Homologs in group_1932

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14365 FBDBKF_14365 100.0 Morganella morganii S1 fadI acetyl-CoA C-acyltransferase FadI
NLDBIP_08240 NLDBIP_08240 100.0 Morganella morganii S4 fadI acetyl-CoA C-acyltransferase FadI
LHKJJB_06025 LHKJJB_06025 100.0 Morganella morganii S3 fadI acetyl-CoA C-acyltransferase FadI
HKOGLL_04890 HKOGLL_04890 100.0 Morganella morganii S5 fadI acetyl-CoA C-acyltransferase FadI
F4V73_RS02540 F4V73_RS02540 88.6 Morganella psychrotolerans fadI acetyl-CoA C-acyltransferase FadI
PMI_RS08865 PMI_RS08865 71.9 Proteus mirabilis HI4320 fadI acetyl-CoA C-acyltransferase FadI

Distribution of the homologs in the orthogroup group_1932

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1932

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5XVW1 0.0 595 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae (strain 342)
P76503 0.0 592 69 0 426 1 fadI 3-ketoacyl-CoA thiolase FadI Escherichia coli (strain K12)
B1X9L5 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / DH10B)
C4ZVN3 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain K12 / MC4100 / BW2952)
B6I6Q5 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SE11)
B1IXA4 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7M6M3 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O8 (strain IAI1)
A7ZPF9 0.0 592 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TC20 0.0 591 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7N5V3 0.0 591 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NP25 0.0 591 69 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B2TWV5 0.0 590 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YXY5 0.0 590 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCN9 0.0 590 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
B1LME8 0.0 589 69 0 424 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain SMS-3-5 / SECEC)
B7LBJ6 0.0 589 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain 55989 / EAEC)
Q0T2E5 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q7N287 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1R971 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q8FFG3 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFA5 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADI9 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
B7MGV8 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O45:K1 (strain S88 / ExPEC)
A8GH87 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
B7MY17 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O81 (strain ED1a)
A7MH80 0.0 588 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
A8A2L1 0.0 587 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
B7UFZ9 0.0 587 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83K95 0.0 587 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella flexneri
Q3YZM1 0.0 585 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
Q6D2L6 0.0 585 70 0 424 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAL8 0.0 584 70 0 424 3 fadI 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JK23 0.0 584 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7LLC9 0.0 583 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8ADP1 0.0 583 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q31YB6 0.0 583 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
A4Y898 0.0 582 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WQ26 0.0 582 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
A9KTW7 0.0 581 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS195)
A3D685 0.0 581 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EE97 0.0 581 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS223)
Q32DJ3 0.0 578 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
A4SMT9 0.0 578 68 0 426 3 fadI 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
A1RI91 0.0 578 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
A9R7W9 0.0 577 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Angola)
B1JGG1 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668V0 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TM83 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CHK1 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD46 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis
B2K8J6 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C659 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK0 0.0 576 70 0 426 3 fadI 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A0KK76 0.0 572 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4WCW7 0.0 572 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
B5R3S0 0.0 571 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella enteritidis PT4 (strain P125109)
B5FPN2 0.0 571 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella dublin (strain CT_02021853)
B5EZS0 0.0 571 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella agona (strain SL483)
Q57LW5 0.0 571 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
B4TQC3 0.0 570 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella schwarzengrund (strain CVM19633)
B5BBA0 0.0 570 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain AKU_12601)
Q5PCX7 0.0 570 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3IEE3 0.0 570 63 0 414 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
A9N452 0.0 569 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZR1 0.0 568 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella newport (strain SL254)
A9MJ36 0.0 568 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z4Y9 0.0 568 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhi
Q6LTK4 0.0 566 65 0 426 3 fadI 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
A5F2P1 0.0 566 66 0 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C0PZX5 0.0 565 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella paratyphi C (strain RKS4594)
B4TCA9 0.0 565 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella heidelberg (strain SL476)
Q8ZNA6 0.0 564 67 0 426 3 fadI 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KT59 0.0 563 65 0 424 3 fadI 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B2VJ10 0.0 563 69 0 398 3 fadI 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q0HWN4 0.0 555 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q0HKD2 0.0 555 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A0KV75 0.0 555 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
Q8ECP6 0.0 553 63 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1S7L7 0.0 549 62 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QFP4 0.0 546 62 0 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q07ZP7 0.0 546 62 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
B0TL22 0.0 544 62 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella halifaxensis (strain HAW-EB4)
B8CPY7 0.0 544 61 0 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H5T2 0.0 543 62 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q12P12 0.0 542 61 0 430 3 fadI 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B5FGB5 0.0 542 62 0 426 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
Q5E3U0 0.0 541 62 0 426 3 fadI 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MIS4 0.0 540 63 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
B1KKT1 0.0 540 62 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella woodyi (strain ATCC 51908 / MS32)
Q87MM2 0.0 539 62 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DB48 0.0 539 63 0 430 3 fadI 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
A8FTR6 0.0 538 61 0 428 3 fadI 3-ketoacyl-CoA thiolase Shewanella sediminis (strain HAW-EB3)
B4RTU9 0.0 536 62 0 426 3 fadI 3-ketoacyl-CoA thiolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q5QXN5 0.0 535 63 0 426 3 fadI 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q47ZB6 0.0 525 61 0 425 3 fadI 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15VA3 0.0 517 62 0 424 3 fadI 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
O46629 2.35e-112 341 43 3 421 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Bos taurus
Q60587 5.26e-110 335 42 3 426 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Rattus norvegicus
Q99JY0 1.77e-109 333 42 3 426 1 Hadhb Trifunctional enzyme subunit beta, mitochondrial Mus musculus
Q8HXX4 1.21e-108 331 42 3 420 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Macaca fascicularis
P55084 1.03e-107 329 42 3 421 1 HADHB Trifunctional enzyme subunit beta, mitochondrial Homo sapiens
Q5R1W7 1.21e-107 329 42 3 421 2 HADHB Trifunctional enzyme subunit beta, mitochondrial Pan troglodytes
P34255 6.74e-100 308 39 1 421 3 B0303.3 Probable 3-ketoacyl-CoA thiolase Caenorhabditis elegans
Q0AVM3 2.99e-66 219 33 8 424 1 Swol_1934 Acetyl-CoA acetyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q46939 5.36e-64 214 35 9 426 3 yqeF Probable acetyl-CoA acetyltransferase Escherichia coli (strain K12)
P07871 1.98e-63 213 35 11 436 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Rattus norvegicus
Q2SD23 3.45e-63 211 35 13 427 3 fadA 3-ketoacyl-CoA thiolase Hahella chejuensis (strain KCTC 2396)
P21775 3.57e-63 213 35 11 436 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Rattus norvegicus
Q0KBP1 3.94e-63 211 35 8 424 1 bktB Beta-ketothiolase BktB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P44873 5.44e-63 211 33 11 428 3 atoB Acetyl-CoA acetyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I2A8 1.48e-62 210 36 10 424 1 atoB Acetyl-CoA acetyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8VCH0 1.51e-62 211 34 10 436 1 Acaa1b 3-ketoacyl-CoA thiolase B, peroxisomal Mus musculus
P07097 1.88e-62 209 34 9 426 1 phaA Acetyl-CoA acetyltransferase Shinella zoogloeoides
Q9ZHI1 4.3e-62 209 35 9 426 3 phaA Acetyl-CoA acetyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P28790 5.76e-62 208 34 10 427 1 fadA 3-ketoacyl-CoA thiolase Pseudomonas fragi
P45369 1.64e-61 207 32 8 429 3 phaA Acetyl-CoA acetyltransferase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
O32177 1.72e-61 207 34 14 445 2 fadA 3-ketoacyl-CoA thiolase Bacillus subtilis (strain 168)
Q921H8 1.79e-61 208 34 11 436 1 Acaa1a 3-ketoacyl-CoA thiolase A, peroxisomal Mus musculus
A7MQM5 7.3e-61 205 33 10 428 3 fadA 3-ketoacyl-CoA thiolase Cronobacter sakazakii (strain ATCC BAA-894)
Q6NU46 1.01e-60 206 31 9 429 2 acat1-a Acetyl-CoA acetyltransferase A, mitochondrial Xenopus laevis
Q48GW4 5.24e-60 203 34 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8CQN7 6.56e-60 203 32 11 425 3 SE_2384 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HS07 6.56e-60 203 32 11 425 3 SERP0032 Probable acetyl-CoA acyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5BKN8 1.08e-59 203 30 9 435 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Xenopus tropicalis
P09110 1.11e-59 203 34 13 437 1 ACAA1 3-ketoacyl-CoA thiolase, peroxisomal Homo sapiens
Q6GN02 1.14e-59 203 31 9 429 2 acat1-b Acetyl-CoA acetyltransferase B, mitochondrial Xenopus laevis
Q6AZA0 2.68e-59 202 30 9 421 2 acat1 Acetyl-CoA acetyltransferase, mitochondrial Danio rerio
A0R1Y7 2.85e-59 201 34 8 421 1 MSMEG_4920 Probable acetyl-CoA acetyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q87ZB3 3.92e-59 201 34 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q02PH7 4.41e-59 201 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V383 4.41e-59 201 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain PA7)
P45363 4.76e-59 201 32 10 433 3 phaA Acetyl-CoA acetyltransferase Thiocystis violacea
P50174 5.86e-59 200 33 7 422 3 phaA Acetyl-CoA acetyltransferase Rhizobium meliloti (strain 1021)
A4WFX5 9.18e-59 200 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Enterobacter sp. (strain 638)
Q9HZJ3 1.59e-58 199 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8ACZ3 1.99e-58 199 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q4ZRA1 2.05e-58 199 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas syringae pv. syringae (strain B728a)
A1TZR8 2.45e-58 199 33 9 421 3 fadA 3-ketoacyl-CoA thiolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P45359 3.21e-58 198 30 7 426 1 thlA Acetyl-CoA acetyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4KFC3 5.25e-58 198 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B7LTZ0 5.56e-58 197 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3K9D9 7.68e-58 197 33 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas fluorescens (strain Pf0-1)
Q9F0Y6 9.53e-58 197 33 11 429 3 fadA 3-ketoacyl-CoA thiolase Enterobacter cloacae
P0A2H7 1.13e-57 197 32 9 428 1 fadA 3-ketoacyl-CoA thiolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2H8 1.13e-57 197 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Salmonella typhi
Q5PKQ3 1.13e-57 197 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FBI3 1.18e-57 197 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A6TGM3 1.22e-57 197 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q31UE3 1.74e-57 196 33 10 428 3 fadA 3-ketoacyl-CoA thiolase Shigella boydii serotype 4 (strain Sb227)
A7ZU50 1.84e-57 196 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A8G8D0 1.96e-57 196 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Serratia proteamaculans (strain 568)
P54810 2.19e-57 196 33 9 423 3 phaA Acetyl-CoA acetyltransferase Paracoccus denitrificans
A4XSM9 2.48e-57 196 32 10 425 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas mendocina (strain ymp)
A1JIG3 3.05e-57 196 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YVC2 4.15e-57 195 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Shigella sonnei (strain Ss046)
A1AI32 4.28e-57 195 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O1:K1 / APEC
Q8X8J4 5.34e-57 195 33 10 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O157:H7
P24752 6.74e-57 196 30 9 429 1 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Homo sapiens
Q0TAL1 6.89e-57 195 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q57HM7 8.6e-57 194 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Salmonella choleraesuis (strain SC-B67)
Q66FR9 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TR28 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis (strain Pestoides F)
Q1CNA0 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAM9 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis
Q1C2C3 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDF1 1.06e-56 194 33 9 428 3 fadA 3-ketoacyl-CoA thiolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8QZT1 1.07e-56 195 30 9 429 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Mus musculus
Q1I7D5 1.1e-56 194 32 9 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas entomophila (strain L48)
A5W6G9 1.44e-56 194 32 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1R467 1.46e-56 194 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli (strain UTI89 / UPEC)
Q6DAP6 1.51e-56 194 33 10 428 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8A6V0 1.8e-56 194 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Escherichia coli O9:H4 (strain HS)
Q83PG2 1.92e-56 194 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri
Q0SZ35 1.92e-56 194 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Shigella flexneri serotype 5b (strain 8401)
Q88L01 2.36e-56 194 32 9 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93Q11 2.41e-56 193 32 10 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas oleovorans
Q7MZ91 2.67e-56 193 32 11 437 3 fadA 3-ketoacyl-CoA thiolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9R9W0 4.04e-56 193 32 9 427 3 fadA 3-ketoacyl-CoA thiolase Pseudomonas putida
C6DI66 4.33e-56 192 33 12 428 3 fadA 3-ketoacyl-CoA thiolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q29RZ0 4.92e-56 194 30 10 430 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Bos taurus
Q32A20 5.07e-56 192 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Shigella dysenteriae serotype 1 (strain Sd197)
P13437 5.92e-56 192 31 8 424 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Rattus norvegicus
P14611 1.22e-55 192 34 9 425 1 phaA Acetyl-CoA acetyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A6VVM8 1.28e-55 192 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Marinomonas sp. (strain MWYL1)
P21151 1.33e-55 191 32 9 428 1 fadA 3-ketoacyl-CoA thiolase FadA Escherichia coli (strain K12)
B6EGU1 1.64e-55 191 32 9 430 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio salmonicida (strain LFI1238)
Q8BWT1 1.72e-55 191 31 7 424 1 Acaa2 3-ketoacyl-CoA thiolase, mitochondrial Mus musculus
P17764 3.18e-55 191 30 9 427 1 Acat1 Acetyl-CoA acetyltransferase, mitochondrial Rattus norvegicus
A4VKA4 6.02e-55 190 32 10 425 3 fadA 3-ketoacyl-CoA thiolase Stutzerimonas stutzeri (strain A1501)
Q8HXY6 6.15e-55 191 29 9 429 2 ACAT1 Acetyl-CoA acetyltransferase, mitochondrial Macaca fascicularis
A0KEL0 1.11e-54 189 33 12 433 3 fadA 3-ketoacyl-CoA thiolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q5HIU0 1.12e-54 189 30 9 424 3 SACOL0426 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain COL)
B5FEW7 1.14e-54 189 32 8 429 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain MJ11)
P42765 1.37e-54 189 31 8 424 1 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Homo sapiens
Q5E8X7 1.5e-54 189 32 9 430 3 fadA 3-ketoacyl-CoA thiolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6L8K7 2.3e-54 188 29 9 421 3 PAT1 Acetyl-CoA acetyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q2G124 3.88e-54 188 30 10 424 3 SAOUHSC_00336 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJQ9 3.88e-54 188 30 10 424 3 SAUSA300_0355 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain USA300)
A4STF3 4.64e-54 187 33 12 433 3 fadA 3-ketoacyl-CoA thiolase Aeromonas salmonicida (strain A449)
Q5RES5 5.33e-54 187 30 8 424 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Pongo abelii
Q08A40 9.1e-54 187 33 11 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella frigidimarina (strain NCIMB 400)
Q489W4 1.01e-53 186 30 9 428 3 fadA 3-ketoacyl-CoA thiolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8NY95 1.2e-53 186 30 10 424 3 MW0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MW2)
Q6GCB8 1.2e-53 186 30 10 424 3 SAS0330 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MSSA476)
Q18AR0 1.25e-53 186 28 7 422 1 thlA Acetyl-CoA acetyltransferase Clostridioides difficile (strain 630)
Q12TB5 1.29e-53 186 32 10 434 3 fadA 3-ketoacyl-CoA thiolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7A7L2 1.84e-53 186 29 9 424 1 SA0342 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain N315)
Q99WM3 1.84e-53 186 29 9 424 3 SAV0354 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GJW4 3.39e-53 185 30 10 424 3 SAR0351 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain MRSA252)
Q0VNZ7 6.61e-53 184 31 9 426 3 fadA 3-ketoacyl-CoA thiolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B0VE46 6.94e-53 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AYE)
B0VLX5 6.94e-53 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain SDF)
B2I2J8 6.94e-53 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ACICU)
B7I3P0 6.94e-53 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB0057)
B7H1I1 6.94e-53 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain AB307-0294)
Q3T0R7 9.62e-53 184 30 8 424 2 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial Bos taurus
Q5QXH8 1.04e-52 184 32 12 428 3 fadA 3-ketoacyl-CoA thiolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q6FF69 1.45e-52 184 31 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3M1H9 2.25e-52 183 30 9 428 3 fadA 3-ketoacyl-CoA thiolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q2YVF5 4.18e-52 182 29 9 424 3 SAB0304 Probable acetyl-CoA acyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
P76461 6.45e-52 182 35 11 429 1 atoB Acetyl-CoA acetyltransferase Escherichia coli (strain K12)
B2VFE0 7.32e-52 182 32 9 428 3 fadA 3-ketoacyl-CoA thiolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A3CYJ3 8.57e-52 181 32 11 434 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q6LW07 1.01e-51 181 31 12 429 3 fadA 3-ketoacyl-CoA thiolase Photobacterium profundum (strain SS9)
Q0I0T4 1.38e-51 181 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-7)
Q1Q8K0 1.39e-51 181 30 9 425 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A4Y1B5 2.58e-51 180 33 12 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WH99 2.58e-51 180 33 12 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella baltica (strain OS185)
Q4FQC7 2.83e-51 180 30 9 425 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A3Q8U3 3.47e-51 180 32 11 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8EKS0 3.54e-51 180 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HPB8 4.06e-51 179 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain MR-4)
A1S1I7 4.28e-51 179 32 10 434 3 fadA 3-ketoacyl-CoA thiolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KR49 8.2e-51 179 33 12 436 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain ANA-3)
A5WH98 2.91e-50 177 30 9 428 3 fadA 3-ketoacyl-CoA thiolase Psychrobacter sp. (strain PRwf-1)
A1RDW3 3.17e-50 177 33 12 435 3 fadA 3-ketoacyl-CoA thiolase Shewanella sp. (strain W3-18-1)
C8YNG6 4.69e-50 179 32 16 443 1 KAT1 3-ketoacyl CoA thiolase 1, peroxisomal Petunia hybrida
Q15ZF4 4.91e-50 177 30 10 428 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q570C8 8.66e-50 178 32 16 445 1 KAT5 3-ketoacyl-CoA thiolase 5, peroxisomal Arabidopsis thaliana
Q21KB1 1.45e-49 176 31 12 432 3 fadA 3-ketoacyl-CoA thiolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q86AD9 1.61e-49 176 29 7 428 2 DDB_G0271544 Probable acetyl-CoA acetyltransferase Dictyostelium discoideum
P0C7L2 2.66e-49 175 32 9 424 1 paaJ 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase Escherichia coli (strain K12)
P45855 3.93e-49 174 30 8 422 1 mmgA Acetyl-CoA acetyltransferase Bacillus subtilis (strain 168)
P0C7L3 8.84e-49 174 31 9 429 3 paaJ Beta-ketoadipyl-CoA thiolase Escherichia coli
Q8LF48 1.1e-48 174 31 10 416 1 KAT1 3-ketoacyl-CoA thiolase 1, peroxisomal Arabidopsis thaliana
Q3IJ24 1.12e-48 173 30 11 426 3 fadA 3-ketoacyl-CoA thiolase Pseudoalteromonas translucida (strain TAC 125)
Q56WD9 1.41e-48 175 30 11 436 1 PED1 3-ketoacyl-CoA thiolase 2, peroxisomal Arabidopsis thaliana
P27796 3.93e-48 172 30 12 437 1 POT1 3-ketoacyl-CoA thiolase, peroxisomal Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1QUW9 1.09e-47 171 32 12 428 3 fadA 3-ketoacyl-CoA thiolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8DDK5 1.64e-47 170 31 11 431 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain CMCP6)
Q7MQI0 1.73e-47 170 31 11 431 3 fadA 3-ketoacyl-CoA thiolase Vibrio vulnificus (strain YJ016)
P41338 1.97e-47 170 29 12 441 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
I1RY81 2.58e-47 170 30 8 427 2 ERG10 Acetyl-CoA acetyltransferase ERG10, cytosolic Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q87TP0 3.39e-47 169 31 11 431 3 fadA 3-ketoacyl-CoA thiolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4WLA8 7.98e-47 169 30 11 423 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0XMC1 7.98e-47 169 30 11 423 1 erg10A Acetyl-CoA acetyltransferase erg10A, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A5F464 9.07e-47 168 31 11 429 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KNI0 9.46e-47 168 32 13 429 3 fadA 3-ketoacyl-CoA thiolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q12598 1.17e-46 168 29 11 429 1 PACTA Acetyl-CoA acetyltransferase IA Candida tropicalis
Q9UQW6 1.24e-46 168 30 10 428 2 erg10 Acetyl-CoA acetyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q04677 1.3e-46 168 29 11 429 1 PACTB Acetyl-CoA acetyltransferase IB Candida tropicalis
Q9FIK7 2.11e-46 168 30 9 429 1 ACCT1 Acetyl-CoA acetyltransferase 1 Arabidopsis thaliana
I1RMA2 2.86e-46 168 28 10 424 3 FG05087 Acetyl-CoA acetyltransferase FG05087, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WG69 3.98e-46 167 31 10 423 1 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG68 4.04e-46 166 31 10 423 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66927 4.04e-46 166 31 10 423 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9BWD1 4.13e-46 167 29 9 432 1 ACAT2 Acetyl-CoA acetyltransferase, cytosolic Homo sapiens
P46707 8.77e-46 166 32 10 423 3 fadA4 Probable acetyl-CoA acetyltransferase Mycobacterium leprae (strain TN)
A0A1D8PH52 8.01e-45 163 30 11 431 2 ERG10 Acetyl-CoA acetyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
P10551 9.52e-45 163 28 8 384 1 ERG10 Acetyl-CoA acetyltransferase Saccharomyces pastorianus (strain ATCC 76670 / Carlsberg bottom yeast no.2 / CBS 1503 / CLIB 180 / NBRC 10610 / NRRL Y-1525)
Q43974 9.85e-45 163 31 11 438 1 pcaF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q43935 3.45e-44 162 31 11 438 3 catF Beta-ketoadipyl-CoA thiolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O53871 5.92e-44 161 29 11 446 1 fadA Putative acyltransferase Rv0859 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8CAY6 4.14e-43 159 29 10 432 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Mus musculus
Q8S4Y1 7.94e-43 158 31 12 411 1 ACCT2 Acetyl-CoA acetyltransferase 2 Arabidopsis thaliana
Q5XI22 6.73e-42 155 28 9 432 1 Acat2 Acetyl-CoA acetyltransferase, cytosolic Rattus norvegicus
P33291 8.16e-42 155 28 11 438 3 None 3-ketoacyl-CoA thiolase B, peroxisomal Candida tropicalis
Q4WCL5 1.07e-41 155 28 7 426 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0YA65 1.07e-41 155 28 7 426 1 erg10B Acetyl-CoA acetyltransferase erg10B, cytosolic Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Q8SVA6 1.7e-41 154 29 11 423 1 FOX3 3-ketoacyl-CoA thiolase, peroxisomal Encephalitozoon cuniculi (strain GB-M1)
I6XHJ3 2.21e-39 149 30 10 429 1 fadA6 Steroid 3-ketoacyl-CoA thiolase FadA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q05493 5.71e-39 148 29 11 403 3 POT1 3-ketoacyl-CoA thiolase, peroxisomal Yarrowia lipolytica (strain CLIB 122 / E 150)
Q51956 7.77e-39 147 29 10 426 3 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas putida
Q22100 2.99e-38 145 26 10 422 1 kat-1 Acetyl-CoA acetyltransferase homolog, mitochondrial Caenorhabditis elegans
P33290 3.02e-38 146 28 11 438 3 None 3-ketoacyl-CoA thiolase A, peroxisomal Candida tropicalis
I6XHI4 4.75e-38 145 30 12 432 1 fadA5 Steroid 3-ketoacyl-CoA thiolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9I6R0 7.08e-37 142 29 8 424 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HRH3 1.43e-36 140 28 11 359 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VPF1 1.86e-36 140 29 10 424 1 pcaF Beta-ketoadipyl-CoA thiolase Pseudomonas knackmussii (strain DSM 6978 / CCUG 54928 / LMG 23759 / B13)
Q8CTR0 7.01e-36 139 28 11 359 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A1P9 7.64e-36 139 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MW2)
Q7A768 7.64e-36 139 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain N315)
Q7A2W9 7.64e-36 139 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9KWK4 7.64e-36 139 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ93 1.54e-35 138 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MRSA252)
Q5HIA0 2.25e-35 137 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain COL)
P73825 5.42e-35 137 28 9 424 3 phaA Acetyl-CoA acetyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6GBR1 2.65e-34 134 26 11 419 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus aureus (strain MSSA476)
O07618 2.29e-33 131 29 14 403 2 yhfS Putative acetyl-CoA C-acetyltransferase YhfS Bacillus subtilis (strain 168)
Q4L3Q1 1.16e-28 119 25 10 428 3 vraB Putative acetyl-CoA C-acetyltransferase VraB Staphylococcus haemolyticus (strain JCSC1435)
P45362 7.55e-06 48 25 0 91 3 thi Acetyl-CoA acetyltransferase (Fragment) Clostridioides difficile

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_07915
Feature type CDS
Gene fadI
Product acetyl-CoA C-acyltransferase FadI
Location 42244 - 43536 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)

Contig

Accession ZDB_217
Length 250991 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1932
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00108 Thiolase, N-terminal domain
PF02803 Thiolase, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0183 Lipid transport and metabolism (I) I Acetyl-CoA acetyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00626 acetyl-CoA C-acetyltransferase [EC:2.3.1.9] Fatty acid degradation
Valine, leucine and isoleucine degradation
Lysine degradation
Benzoate degradation
Tryptophan metabolism
Pyruvate metabolism
Glyoxylate and dicarboxylate metabolism
Butanoate metabolism
Carbon fixation pathways in prokaryotes
Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Fatty acid metabolism
Two-component system
Fat digestion and absorption
Ketone body biosynthesis, acetyl-CoA => acetoacetate/3-hydroxybutyrate/acetone
C5 isoprenoid biosynthesis, mevalonate pathway
Ethylmalonyl pathway
Dicarboxylate-hydroxybutyrate cycle
Hydroxypropionate-hydroxybutylate cycle
C5 isoprenoid biosynthesis, mevalonate pathway, archaea
Lysine degradation, bacteria, L-lysine => glutarate => succinate/acetyl-CoA

Protein Sequence

MKQAQAERIAVVDGLRTPFARQSTVYRDIPAVELGRAVVQELLFRQSFPAELVDLVVFGQVIQMPAAPNIAREIVLSTGLPVTTDAYSVTRACATSFQAIANAAQAIQCGQNQIAVAGGADSASVLPIGVSRKLAGVLLDLSKARKLSQKLRLLAALRPRDLLPVAPAVAEYSTGLRMGDTAEQMAKRYHISRQAQDAFAHQSHQAATQAWTSGVLRDEVMTARFPPFSQVCEEDNTLRKNSLPGSYAQLKPAFDKRHGTVTAANSTPLTDGAAAVLMMTEARARELGLTPLGFLRSYAFTGNAVQEDMLLGPSYAAPLALDRAGLTLSDLTLIDMHEAFAAQVLTNLHCFASEDFAREKLNRTAALGEVDPARFNVLGGSIAYGHPFAATGARMVTQTLRELRRRGGGFAMTTACAAGGLGVAMIWETE

Flanking regions ( +/- flanking 50bp)

TCAGACCACCGGCAGTTCGTGATAACCTCTCATCATGTAAGGATGAACGAATGAAGCAGGCACAGGCAGAACGCATTGCAGTTGTTGACGGATTACGAACACCGTTTGCCCGGCAGTCCACGGTATACCGTGATATCCCGGCGGTTGAACTTGGCCGGGCGGTGGTGCAGGAACTCCTTTTTCGCCAGTCATTTCCGGCAGAACTGGTTGACCTTGTCGTTTTCGGCCAGGTGATCCAAATGCCTGCCGCGCCCAATATTGCCCGTGAAATTGTGCTCAGTACCGGGTTGCCGGTAACCACAGATGCGTATTCAGTAACCCGTGCCTGTGCCACCAGTTTTCAGGCCATCGCCAATGCGGCACAGGCGATACAGTGCGGACAGAATCAGATAGCTGTCGCAGGCGGGGCAGATTCCGCCTCTGTGCTCCCGATTGGTGTATCACGCAAACTGGCCGGAGTATTGCTGGATCTCAGTAAAGCCCGGAAATTATCGCAGAAACTCCGGTTGCTGGCCGCATTGCGGCCGCGCGACCTCCTGCCTGTTGCCCCTGCGGTGGCGGAATATTCCACTGGTCTGCGCATGGGCGATACCGCCGAACAGATGGCAAAACGTTACCATATCAGCCGTCAGGCACAGGATGCGTTCGCCCATCAGTCACATCAGGCCGCCACTCAGGCGTGGACATCCGGTGTCCTGCGCGATGAGGTGATGACCGCCCGTTTCCCGCCGTTCAGTCAGGTATGTGAAGAAGATAATACGCTGCGGAAAAACTCTCTGCCCGGCAGCTATGCACAACTGAAACCGGCATTTGATAAACGTCACGGTACAGTGACAGCGGCAAACAGCACACCACTGACAGATGGCGCGGCAGCCGTATTGATGATGACCGAAGCCCGCGCCCGTGAACTCGGGCTGACGCCGCTGGGCTTTCTGCGCAGTTATGCATTTACGGGTAACGCAGTGCAGGAAGATATGCTGCTGGGGCCGTCGTATGCCGCACCGCTGGCACTTGATCGCGCCGGTCTGACATTATCTGACCTGACACTGATTGATATGCATGAAGCTTTTGCAGCCCAGGTTCTGACTAACCTGCACTGTTTTGCCAGTGAGGACTTTGCCCGTGAAAAACTCAACCGGACAGCGGCGTTGGGAGAAGTGGATCCGGCGCGGTTTAATGTGCTCGGCGGGTCAATTGCCTACGGACATCCTTTTGCTGCAACCGGTGCCCGGATGGTGACACAAACACTGCGGGAGCTGCGGCGGCGGGGCGGCGGTTTTGCAATGACCACGGCCTGTGCGGCGGGCGGTCTCGGCGTGGCGATGATCTGGGAAACGGAATAAGACGGGAGACTGATGATGACACAACATGATGAAACACCTTCTGCCTTCCG