Homologs in group_1252

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07290 FBDBKF_07290 81.3 Morganella morganii S1 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
EHELCC_03680 EHELCC_03680 81.3 Morganella morganii S2 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
NLDBIP_03680 NLDBIP_03680 81.3 Morganella morganii S4 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
LHKJJB_09510 LHKJJB_09510 81.3 Morganella morganii S3 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
HKOGLL_09465 HKOGLL_09465 81.3 Morganella morganii S5 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
PMI_RS03800 PMI_RS03800 57.0 Proteus mirabilis HI4320 - YcbX family protein

Distribution of the homologs in the orthogroup group_1252

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1252

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P75863 5.19e-155 443 56 0 365 1 ycbX Uncharacterized protein YcbX Escherichia coli (strain K12)
Q5VT66 7.89e-33 128 31 8 283 1 MTARC1 Mitochondrial amidoxime-reducing component 1 Homo sapiens
Q9CW42 8.91e-33 128 29 8 286 1 Mtarc1 Mitochondrial amidoxime-reducing component 1 Mus musculus
Q5U534 3.58e-31 124 30 8 280 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Xenopus laevis
O88994 2.84e-30 121 30 8 286 2 Mtarc2 Mitochondrial amidoxime reducing component 2 Rattus norvegicus
Q922Q1 2.99e-30 121 30 8 286 1 Mtarc2 Mitochondrial amidoxime reducing component 2 Mus musculus
Q9GKW0 1.61e-29 119 31 8 279 2 MTARC2 Mitochondrial amidoxime reducing component 2 Macaca fascicularis
Q58EJ9 7.04e-29 117 28 7 279 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Danio rerio
Q969Z3 1.42e-28 117 31 8 279 1 MTARC2 Mitochondrial amidoxime reducing component 2 Homo sapiens
Q1LZH1 3.15e-28 115 30 8 278 2 MTARC2 Mitochondrial amidoxime reducing component 2 Bos taurus
A2VD33 4.12e-22 101 26 9 290 2 mocos Molybdenum cofactor sulfurase Danio rerio
B3MZN7 4.12e-19 92 28 9 271 3 mal Molybdenum cofactor sulfurase Drosophila ananassae
Q559G8 4.46e-19 92 25 10 308 3 mocos Molybdenum cofactor sulfurase Dictyostelium discoideum
Q14CH1 2.46e-18 90 24 5 241 1 Mocos Molybdenum cofactor sulfurase Mus musculus
Q21657 6.14e-17 85 24 6 251 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis elegans
Q9VRA2 7.97e-17 85 26 6 226 1 mal Molybdenum cofactor sulfurase Drosophila melanogaster
Q96EN8 1e-16 85 24 6 266 1 MOCOS Molybdenum cofactor sulfurase Homo sapiens
Q9C5X8 1.07e-16 85 24 4 259 1 ABA3 Molybdenum cofactor sulfurase Arabidopsis thaliana
B4L340 1.41e-16 85 25 4 233 3 mal Molybdenum cofactor sulfurase Drosophila mojavensis
A8X493 1.52e-16 84 24 6 247 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis briggsae
Q9N0E7 4.1e-16 83 24 5 241 2 MOCOS Molybdenum cofactor sulfurase Bos taurus
B4PYH5 5.29e-16 83 26 5 226 3 mal Molybdenum cofactor sulfurase Drosophila yakuba
B3NY19 5.29e-16 83 26 4 226 3 mal Molybdenum cofactor sulfurase Drosophila erecta
Q655R6 9.89e-16 82 24 8 269 2 MCSU3 Molybdenum cofactor sulfurase Oryza sativa subsp. japonica
B4H0S8 1.34e-15 82 25 4 237 3 mal Molybdenum cofactor sulfurase Drosophila persimilis
B4JXP7 1.65e-15 81 26 4 219 3 mal Molybdenum cofactor sulfurase Drosophila grimshawi
Q8LGM7 8.44e-15 79 23 7 267 2 FLACCA Molybdenum cofactor sulfurase Solanum lycopersicum
Q29GM0 1.23e-14 79 25 4 237 3 mal Molybdenum cofactor sulfurase Drosophila pseudoobscura pseudoobscura
Q16GH0 1.8e-13 75 26 10 249 3 mal1 Molybdenum cofactor sulfurase 1 Aedes aegypti
B4N1V2 2.2e-12 72 25 3 226 3 mal Molybdenum cofactor sulfurase Drosophila willistoni
B0WSX1 9.58e-12 70 24 10 249 3 mal2 Molybdenum cofactor sulfurase 2 Culex quinquefasciatus
Q7QFL7 1.87e-11 69 25 8 255 3 mal Molybdenum cofactor sulfurase Anopheles gambiae
Q16P90 4.51e-11 68 25 11 249 3 mal3 Molybdenum cofactor sulfurase 3 Aedes aegypti
Q16P87 2.47e-09 62 23 6 216 3 mal2 Molybdenum cofactor sulfurase 2 Aedes aegypti
A6SRX6 3.28e-09 62 22 13 335 3 hxB Molybdenum cofactor sulfurase Botryotinia fuckeliana (strain B05.10)
Q8IU29 5.08e-09 61 24 8 250 2 mal Molybdenum cofactor sulfurase Bombyx mori
P57274 5.63e-09 56 34 1 83 4 BU177 Uncharacterized ferredoxin-like protein BU177 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P0ABW3 6.11e-09 55 38 3 84 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli (strain K12)
P0ABW4 6.11e-09 55 38 3 84 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P21394 7e-08 57 29 1 87 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
Q8IED5 5.97e-07 52 36 3 88 1 FD Ferredoxin, apicoplast Plasmodium falciparum (isolate 3D7)
P83522 8.97e-07 50 31 3 97 1 None Ferredoxin Hordeum vulgare
P45154 1.34e-06 49 37 2 69 4 HI_1309 Uncharacterized ferredoxin-like protein HI_1309 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P00228 1.77e-06 50 35 1 77 1 PETF Ferredoxin, chloroplastic Triticum aestivum
P75824 2.07e-06 52 36 1 74 1 hcr NADH oxidoreductase HCR Escherichia coli (strain K12)
Q0J8M2 5.67e-06 48 32 1 77 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. japonica
A2YQD9 5.67e-06 48 32 1 77 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. indica
P00226 7.89e-06 47 33 1 78 1 None Ferredoxin Sambucus nigra
P14937 1.55e-05 46 27 1 79 1 None Ferredoxin, root R-B2 Raphanus sativus
P09735 2.12e-05 46 32 1 70 1 None Ferredoxin Marchantia polymorpha
Q9TLW0 2.21e-05 46 33 1 75 3 petF Ferredoxin Cyanidium caldarium
Q9UV64 2.23e-05 50 23 14 341 2 hxB Molybdenum cofactor sulfurase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P00225 2.74e-05 45 29 1 78 1 None Ferredoxin Leucaena leucocephala
P00241 3.29e-05 45 32 1 75 1 PETF Ferredoxin Cyanidium caldarium
P27787 4.87e-05 46 34 2 78 1 FDX1 Ferredoxin-1, chloroplastic Zea mays
P26395 5.37e-05 48 31 0 70 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q03304 5.75e-05 48 37 2 74 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
Q1QYU6 6.05e-05 48 41 1 56 1 bmoB Glycine betaine monooxygenase reductase subunit Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P14936 7.6e-05 44 27 1 79 1 None Ferredoxin, root R-B1 Raphanus sativus
P83584 8.52e-05 44 31 1 77 1 None Ferredoxin Solanum lasiocarpum
P81372 0.000104 44 28 2 97 1 None Ferredoxin-A Alocasia macrorrhizos
Q9ZQG8 0.000119 45 29 1 79 1 FD3 Ferredoxin-3, chloroplastic Arabidopsis thaliana
P14938 0.000148 43 29 1 75 1 None Ferredoxin, leaf L-A Raphanus sativus
P83583 0.000165 43 31 1 77 1 None Ferredoxin Solanum lyratum
Q9C7Y4 0.000174 45 30 1 73 2 FDC2 Ferredoxin C 2, chloroplastic Arabidopsis thaliana
P04669 0.000181 44 32 1 68 2 PETF Ferredoxin, chloroplastic Silene latifolia subsp. alba
P00254 0.000191 43 29 1 74 1 petF1 Ferredoxin-1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P00220 0.000219 43 29 1 78 1 None Ferredoxin Medicago sativa
Q3C1D2 0.000238 46 34 2 69 1 tphA1II Terephthalate 1,2-dioxygenase, reductase component 2 Comamonas sp.
P83582 0.000249 43 33 1 68 1 None Ferredoxin Solanum nigrum
Q3C1E0 0.000254 46 34 2 69 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
P00227 0.000282 43 29 1 79 1 None Ferredoxin Brassica napus
P15789 0.000309 43 29 2 94 1 PETF Ferredoxin Cyanidium caldarium
P00233 0.000329 42 32 1 75 1 None Ferredoxin Gleichenia japonica
P16972 0.000358 43 29 2 89 1 FD2 Ferredoxin-2, chloroplastic Arabidopsis thaliana
P00217 0.000407 43 35 1 51 1 fer1 Ferredoxin-1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q43517 0.000487 43 31 1 77 2 SEND33 Ferredoxin-1, chloroplastic Solanum lycopersicum
P0A3D3 0.00049 42 29 1 74 1 petF1 Ferredoxin-1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P0A3D2 0.00049 42 29 1 74 3 petF Ferredoxin-1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P49522 0.000525 42 28 1 75 3 petF Ferredoxin Trieres chinensis
P83585 0.000576 42 28 1 77 1 None Ferredoxin Solanum abutiloides
P10770 0.000599 42 28 1 75 1 None Ferredoxin Peridinium bipes
P46035 0.000614 42 31 2 72 3 fdxH Ferredoxin-2 Leptolyngbya boryana
P68165 0.000641 42 29 1 77 1 None Ferredoxin Datura stramonium
P68166 0.000641 42 29 1 77 1 None Ferredoxin Datura quercifolia
P56408 0.000709 42 35 1 64 1 None Ferredoxin Scenedesmus fuscus
P00248 0.000738 42 29 1 79 1 petF Ferredoxin Mastigocladus laminosus
P83526 0.00078 42 32 1 68 1 None Ferredoxin Nicotiana tabacum
P83520 0.000795 42 32 1 68 1 None Ferredoxin Brugmansia arborea
P27788 0.000816 43 28 1 80 1 FDX3 Ferredoxin-3, chloroplastic Zea mays
P00224 0.000819 41 31 3 90 1 None Ferredoxin-2 Spinacia oleracea
P08451 0.000872 42 28 1 78 3 petF2 Ferredoxin-2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O80429 0.001 42 29 1 77 1 FDX2 Ferredoxin-2, chloroplastic Zea mays

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01475
Feature type CDS
Gene -
Product MOSC domain-containing protein
Location 327988 - 329115 (strand: -1)
Length 1128 (nucleotides) / 375 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1252
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain
PF03473 MOSC domain
PF03476 MOSC N-terminal beta barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3217 Nucleotide transport and metabolism (F)
Defense mechanisms (V)		 FV N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07140 uncharacterized protein - -

Protein Sequence

MTKTAITLSRLYTFPVKSMKGVRLSQSYAGDTGLSFDRNFMITDEDGKFLTARRYPQMVLFTPALLNNGIYLRSPDGSSATILYDDFLPESLACEVWGNHFTSLIAPEKINQWLCQFFDIPVQLRWLSPHSTRRVKLSPDSPVSFADGYPYLIVNEASFQAVQKRCSAAIKIEQFRGNIIVTGADAFAEDGWKVIQIGDVIFDLKKPCSRCIFTTISTDKGEKHPQMEPLHTLQTFRTAADKNDVDFGMNAIARNTGVIQVGDTVTVLETCPPREYQERVIEKIQPVTTQPQAMLTLTFNDKEYAVNNQHVLLEQLEAHQVSIPYSCRAGVCGSCKVTLLSGEVTPLKAGAIKRNGDILACSCIPKTNITIRHGK

Flanking regions ( +/- flanking 50bp)

CCGGATGCCATTGTGGTATTTACCGATAACAACGAAAAGAACGGATAACTATGACAAAAACAGCCATCACACTCTCCCGTTTATATACCTTTCCGGTGAAATCAATGAAAGGTGTACGCTTGTCGCAGAGCTATGCCGGGGATACCGGGCTGAGTTTTGACCGCAATTTTATGATAACCGACGAAGACGGAAAATTTCTGACCGCCCGCCGTTATCCGCAAATGGTGCTGTTTACCCCGGCACTGCTGAACAACGGCATTTACCTGCGCAGCCCGGATGGCAGCAGTGCCACTATTTTATATGATGATTTTCTGCCGGAGAGTCTGGCATGCGAAGTCTGGGGAAATCATTTTACCTCACTCATTGCCCCGGAAAAAATCAACCAGTGGCTGTGCCAGTTTTTTGATATCCCGGTTCAGTTACGCTGGCTCAGCCCGCACTCCACCCGGCGCGTGAAGCTCTCCCCGGACAGCCCGGTGTCTTTTGCGGACGGCTATCCGTATCTGATTGTGAATGAAGCTTCTTTTCAGGCGGTACAGAAACGTTGCAGTGCCGCGATTAAAATTGAACAGTTCCGCGGCAATATTATTGTCACCGGCGCAGATGCCTTTGCCGAAGACGGCTGGAAAGTGATTCAGATTGGCGATGTTATATTTGACCTGAAAAAACCGTGCAGCCGCTGCATTTTCACAACAATCAGCACGGATAAAGGTGAAAAACACCCGCAGATGGAGCCTCTGCACACTTTGCAGACGTTCAGGACAGCAGCGGATAAGAATGATGTGGATTTCGGCATGAATGCCATCGCCCGCAATACCGGTGTTATTCAGGTCGGCGACACAGTCACAGTATTGGAAACCTGCCCGCCGCGGGAATATCAGGAGCGGGTGATTGAGAAAATTCAACCGGTCACCACACAGCCGCAAGCCATGCTGACACTGACGTTCAACGATAAAGAGTATGCGGTGAATAATCAGCATGTCCTGCTGGAGCAGCTGGAAGCGCATCAGGTTTCCATTCCCTACTCCTGCCGTGCAGGTGTTTGCGGCAGTTGTAAAGTGACGCTGCTGTCCGGTGAGGTAACACCGCTGAAAGCCGGGGCAATAAAAAGAAACGGCGATATTCTGGCGTGTAGTTGTATTCCGAAAACCAATATTACGATCCGTCACGGCAAATAACAGATAAAAAAATACCCTCAGGCAGATTAATCCACCCGGGGGTATTGTAC