Homologs in group_1932

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14365 FBDBKF_14365 88.6 Morganella morganii S1 fadI acetyl-CoA C-acyltransferase FadI
EHELCC_07915 EHELCC_07915 88.6 Morganella morganii S2 fadI acetyl-CoA C-acyltransferase FadI
NLDBIP_08240 NLDBIP_08240 88.6 Morganella morganii S4 fadI acetyl-CoA C-acyltransferase FadI
LHKJJB_06025 LHKJJB_06025 88.6 Morganella morganii S3 fadI acetyl-CoA C-acyltransferase FadI
HKOGLL_04890 HKOGLL_04890 88.6 Morganella morganii S5 fadI acetyl-CoA C-acyltransferase FadI
PMI_RS08865 PMI_RS08865 72.1 Proteus mirabilis HI4320 fadI acetyl-CoA C-acyltransferase FadI

Distribution of the homologs in the orthogroup group_1932

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1932

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N287 0.0 598 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GH87 0.0 598 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
B5XVW1 0.0 590 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae (strain 342)
A6TC20 0.0 588 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MH80 0.0 587 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
A4Y898 0.0 587 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1JK23 0.0 585 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9KTW7 0.0 585 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS195)
A6WQ26 0.0 585 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
A3D685 0.0 585 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE97 0.0 585 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS223)
Q6D2L6 0.0 584 70 0 424 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAL8 0.0 583 70 0 424 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1RI91 0.0 582 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A9R7W9 0.0 580 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Angola)
B6I6Q5 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SE11)
P76503 0.0 580 67 0 426 1 fadI 3-ketoacyl-CoA thiolase FadI Escherichia coli (strain K12)
B1X9L5 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / DH10B)
C4ZVN3 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6M3 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O8 (strain IAI1)
A7ZPF9 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A4SMT9 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
B1IXA4 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LBJ6 0.0 580 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain 55989 / EAEC)
B1JGG1 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668V0 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM83 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CHK1 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD46 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis
B2K8J6 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C659 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK0 0.0 579 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B7NP25 0.0 579 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7N5V3 0.0 579 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TWV5 0.0 578 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YXY5 0.0 578 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCN9 0.0 578 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
B1LME8 0.0 578 67 0 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SMS-3-5 / SECEC)
Q0T2E5 0.0 577 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q1R971 0.0 577 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q0TFA5 0.0 577 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI9 0.0 577 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
B7MGV8 0.0 577 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FFG3 0.0 577 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MY17 0.0 576 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O81 (strain ED1a)
B7UFZ9 0.0 576 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83K95 0.0 575 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri
A8A2L1 0.0 575 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q3YZM1 0.0 574 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
B7LLC9 0.0 574 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8ADP1 0.0 573 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6LTK4 0.0 572 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
A0KK76 0.0 572 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3IEE3 0.0 572 64 0 414 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
Q31YB6 0.0 571 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
A4WCW7 0.0 568 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
Q32DJ3 0.0 566 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
Q9KT59 0.0 565 65 0 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2P1 0.0 564 65 0 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5R3S0 0.0 560 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella enteritidis PT4 (strain P125109)
B5FPN2 0.0 560 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella dublin (strain CT_02021853)
Q57LW5 0.0 560 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
B5EZS0 0.0 560 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella agona (strain SL483)
A9MJ36 0.0 560 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TQC3 0.0 559 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella schwarzengrund (strain CVM19633)
B5BBA0 0.0 558 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain AKU_12601)
A9N452 0.0 558 66 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PCX7 0.0 558 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0HWN4 0.0 557 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q0HKD2 0.0 557 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KV75 0.0 557 64 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q8Z4Y9 0.0 557 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhi
C0PZX5 0.0 557 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi C (strain RKS4594)
B4SZR1 0.0 557 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella newport (strain SL254)
B2VJ10 0.0 555 67 0 398 3 fadI 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5FGB5 0.0 555 63 0 426 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
B4TCA9 0.0 554 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella heidelberg (strain SL476)
Q8ECP6 0.0 554 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8ZNA6 0.0 553 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7MIS4 0.0 553 64 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
Q5E3U0 0.0 552 63 0 426 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8DB48 0.0 551 64 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q87MM2 0.0 549 63 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1S7L7 0.0 549 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QFP4 0.0 548 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KKT1 0.0 546 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella woodyi (strain ATCC 51908 / MS32)
Q07ZP7 0.0 546 62 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
Q12P12 0.0 546 62 0 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0TL22 0.0 545 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella halifaxensis (strain HAW-EB4)
B8CPY7 0.0 545 62 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H5T2 0.0 545 63 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FTR6 0.0 542 62 0 427 3 fadI 3-ketoacyl-CoA thiolase Shewanella sediminis (strain HAW-EB3)
B4RTU9 0.0 537 62 0 426 3 fadI 3-ketoacyl-CoA thiolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q47ZB6 0.0 536 62 0 425 3 fadI 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QXN5 0.0 532 63 0 426 3 fadI 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q15VA3 0.0 520 62 0 424 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
O46629 1.85e-116 351 43 2 421 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Bos taurus
Q60587 1.07e-114 347 43 2 422 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Rattus norvegicus
Q99JY0 4.83e-114 345 43 2 422 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Mus musculus
Q8HXX4 6.22e-113 342 43 3 421 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Macaca fascicularis
P55084 2.74e-112 341 42 2 421 1 HADHB Trifunctional enzyme subunit beta, mitochondrial Homo sapiens
Q5R1W7 2.83e-112 341 42 2 421 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Pan troglodytes
P34255 1.28e-100 310 39 1 421 3 B0303.3 Probable 3-ketoacyl-CoA thiolase Caenorhabditis elegans
Q0AVM3 1.74e-63 212 33 7 423 1 Swol_1934 Acetyl-CoA acetyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q9ZHI1 7.69e-63 211 35 8 426 3 phaA Acetyl-CoA acetyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P44873 1.13e-62 210 33 10 424 3 atoB Acetyl-CoA acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O32177 8.1e-61 205 34 11 436 2 fadA 3-ketoacyl-CoA thiolase Bacillus subtilis (strain 168)
Q2SD23 5.18e-60 203 34 11 427 3 fadA 3-ketoacyl-CoA thiolase Hahella chejuensis (strain KCTC 2396)
P45369 5.54e-60 203 33 7 429 3 phaA Acetyl-CoA acetyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P28790 4.5e-59 201 33 10 426 1 fadA 3-ketoacyl-CoA thiolase Pseudomonas fragi
P45359 5.71e-59 200 32 8 427 1 thlA Acetyl-CoA acetyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q0KBP1 6.75e-59 200 34 8 426 1 bktB Beta-ketothiolase BktB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P45363 2.16e-58 199 33 9 433 3 phaA Acetyl-CoA acetyltransferase Thiocystis violacea
A1TZR8 2.56e-58 199 33 8 414 3 fadA 3-ketoacyl-CoA thiolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P07871 2.86e-58 199 33 9 434 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Rattus norvegicus
P21775 5.78e-58 199 33 9 434 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Rattus norvegicus
Q6NU46 5.97e-58 199 29 7 425 2 acat1-a Acetyl-CoA acetyltransferase A, mitochondrial Xenopus laevis
Q6AZA0 9.5e-58 198 30 8 418 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Danio rerio
Q8VCH0 1.21e-57 198 33 9 434 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Mus musculus
P07097 2.58e-57 196 33 9 423 1 phaA Acetyl-CoA acetyltransferase Shinella zoogloeoides
Q46939 2.64e-57 196 34 9 428 3 yqeF Probable acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q87ZB3 3.48e-57 196 33 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48GW4 5.55e-57 195 32 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5BKN8 1.16e-56 195 29 7 425 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Xenopus tropicalis
Q29RZ0 1.21e-56 195 30 9 427 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Bos taurus
A7MQM5 1.98e-56 194 33 11 439 3 fadA 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
Q921H8 2e-56 194 33 9 434 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Mus musculus
Q6GN02 2.47e-56 194 29 7 425 2 acat1-b Acetyl-CoA acetyltransferase B, mitochondrial Xenopus laevis
Q18AR0 2.85e-56 193 31 7 404 1 thlA Acetyl-CoA acetyltransferase Clostridioides difficile (strain 630)
Q8CQN7 3.84e-56 193 31 12 433 3 SE_2384 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS07 3.84e-56 193 31 12 433 3 SERP0032 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4ZRA1 4.13e-56 193 32 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. syringae (strain B728a)
Q86AD9 4.61e-56 193 30 7 428 2 DDB_G0271544 Probable acetyl-CoA acetyltransferase Dictyostelium discoideum
Q9I2A8 5.53e-56 192 35 9 424 1 atoB Acetyl-CoA acetyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P09110 6.44e-56 193 32 9 434 1 ACAA1 3-ketoacyl-CoA thiolase, peroxisomal Homo sapiens
Q4KFC3 1.05e-55 192 31 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K9D9 1.17e-55 192 32 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain Pf0-1)
Q6L8K7 1.45e-55 192 31 8 418 3 PAT1 Acetyl-CoA acetyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
P14611 3.03e-55 191 35 8 425 1 phaA Acetyl-CoA acetyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8QZT1 3.12e-55 191 30 8 426 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Mus musculus
Q02PH7 5.14e-55 190 31 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V383 5.14e-55 190 31 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain PA7)
A8G8D0 6.81e-55 189 33 11 430 3 fadA 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
P17764 1e-54 190 31 8 424 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus
P54810 1.3e-54 189 33 9 427 3 phaA Acetyl-CoA acetyltransferase Paracoccus denitrificans
A0R1Y7 1.71e-54 189 33 9 423 1 MSMEG_4920 Probable acetyl-CoA acetyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0VNZ7 1.77e-54 189 33 10 426 3 fadA 3-ketoacyl-CoA thiolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q9HZJ3 1.78e-54 189 31 10 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1I7D5 2.09e-54 188 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas entomophila (strain L48)
P76461 2.13e-54 188 36 10 428 1 atoB Acetyl-CoA acetyltransferase Escherichia coli (strain K12)
Q7MZ91 2.27e-54 188 33 11 437 3 fadA 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P50174 3.8e-54 188 32 7 427 3 phaA Acetyl-CoA acetyltransferase Rhizobium meliloti (strain 1021)
A8ACZ3 4.16e-54 187 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TGM3 4.59e-54 187 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A5W6G9 4.8e-54 187 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88L01 5.45e-54 187 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P13437 6.37e-54 187 30 7 424 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Rattus norvegicus
Q93Q11 8.05e-54 187 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas oleovorans
B7LTZ0 9.1e-54 187 33 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P24752 1.06e-53 187 29 9 427 1 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Homo sapiens
Q9R9W0 1.13e-53 186 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida
P0A2H7 1.42e-53 186 32 10 436 1 fadA 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2H8 1.42e-53 186 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Salmonella typhi
Q5PKQ3 1.42e-53 186 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FBI3 1.57e-53 186 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q31UE3 1.88e-53 186 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
Q489W4 2.13e-53 186 31 10 428 3 fadA 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q6DAP6 2.35e-53 186 32 11 443 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JIG3 2.58e-53 186 33 11 435 3 fadA 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q9F0Y6 2.96e-53 185 31 10 436 3 fadA 3-ketoacyl-CoA thiolase Enterobacter cloacae
Q5HIU0 3.29e-53 185 30 10 425 3 SACOL0426 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain COL)
A7ZU50 4.24e-53 185 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A4WFX5 4.91e-53 185 31 10 436 3 fadA 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
Q3YVC2 6.19e-53 184 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
A1AI32 6.59e-53 184 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
Q8BWT1 7.24e-53 184 30 7 424 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Mus musculus
A6VVM8 7.98e-53 184 32 11 436 3 fadA 3-ketoacyl-CoA thiolase Marinomonas sp. (strain MWYL1)
Q8X8J4 9.52e-53 184 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
Q0TAL1 1.06e-52 184 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2G124 1.17e-52 184 30 10 425 3 SAOUHSC_00336 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ9 1.17e-52 184 30 10 425 3 SAUSA300_0355 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain USA300)
Q08A40 1.35e-52 184 33 12 432 3 fadA 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
Q57HM7 1.39e-52 184 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
A4XSM9 1.48e-52 184 31 10 424 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas mendocina (strain ymp)
A3CYJ3 1.5e-52 183 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A4Y1B5 1.95e-52 183 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WH99 1.95e-52 183 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
Q1R467 1.97e-52 183 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q8NY95 2.55e-52 183 30 10 425 3 MW0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MW2)
Q6GCB8 2.55e-52 183 30 10 425 3 SAS0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MSSA476)
A8A6V0 2.73e-52 183 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q66FR9 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR28 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CNA0 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAM9 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis
Q1C2C3 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDF1 2.78e-52 182 33 9 430 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q5E8X7 3.33e-52 182 33 13 434 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q83PG2 3.55e-52 182 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri
Q0SZ35 3.55e-52 182 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
C6DI66 3.82e-52 182 32 11 443 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B0VE46 5.12e-52 182 32 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AYE)
B0VLX5 5.12e-52 182 32 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain SDF)
B2I2J8 5.12e-52 182 32 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ACICU)
B7I3P0 5.12e-52 182 32 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB0057)
B7H1I1 5.12e-52 182 32 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB307-0294)
Q7A7L2 6.64e-52 182 30 10 425 1 SA0342 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain N315)
Q99WM3 6.64e-52 182 30 10 425 3 SAV0354 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q1Q8K0 7.87e-52 182 31 8 434 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B5FEW7 7.88e-52 181 33 13 434 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
Q6GJW4 8.73e-52 181 30 10 427 3 SAR0351 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MRSA252)
Q8HXY6 1.02e-51 182 29 9 427 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Macaca fascicularis
B6EGU1 1.07e-51 181 31 10 430 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio salmonicida (strain LFI1238)
Q32A20 1.28e-51 181 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
Q12TB5 1.42e-51 181 33 11 425 3 fadA 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5QXH8 1.45e-51 181 32 13 432 3 fadA 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4FQC7 1.59e-51 181 31 8 434 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A3M1H9 1.61e-51 181 31 8 426 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A0KR49 1.77e-51 181 33 12 431 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
A4VKA4 2.78e-51 180 31 10 424 3 fadA 3-ketoacyl-CoA thiolase Stutzerimonas stutzeri (strain A1501)
A1RDW3 2.84e-51 180 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
P21151 2.93e-51 180 32 10 436 1 fadA 3-ketoacyl-CoA thiolase FadA Escherichia coli (strain K12)
Q21KB1 2.93e-51 180 32 12 433 3 fadA 3-ketoacyl-CoA thiolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q570C8 4.65e-51 181 33 13 440 1 KAT5 3-ketoacyl-CoA thiolase 5, peroxisomal Arabidopsis thaliana
Q8EKS0 5.56e-51 179 33 10 425 3 fadA 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
I1RY81 8.13e-51 179 31 8 437 2 ERG10 Acetyl-CoA acetyltransferase ERG10, cytosolic Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
C8YNG6 9.16e-51 181 32 12 438 1 KAT1 3-ketoacyl CoA thiolase 1, peroxisomal Petunia hybrida
Q0HPB8 9.9e-51 179 33 12 431 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A1S1I7 1.22e-50 178 32 10 428 3 fadA 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2YVF5 1.35e-50 178 29 10 425 3 SAB0304 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P42765 1.45e-50 178 30 8 424 1 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Homo sapiens
Q0I0T4 2.36e-50 177 33 12 431 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
A0KEL0 2.86e-50 177 32 12 431 3 fadA 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3T0R7 3.39e-50 177 30 8 424 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Bos taurus
Q6FF69 5.07e-50 177 31 8 425 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B2VFE0 5.19e-50 177 32 10 436 3 fadA 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q5RES5 6.29e-50 177 30 8 417 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Pongo abelii
Q6LW07 1.68e-49 175 30 11 428 3 fadA 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
A4STF3 1.86e-49 175 31 12 429 3 fadA 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
Q8LF48 1.91e-49 177 31 13 439 1 KAT1 3-ketoacyl-CoA thiolase 1, peroxisomal Arabidopsis thaliana
P41338 3.85e-49 175 30 10 437 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A3Q8U3 1.9e-48 172 31 11 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5WH98 2e-48 172 30 8 426 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter sp. (strain PRwf-1)
Q56WD9 1.01e-47 172 30 12 437 1 PED1 3-ketoacyl-CoA thiolase 2, peroxisomal Arabidopsis thaliana
Q9FIK7 2.26e-47 171 29 7 429 1 ACCT1 Acetyl-CoA acetyltransferase 1 Arabidopsis thaliana
A0A1D8PH52 5.02e-47 169 31 11 435 2 ERG10 Acetyl-CoA acetyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9UQW6 1.39e-46 168 29 8 426 2 erg10 Acetyl-CoA acetyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9BWD1 1.46e-46 168 29 8 432 1 ACAT2 Acetyl-CoA acetyltransferase, cytosolic Homo sapiens
P10551 2.1e-46 167 31 9 393 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces pastorianus (strain ATCC 76670 / Carlsberg bottom yeast no.2 / CBS 1503 / CLIB 180 / NBRC 10610 / NRRL Y-1525)
Q12598 2.32e-46 167 29 10 428 1 PACTA Acetyl-CoA acetyltransferase IA Candida tropicalis
P45855 2.36e-46 167 30 9 422 1 mmgA Acetyl-CoA acetyltransferase Bacillus subtilis (strain 168)
Q3IJ24 3.15e-46 167 30 10 425 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
Q8CAY6 3.25e-46 167 31 9 430 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Mus musculus
Q04677 3.59e-46 167 29 10 428 1 PACTB Acetyl-CoA acetyltransferase IB Candida tropicalis
P0C7L2 4.95e-46 166 32 9 423 1 paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase Escherichia coli (strain K12)
Q15ZF4 6.16e-46 166 29 11 429 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P46707 7.2e-46 166 31 8 425 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium leprae (strain TN)
Q1QUW9 8.49e-46 166 31 10 428 3 fadA 3-ketoacyl-CoA thiolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P0C7L3 1.43e-45 165 31 9 423 3 paaJ Beta-ketoadipyl-CoA thiolase Escherichia coli
P9WG69 3.36e-45 164 31 7 421 1 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG68 3.55e-45 164 31 7 421 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66927 3.55e-45 164 31 7 421 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5XI22 4.19e-45 164 31 9 432 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Rattus norvegicus
Q8S4Y1 1.28e-44 163 31 9 409 1 ACCT2 Acetyl-CoA acetyltransferase 2 Arabidopsis thaliana
Q8DDK5 3.08e-44 161 31 12 433 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q7MQI0 3.24e-44 161 31 12 433 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
Q9KNI0 4.11e-43 158 31 13 431 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4WLA8 4.24e-43 159 29 9 429 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XMC1 4.24e-43 159 29 9 429 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P27796 4.77e-43 159 30 13 441 1 POT1 3-ketoacyl-CoA thiolase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5F464 5.67e-43 158 31 13 433 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
I1RMA2 6.29e-43 159 29 10 421 3 FG05087 Acetyl-CoA acetyltransferase FG05087, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q87TP0 7.52e-43 158 30 11 433 3 fadA 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4WCL5 5.71e-42 155 28 6 426 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0YA65 5.71e-42 155 28 6 426 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
P33291 6.44e-42 155 29 11 437 3 None 3-ketoacyl-CoA thiolase B, peroxisomal Candida tropicalis
Q43974 2.76e-41 154 31 12 433 1 pcaF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8SVA6 9.53e-41 152 30 13 425 1 FOX3 3-ketoacyl-CoA thiolase, peroxisomal Encephalitozoon cuniculi (strain GB-M1)
Q43935 1.15e-40 152 31 12 433 3 catF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q22100 1.31e-40 152 28 9 420 1 kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Caenorhabditis elegans
O53871 1.51e-40 152 29 11 446 1 fadA Putative acyltransferase Rv0859 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5HRH3 1.67e-38 146 29 11 358 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P33290 4.02e-38 145 30 10 401 3 None 3-ketoacyl-CoA thiolase A, peroxisomal Candida tropicalis
Q8CTR0 8.77e-38 144 29 11 358 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
I6XHJ3 1.28e-37 144 30 11 429 1 fadA6 Steroid 3-ketoacyl-CoA thiolase FadA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7A1P9 6.46e-37 141 27 12 422 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MW2)
Q7A768 6.46e-37 141 27 12 422 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain N315)
Q7A2W9 6.46e-37 141 27 12 422 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KWK4 6.46e-37 141 27 12 422 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q05493 8.16e-37 142 28 8 432 3 POT1 3-ketoacyl-CoA thiolase, peroxisomal Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6GJ93 1.43e-36 140 28 13 424 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MRSA252)
Q5HIA0 7.41e-36 139 27 13 424 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain COL)
Q51956 1.8e-35 138 29 10 424 3 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas putida
Q6GBR1 2.09e-35 137 27 13 424 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MSSA476)
I6XHI4 6.2e-35 136 30 13 433 1 fadA5 Steroid 3-ketoacyl-CoA thiolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9I6R0 9.44e-35 136 30 9 424 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8VPF1 1.55e-34 135 29 13 428 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas knackmussii (strain DSM 6978 / CCUG 54928 / LMG 23759 / B13)
P73825 1.14e-33 133 28 8 424 3 phaA Acetyl-CoA acetyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q4L3Q1 1.14e-31 127 27 9 420 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus haemolyticus (strain JCSC1435)
O07618 9.93e-27 113 28 12 403 2 yhfS Putative acetyl-CoA C-acetyltransferase YhfS Bacillus subtilis (strain 168)
P45362 6.72e-06 48 29 0 74 3 thi Acetyl-CoA acetyltransferase (Fragment) Clostridioides difficile
O62742 3.84e-05 49 21 15 434 1 SCP2 Sterol carrier protein 2 Oryctolagus cuniculus
P32020 0.000131 47 22 8 244 1 Scp2 Sterol carrier protein 2 Mus musculus
P07857 0.000213 47 21 13 426 1 SCP2 Sterol carrier protein 2 Bos taurus

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02540
Feature type CDS
Gene fadI
Product acetyl-CoA C-acyltransferase FadI
Location 535785 - 537077 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1932
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00108 Thiolase, N-terminal domain
PF02803 Thiolase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0183 Lipid transport and metabolism (I) I Acetyl-CoA acetyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00626 acetyl-CoA C-acetyltransferase [EC:2.3.1.9] Fatty acid degradation
Valine, leucine and isoleucine degradation
Lysine degradation
Benzoate degradation
Tryptophan metabolism
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Butanoate metabolism
Carbon fixation pathways in prokaryotes
Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Fatty acid metabolism
Two-component system
Fat digestion and absorption		 Ketone body biosynthesis, acetyl-CoA => acetoacetate/3-hydroxybutyrate/acetone
C5 isoprenoid biosynthesis, mevalonate pathway
Ethylmalonyl pathway
Dicarboxylate-hydroxybutyrate cycle
Hydroxypropionate-hydroxybutylate cycle
C5 isoprenoid biosynthesis, mevalonate pathway, archaea
Lysine degradation, bacteria, L-lysine => glutarate => succinate/acetyl-CoA

Protein Sequence

MKLAQAERIAIIDGLRTPFVKQSTVYRDVPAIELGRAVVQELLFRQSFPPELVDLVVFGQVIQMPAAPNIAREIVPGAGLAVTTDAYSVTRACATSFQAIASAAQAIQCGQNHIAVAGGADSSSVLPIGVSRKLAGTLLDLSKARSLSQKLRLLASLRPRDLLPVAPAVAEYSTGLRMGDTAEQMAKRYHITREAQDAFAHRSHQFATQAWASGVLRDEVMTARFAPFTHVCEEDNTLRKNSLAGSYAQLKPAFDKRHGTVTAANSTPLTDGAAAVLMMSESRARELGLVPLGFLRSYAFTAESMREDMLLGPSYAAPAALARAGLSLSDLTLIDMHEAFSAQVLANLQCFASDTFAREKLNRSKAVGEVDPDKFNVLGGSIAYGHPFAATGARMVTQTLRELQRRGGGFAMTTACAAGGLGVAMIWETE

Flanking regions ( +/- flanking 50bp)

GTCAGACCACCGCATGTCGGGATAACCTTTCATAACGTAAGGATAAACGGATGAAACTTGCGCAGGCAGAACGAATTGCAATTATTGACGGATTACGAACGCCGTTTGTAAAACAATCAACGGTTTATCGTGATGTTCCGGCGATTGAACTGGGTCGCGCTGTTGTGCAGGAATTACTTTTCAGGCAATCATTTCCCCCGGAACTCGTTGATCTTGTCGTTTTCGGGCAGGTGATACAAATGCCCGCTGCACCCAATATTGCCAGGGAGATTGTCCCAGGAGCGGGACTTGCGGTAACAACAGATGCTTATTCGGTTACCCGTGCCTGCGCCACCAGTTTTCAGGCGATTGCCAGTGCGGCACAGGCTATTCAGTGTGGTCAGAATCATATTGCGGTGGCTGGCGGGGCGGATTCCTCGTCTGTTTTACCTATTGGTGTATCCCGTAAACTCGCCGGGACGTTACTGGATCTCAGCAAAGCCCGCTCACTTTCACAAAAGCTCAGGTTACTGGCATCGCTGCGCCCGCGCGATCTCCTGCCTGTTGCCCCGGCAGTGGCAGAGTACTCCACTGGCCTGCGCATGGGCGATACCGCAGAACAGATGGCGAAACGCTACCATATTACCCGCGAAGCCCAGGATGCCTTTGCTCACCGCTCACATCAGTTCGCCACACAGGCATGGGCTTCCGGTGTGCTGCGTGATGAGGTTATGACGGCACGGTTTGCGCCGTTCACACACGTCTGTGAAGAAGATAATACGCTGCGGAAAAATTCACTGGCAGGCAGCTATGCACAACTGAAACCGGCATTTGATAAACGCCACGGTACAGTTACAGCCGCGAACAGTACGCCTCTGACTGATGGTGCAGCTGCGGTACTGATGATGTCTGAGTCCCGCGCACGCGAACTGGGACTGGTTCCGCTGGGCTTTCTGCGCAGTTATGCGTTCACCGCTGAGAGTATGCGGGAAGATATGCTGCTGGGACCGTCTTACGCCGCACCTGCCGCATTGGCGCGGGCGGGACTGTCGTTATCTGATCTGACACTGATTGATATGCATGAAGCATTTTCCGCTCAGGTGCTGGCAAACCTGCAATGTTTTGCCAGCGATACTTTTGCCCGTGAAAAACTCAATCGCTCAAAAGCGGTCGGTGAAGTGGATCCGGATAAATTTAATGTACTCGGCGGCTCTATTGCATACGGGCATCCGTTTGCGGCAACCGGTGCGCGGATGGTCACTCAGACCCTGCGGGAACTGCAACGGCGCGGTGGTGGTTTTGCCATGACAACCGCGTGTGCCGCAGGTGGTCTTGGGGTAGCGATGATCTGGGAAACAGAATAGGACGGAGGAAATAATAATGACTGATTATAATAAAACACGTTCTGATGAAA