 30 5 228 1 HEMK1 MTRF1L release factor glutamine methyltransferase Homo sapiens
Q8K9W9 3.95e-14 74 28 5 200 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P72542 8.78e-14 73 26 6 228 1 papM 4-amino-L-phenylalanine/4-methylamino-L-phenylalanine methyltransferase Streptomyces pristinaespiralis
Q9CN82 1.51e-13 73 27 7 235 3 prmC Release factor glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q5E6T2 2.18e-13 72 27 4 212 3 prmC Release factor glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8G3P4 3.01e-13 72 26 5 216 3 prmC Release factor glutamine methyltransferase Bifidobacterium longum (strain NCC 2705)
P57269 5.36e-13 71 26 4 197 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q921L7 4.03e-12 69 27 5 233 2 Hemk1 MTRF1L release factor glutamine methyltransferase Mus musculus
P75419 6.25e-11 66 27 8 235 4 MPN_362 Uncharacterized protein MG259 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7VDL7 3.14e-10 63 30 4 188 3 prmC Release factor glutamine methyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q49404 8.33e-10 62 29 5 175 4 MG259 Uncharacterized protein MG259 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P45832 1.31e-09 61 29 7 212 3 prmC Release factor glutamine methyltransferase Mycobacterium leprae (strain TN)
A7MXM2 1.31e-09 60 31 0 85 3 VIBHAR_00953 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
A0R213 2.75e-09 60 29 4 186 3 prmC Release factor glutamine methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
C6Y2G0 3.99e-09 59 41 0 79 3 Phep_2972 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pedobacter heparinus (strain ATCC 13125 / DSM 2366 / CIP 104194 / JCM 7457 / NBRC 12017 / NCIMB 9290 / NRRL B-14731 / HIM 762-3)
O14028 7.24e-09 59 27 10 217 3 mtq1 Probable MRF1 mitochondrial N(5)-glutamine methyltransferase mtq1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q87SB8 7.3e-09 58 27 1 128 3 VP0506 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3LSR6 1.09e-08 58 28 3 127 3 VCM66_0619 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KU62 1.09e-08 58 28 3 127 3 VC_0661 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CM79 3.07e-07 54 34 6 126 3 rsmC Ribosomal RNA small subunit methyltransferase C Pasteurella multocida (strain Pm70)
P9WHV3 9.66e-07 53 26 5 182 1 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHV2 1.01e-06 53 26 5 182 3 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0DJB1 1.06e-06 52 26 6 165 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDG2 1.06e-06 52 26 6 165 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain R)
Q9K623 1.16e-06 52 33 1 80 3 bioC Malonyl-[acyl-carrier protein] O-methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6LD46 1.44e-06 52 33 5 131 3 BDI_1875 tRNA1(Val) (adenine(37)-N6)-methyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B7VJ58 3.28e-06 50 24 1 137 3 VS_0507 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio atlanticus (strain LGP32)
B8F678 4.25e-06 50 32 0 77 3 HAPS_1234 tRNA1(Val) (adenine(37)-N6)-methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q58338 4.51e-06 50 25 5 135 3 MJ0928 Putative protein N5-glutamine methyltransferase MJ0928 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7MUT5 5.49e-06 50 25 9 204 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio campbellii (strain ATCC BAA-1116)
B5F9T8 8.39e-06 49 28 0 87 3 VFMJ11_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain MJ11)
A5UFI6 9.15e-06 50 28 7 146 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain PittGG)
C4LCN4 1.84e-05 48 27 3 113 3 Tola_0970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P53944 1.98e-05 49 24 5 160 1 MTQ1 Mitochondrial MRF1 N(5)-glutamine methyltransferase MTQ1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P44453 2.47e-05 48 27 7 146 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q58292 2.65e-05 47 36 2 79 1 MJ0882 Probable S-adenosylmethionine-dependent methyltransferase MJ0882 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A5UBC5 2.99e-05 48 27 6 144 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain PittEE)
B3GZF1 3.06e-05 48 31 2 88 3 rsmC Ribosomal RNA small subunit methyltransferase C Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
C4K8X0 3.27e-05 48 32 2 75 3 rsmC Ribosomal RNA small subunit methyltransferase C Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B0BU33 3.32e-05 48 31 2 88 3 rsmC Ribosomal RNA small subunit methyltransferase C Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q65S65 3.68e-05 48 32 6 129 3 rsmC Ribosomal RNA small subunit methyltransferase C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5E7Q6 3.83e-05 47 30 0 82 3 VF_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A3N3U3 4.05e-05 48 31 2 88 3 rsmC Ribosomal RNA small subunit methyltransferase C Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VMV4 4.13e-05 48 30 7 142 3 rsmC Ribosomal RNA small subunit methyltransferase C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0LXM6 4.81e-05 47 30 6 131 3 GFO_0132 tRNA1(Val) (adenine(37)-N6)-methyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
C6VS84 6.23e-05 47 27 0 86 3 Dfer_5119 tRNA1(Val) (adenine(37)-N6)-methyltransferase Dyadobacter fermentans (strain ATCC 700827 / DSM 18053 / CIP 107007 / KCTC 52180 / NS114)
C6X2D2 7.44e-05 47 26 0 83 3 FIC_02159 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacteriaceae bacterium (strain 3519-10)
A6GWI6 9.22e-05 46 33 1 84 3 FP0346 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A9MGW2 9.82e-05 46 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q87LY1 0.000115 47 26 5 134 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4QPN2 0.000122 46 27 7 145 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain 86-028NP)
Q60354 0.000144 46 24 6 158 3 MJ0046 Putative methyltransferase MJ0046 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q088B4 0.000146 46 25 7 166 3 rsmC Ribosomal RNA small subunit methyltransferase C Shewanella frigidimarina (strain NCIMB 400)
A3QHZ8 0.000165 46 29 4 113 3 rsmC Ribosomal RNA small subunit methyltransferase C Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S8P4 0.000212 46 27 4 122 3 rlmG Ribosomal RNA large subunit methyltransferase G Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12JX1 0.000215 46 28 4 113 3 rsmC Ribosomal RNA small subunit methyltransferase C Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q57G51 0.000228 45 28 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella choleraesuis (strain SC-B67)
Q8Z4J9 0.000231 45 28 4 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella typhi
A0KPC4 0.000239 45 28 5 147 3 AHA_3669 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8A9H7 0.000243 45 26 4 124 3 BT_0838 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P37872 0.000254 45 33 2 75 3 ybxB Uncharacterized protein YbxB Bacillus subtilis (strain 168)
Q7MNQ4 0.000304 45 24 0 83 3 VV0662 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain YJ016)
A5FKD7 0.000319 45 35 2 85 3 Fjoh_1299 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B6EMW5 0.000392 44 27 0 87 3 VSAL_I0559 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio salmonicida (strain LFI1238)
Q8DEQ3 0.000455 44 24 0 83 3 VV1_0533 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain CMCP6)
B4F055 0.000472 44 30 2 85 3 PMI1896 tRNA1(Val) (adenine(37)-N6)-methyltransferase Proteus mirabilis (strain HI4320)
C6DY35 0.00051 44 35 5 97 3 prmA Ribosomal protein L11 methyltransferase Geobacter sp. (strain M21)
B5RD57 0.000582 44 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTV6 0.000582 44 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella enteritidis PT4 (strain P125109)
B4T4F9 0.000628 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella newport (strain SL254)
A7MGA7 0.000639 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Cronobacter sakazakii (strain ATCC BAA-894)
Q8ZMX8 0.000699 43 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BAS2 0.000699 43 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi A (strain AKU_12601)
C0PVY6 0.000699 43 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi C (strain RKS4594)
A9N0W9 0.000699 43 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNB8 0.000699 43 28 5 142 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TGY8 0.000771 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella heidelberg (strain SL476)
Q1R2D5 0.00078 44 25 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain UTI89 / UPEC)
A1AJP2 0.00078 44 25 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O1:K1 / APEC
Q0T8U3 0.000801 44 25 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MTB6 0.000823 44 25 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O81 (strain ED1a)
A1SZ19 0.000833 44 29 3 92 3 rsmC Ribosomal RNA small subunit methyltransferase C Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B5BL07 0.000836 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain AKU_12601)
Q5PK16 0.000836 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZJW6 0.000844 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R2I6 0.000844 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella enteritidis PT4 (strain P125109)
B5FTB3 0.000844 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella dublin (strain CT_02021853)
B4TU29 0.000851 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella schwarzengrund (strain CVM19633)
B5F512 0.000851 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella agona (strain SL483)
Q8Z0V2 0.000882 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhi
A9N7C4 0.000898 44 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A3N3J4 0.001 43 32 1 76 3 APL_1900 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B5R9T9 0.001 43 26 2 82 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella gallinarum (strain 287/91 / NCTC 13346)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02560
Feature type CDS
Gene prmB
Product 50S ribosomal protein L3 N(5)-glutamine methyltransferase
Location 540766 - 541695 (strand: 1)
Length 930 (nucleotides) / 309 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1928
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF05175 Methyltransferase small domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2890 Translation, ribosomal structure and biogenesis (J) J Methylase of polypeptide chain release factors

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07320 ribosomal protein L3 glutamine methyltransferase [EC:2.1.1.298] - -

Protein Sequence

MDKIYVDEAVAELHTLQDMLRWAMSRFNAANIWYGHGTDNAWDEALQLALPTLFLPLDLPAELYQSRLTSSERQRIVERVLRRITERVPVPYLTNRSWFCGHEFYVDERVLIPRSPIGELINNHFSGLLDAEPDTILDLCTGSGCIAIACAYEFPDAEVDAADISADVLDVTEMNIENHGLSHRVVPIRSDLFNNLPAVKYDLIVTNPPYVDAEDMSDLPDEFRVEPELALAAGSDGLKLVRRILANAPDFMSEDAVLICEVGNSQVHLIDEFPQVPFIWLSFDNGGDGVFMLTRDQLTEHHDAFKLFK

Flanking regions ( +/- flanking 50bp)

AAACTATGTCATCAGATATCTTATTTTGGTTTACCCCGCCGGAGGCACTTTTGGATAAAATTTACGTTGATGAAGCCGTTGCCGAGCTTCACACGCTACAGGACATGCTGCGCTGGGCGATGAGCCGCTTTAATGCTGCTAATATCTGGTATGGACACGGAACGGATAATGCCTGGGATGAAGCTCTCCAACTGGCGCTGCCGACACTATTTCTGCCCCTTGACCTGCCTGCGGAACTTTATCAGTCCCGGCTGACATCATCTGAGCGCCAACGCATTGTTGAACGGGTGCTGCGCCGTATTACGGAGCGTGTTCCGGTACCGTATCTGACCAACCGTTCGTGGTTTTGCGGGCATGAATTTTATGTGGATGAGCGGGTGCTTATTCCCCGTTCACCGATTGGTGAGCTGATTAACAATCATTTTTCCGGTCTGCTTGATGCCGAGCCGGACACAATTTTGGATCTCTGTACCGGCAGCGGTTGTATCGCTATTGCCTGTGCGTATGAATTCCCGGATGCAGAAGTGGATGCCGCAGACATTTCAGCCGATGTGCTGGATGTCACAGAAATGAACATTGAAAATCACGGGTTATCCCATCGCGTGGTGCCGATACGATCAGATCTGTTTAATAATCTGCCGGCAGTGAAATATGACCTTATTGTGACTAATCCGCCGTATGTGGATGCGGAAGATATGAGCGACCTGCCGGATGAATTCCGGGTAGAACCAGAGTTGGCGCTGGCTGCGGGCAGTGACGGGCTGAAACTGGTACGCCGGATACTTGCGAATGCCCCGGATTTTATGTCTGAAGACGCGGTGCTGATTTGTGAAGTAGGTAACAGTCAGGTACATCTGATTGATGAGTTTCCGCAGGTGCCGTTCATCTGGCTCTCTTTCGATAACGGCGGCGATGGCGTATTTATGTTAACTCGTGATCAATTAACAGAACATCATGATGCATTTAAGCTTTTCAAATAGACAATCCTCATGTAGGAATAGACACATAAAAATAGGTTAAAACCATTCAC