Homologs in group_1252

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07290 FBDBKF_07290 57.5 Morganella morganii S1 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
EHELCC_03680 EHELCC_03680 57.5 Morganella morganii S2 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
NLDBIP_03680 NLDBIP_03680 57.5 Morganella morganii S4 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
LHKJJB_09510 LHKJJB_09510 57.5 Morganella morganii S3 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
HKOGLL_09465 HKOGLL_09465 57.5 Morganella morganii S5 ycbX N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain
F4V73_RS01475 F4V73_RS01475 57.0 Morganella psychrotolerans - MOSC domain-containing protein

Distribution of the homologs in the orthogroup group_1252

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1252

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P75863 3.41e-154 442 56 3 377 1 ycbX Uncharacterized protein YcbX Escherichia coli (strain K12)
Q9GKW0 1.02e-31 125 30 6 276 2 MTARC2 Mitochondrial amidoxime reducing component 2 Macaca fascicularis
Q5U534 1.36e-31 125 28 6 278 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Xenopus laevis
Q58EJ9 1.39e-31 125 28 6 277 2 mtarc1 Mitochondrial amidoxime-reducing component 1 Danio rerio
Q9CW42 4.91e-31 124 29 7 284 1 Mtarc1 Mitochondrial amidoxime-reducing component 1 Mus musculus
Q922Q1 5.18e-31 124 30 6 279 1 Mtarc2 Mitochondrial amidoxime reducing component 2 Mus musculus
O88994 6.96e-31 123 29 7 282 2 Mtarc2 Mitochondrial amidoxime reducing component 2 Rattus norvegicus
Q1LZH1 8.06e-31 123 29 6 277 2 MTARC2 Mitochondrial amidoxime reducing component 2 Bos taurus
Q5VT66 1.14e-29 120 28 6 281 1 MTARC1 Mitochondrial amidoxime-reducing component 1 Homo sapiens
Q969Z3 1.32e-29 119 29 7 277 1 MTARC2 Mitochondrial amidoxime reducing component 2 Homo sapiens
Q655R6 2.54e-21 99 25 7 264 2 MCSU3 Molybdenum cofactor sulfurase Oryza sativa subsp. japonica
Q559G8 6.01e-21 98 27 10 295 3 mocos Molybdenum cofactor sulfurase Dictyostelium discoideum
Q9C5X8 5.84e-20 95 27 8 261 1 ABA3 Molybdenum cofactor sulfurase Arabidopsis thaliana
Q14CH1 5.56e-19 92 25 5 264 1 Mocos Molybdenum cofactor sulfurase Mus musculus
A2VD33 7.95e-19 92 26 7 265 2 mocos Molybdenum cofactor sulfurase Danio rerio
B4L340 8.44e-19 91 25 4 245 3 mal Molybdenum cofactor sulfurase Drosophila mojavensis
Q8LGM7 1.17e-18 91 24 9 289 2 FLACCA Molybdenum cofactor sulfurase Solanum lycopersicum
B0WSX1 2.96e-17 87 27 9 255 3 mal2 Molybdenum cofactor sulfurase 2 Culex quinquefasciatus
Q9VRA2 2.21e-16 84 25 5 247 1 mal Molybdenum cofactor sulfurase Drosophila melanogaster
B4JXP7 2.42e-16 84 25 4 243 3 mal Molybdenum cofactor sulfurase Drosophila grimshawi
Q96EN8 4.03e-16 83 24 7 268 1 MOCOS Molybdenum cofactor sulfurase Homo sapiens
Q9N0E7 6.56e-16 83 25 5 238 2 MOCOS Molybdenum cofactor sulfurase Bos taurus
A8X493 1.08e-15 82 26 8 252 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis briggsae
B3NY19 8.65e-14 76 24 4 245 3 mal Molybdenum cofactor sulfurase Drosophila erecta
Q16GH0 9.89e-14 76 26 8 253 3 mal1 Molybdenum cofactor sulfurase 1 Aedes aegypti
Q21657 1.02e-13 76 25 9 256 3 mocs-1 Molybdenum cofactor sulfurase Caenorhabditis elegans
Q7QFL7 1.31e-13 75 25 7 247 3 mal Molybdenum cofactor sulfurase Anopheles gambiae
B4PYH5 1.42e-13 75 24 4 245 3 mal Molybdenum cofactor sulfurase Drosophila yakuba
B3MZN7 1.48e-13 75 24 7 270 3 mal Molybdenum cofactor sulfurase Drosophila ananassae
Q16P90 1.29e-12 72 25 8 253 3 mal3 Molybdenum cofactor sulfurase 3 Aedes aegypti
B4H0S8 1.59e-12 72 24 6 258 3 mal Molybdenum cofactor sulfurase Drosophila persimilis
B4N1V2 1.71e-11 69 23 4 244 3 mal Molybdenum cofactor sulfurase Drosophila willistoni
Q29GM0 2.28e-11 68 23 6 258 3 mal Molybdenum cofactor sulfurase Drosophila pseudoobscura pseudoobscura
A2QIK9 7.91e-10 64 22 18 341 3 hxB Molybdenum cofactor sulfurase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A6SRX6 1.76e-09 63 24 14 350 3 hxB Molybdenum cofactor sulfurase Botryotinia fuckeliana (strain B05.10)
Q9UV64 5.39e-09 61 25 20 347 2 hxB Molybdenum cofactor sulfurase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P21394 2.15e-08 58 31 1 90 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
Q8IU29 4.15e-08 58 23 9 293 2 mal Molybdenum cofactor sulfurase Bombyx mori
P0ABW3 1.49e-07 52 39 1 63 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli (strain K12)
P0ABW4 1.49e-07 52 39 1 63 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q43517 3.6e-07 52 32 1 79 2 SEND33 Ferredoxin-1, chloroplastic Solanum lycopersicum
A1CHL0 4.35e-07 55 21 14 330 3 hxB Molybdenum cofactor sulfurase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P04669 4.76e-07 52 32 2 87 2 PETF Ferredoxin, chloroplastic Silene latifolia subsp. alba
P83582 5.76e-07 50 35 2 80 1 None Ferredoxin Solanum nigrum
Q16P87 8.96e-07 54 23 8 220 3 mal2 Molybdenum cofactor sulfurase 2 Aedes aegypti
P31965 9.94e-07 50 29 1 79 3 petF Ferredoxin-1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A1CX75 1.12e-06 54 20 13 326 3 hxB Molybdenum cofactor sulfurase Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P83523 1.18e-06 49 33 2 80 1 None Ferredoxin Lycium chinense
P83527 1.6e-06 49 33 2 80 1 None Ferredoxin Capsicum annuum var. annuum
P83583 1.63e-06 49 31 1 79 1 None Ferredoxin Solanum lyratum
P00225 1.71e-06 49 32 1 77 1 None Ferredoxin Leucaena leucocephala
P83584 1.75e-06 49 31 1 79 1 None Ferredoxin Solanum lasiocarpum
P83585 1.8e-06 49 32 2 80 1 None Ferredoxin Solanum abutiloides
P83524 2.21e-06 48 32 2 80 1 None Ferredoxin Alkekengi officinarum var. franchetii
P83526 2.39e-06 48 30 1 80 1 None Ferredoxin Nicotiana tabacum
P84872 2.44e-06 48 30 1 79 1 None Ferredoxin Atropa belladonna
P84874 2.46e-06 48 30 1 79 1 None Ferredoxin-2 Hyoscyamus niger
P83520 3.23e-06 48 32 2 80 1 None Ferredoxin Brugmansia arborea
P00254 3.29e-06 48 31 2 79 1 petF1 Ferredoxin-1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P49522 3.49e-06 48 29 1 78 3 petF Ferredoxin Trieres chinensis
B0WSW8 3.67e-06 52 21 7 228 3 mal1 Molybdenum cofactor sulfurase 1 Culex quinquefasciatus
P83525 4.13e-06 48 30 1 79 1 None Ferredoxin Scopolia japonica
P84873 5.17e-06 48 32 2 80 1 None Ferredoxin-1 Hyoscyamus niger
Q9ZTS2 5.37e-06 49 33 2 80 1 AP1 Ferredoxin, chloroplastic Capsicum annuum
P83522 8.75e-06 47 33 1 69 1 None Ferredoxin Hordeum vulgare
P81372 1.09e-05 47 31 1 77 1 None Ferredoxin-A Alocasia macrorrhizos
P00224 1.15e-05 47 33 2 74 1 None Ferredoxin-2 Spinacia oleracea
P68164 1.32e-05 47 31 2 80 1 None Ferredoxin Datura metel
P68163 1.32e-05 47 31 2 80 1 None Ferredoxin Datura inoxia
P9WNE9 1.39e-05 50 33 1 80 1 Rv3230c NADPH oxidoreductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNE8 1.39e-05 50 33 1 80 3 MT3327 NADPH oxidoreductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P57274 1.45e-05 46 36 1 68 4 BU177 Uncharacterized ferredoxin-like protein BU177 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P68165 1.57e-05 46 31 2 80 1 None Ferredoxin Datura stramonium
P68166 1.57e-05 46 31 2 80 1 None Ferredoxin Datura quercifolia
P27788 1.66e-05 48 28 1 77 1 FDX3 Ferredoxin-3, chloroplastic Zea mays
P14936 1.7e-05 46 27 1 77 1 None Ferredoxin, root R-B1 Raphanus sativus
Q9FIA7 1.89e-05 47 38 2 67 1 FD4 Probable ferredoxin-4, chloroplastic Arabidopsis thaliana
P00228 2.27e-05 47 31 1 69 1 PETF Ferredoxin, chloroplastic Triticum aestivum
P00226 2.48e-05 46 35 2 78 1 None Ferredoxin Sambucus nigra
P45154 2.56e-05 45 30 2 83 4 HI_1309 Uncharacterized ferredoxin-like protein HI_1309 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A3C8 2.92e-05 45 32 2 74 1 petF Ferredoxin-1 Nostoc sp. (strain ATCC 29151 / PCC 7119)
P0A3C7 2.92e-05 45 32 2 74 1 petF Ferredoxin-1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O04683 3.3e-05 47 33 1 69 2 None Ferredoxin-1, chloroplastic Mesembryanthemum crystallinum
P00253 3.35e-05 45 32 2 74 1 None Ferredoxin Desmonostoc muscorum
P00252 3.99e-05 45 30 2 79 1 None Ferredoxin-1 Desmonostoc muscorum
P0A3D1 4.1e-05 45 29 1 78 3 petF1 Ferredoxin-1 Thermostichus vulcanus
P0A3C9 4.1e-05 45 29 1 78 1 petF1 Ferredoxin-1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0A3D0 4.1e-05 45 29 1 78 3 petF1 Ferredoxin-1 Synechococcus elongatus
Q8IED5 4.31e-05 47 34 2 75 1 FD Ferredoxin, apicoplast Plasmodium falciparum (isolate 3D7)
Q0J8M2 4.78e-05 46 35 3 70 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. japonica
A2YQD9 4.78e-05 46 35 3 70 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. indica
Q03304 4.83e-05 48 32 1 76 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
P00229 5.14e-05 45 30 1 78 1 None Ferredoxin-1 Phytolacca americana
P00241 5.87e-05 45 30 1 68 1 PETF Ferredoxin Cyanidium caldarium
P00230 5.95e-05 45 30 1 78 1 None Ferredoxin-1 Phytolacca acinosa
Q9TLW0 6.62e-05 45 34 3 87 3 petF Ferredoxin Cyanidium caldarium
P27787 6.99e-05 46 35 2 70 1 FDX1 Ferredoxin-1, chloroplastic Zea mays
P81373 7.14e-05 44 29 1 86 1 None Ferredoxin-B Alocasia macrorrhizos
P14937 8.76e-05 44 27 1 77 1 None Ferredoxin, root R-B2 Raphanus sativus
P00242 9.75e-05 44 28 1 74 1 PETF Ferredoxin Porphyra umbilicalis
P51320 0.000101 44 28 1 74 3 petF Ferredoxin Porphyra purpurea
P00220 0.000118 44 29 1 77 1 None Ferredoxin Medicago sativa
P00255 0.000122 44 30 1 73 1 None Ferredoxin Thermostichus lividus
P75824 0.000125 47 33 1 65 1 hcr NADH oxidoreductase HCR Escherichia coli (strain K12)
P00235 0.000132 43 31 2 70 1 None Ferredoxin-1 Equisetum arvense
Q1XDG7 0.000143 43 28 1 75 3 petF Ferredoxin Neopyropia yezoensis
P00234 0.000153 43 28 1 69 1 None Ferredoxin-1 Equisetum telmateia
P26395 0.000154 47 33 0 71 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2UH11 0.000167 47 20 15 293 3 hxB Molybdenum cofactor sulfurase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9ZQG8 0.000195 45 28 1 77 1 FD3 Ferredoxin-3, chloroplastic Arabidopsis thaliana
P00232 0.000213 43 31 1 69 1 None Ferredoxin-2 Phytolacca acinosa
P22341 0.000227 43 32 3 90 1 None Ferredoxin Euglena viridis
P00221 0.00024 44 29 1 79 1 PETF Ferredoxin-1, chloroplastic Spinacia oleracea
O98450 0.000244 43 26 1 78 3 petF Ferredoxin Thalassiosira weissflogii
P00250 0.000246 43 33 3 83 1 None Ferredoxin-1 Aphanothece sacrum
P00217 0.00029 43 33 2 80 1 fer1 Ferredoxin-1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P00231 0.000291 43 31 1 69 1 None Ferredoxin-2 Phytolacca americana
P27789 0.000369 43 27 3 111 2 FDX5 Ferredoxin-5, chloroplastic Zea mays
P94044 0.000372 43 27 1 77 2 FDX6 Ferredoxin-6, chloroplastic Zea mays
P09735 0.000379 42 27 1 76 1 None Ferredoxin Marchantia polymorpha
P15788 0.000538 42 27 1 68 1 PCC7418_2938 Ferredoxin Halothece sp. (strain PCC 7418)
P00233 0.000648 42 30 1 68 1 None Ferredoxin Gleichenia japonica
Q3C1E0 0.000886 44 25 1 81 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
P00244 0.001 41 29 2 79 1 None Ferredoxin-1 Aphanizomenon flos-aquae
P17007 0.001 41 28 1 73 1 petF Ferredoxin-1 Cyanophora paradoxa

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03800
Feature type CDS
Gene -
Product YcbX family protein
Location 859626 - 860768 (strand: -1)
Length 1143 (nucleotides) / 380 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1252
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain
PF03473 MOSC domain
PF03476 MOSC N-terminal beta barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3217 Nucleotide transport and metabolism (F)
Defense mechanisms (V)		 FV N-hydroxylaminopurine reductase subunit YcbX, contains MOSC domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07140 uncharacterized protein - -

Protein Sequence

MINVSRLYIHPVKSMKGTRLSQAFARESGFTFDRDFMITTPEGTFITARKYPLLLCFIPTVMTNGIYIQAPDGEGIAITYQDFQSSLQPTEVWGNHFTAYVAPDEINQWFSRYLGMDVQLRWTGEKSTRRVKKSPETAVSFADGYPYLLINEASFQSLQQRCPASINIEQFRGNIIITGAKPFAEDSWQTIRIGSVVMDLVKPCSRCIMTTISIDKGIKHPTTEPLATLQTFRTDEKGDVDFGQNIIIRQSGIIRVGDKVEILAYKEAKSYLQTTEQTTEPATDNAVTAASAQEPKQAVTIEFNGISFDGNNQEVLLEQLENHGYAIPYSCRAGICGSCVIQLDEGDVNALKAGAIKRSGRILACSCVPKGNVKLSLNKK

Flanking regions ( +/- flanking 50bp)

CATAAAGTTACTGACGATAAAAAAATAATAAAACCTTTTTGGGAGCACTGATGATCAACGTATCACGCCTTTATATACACCCTGTAAAATCAATGAAAGGGACTCGTCTTTCTCAAGCCTTTGCCCGTGAAAGCGGCTTCACGTTTGATCGTGATTTTATGATAACGACCCCTGAGGGGACATTTATCACCGCACGTAAATACCCTTTGTTGCTGTGTTTTATTCCCACTGTAATGACAAATGGTATTTATATTCAAGCACCCGATGGTGAAGGAATTGCCATTACTTATCAGGATTTTCAATCTTCATTACAACCAACTGAAGTGTGGGGAAATCATTTTACCGCTTATGTTGCCCCAGATGAAATAAATCAATGGTTCAGCCGCTATTTAGGCATGGATGTACAACTTCGCTGGACGGGTGAAAAATCAACACGTCGAGTAAAAAAATCTCCTGAAACCGCGGTTTCGTTCGCTGACGGTTACCCTTATCTATTGATTAATGAAGCCTCATTTCAGTCTCTGCAACAGCGTTGCCCAGCTTCAATCAATATTGAGCAATTTCGCGGTAATATCATCATCACAGGTGCAAAACCTTTTGCAGAAGATAGCTGGCAAACAATCCGTATTGGCTCTGTCGTCATGGACTTAGTCAAGCCTTGCAGTCGCTGCATTATGACCACTATCAGTATCGATAAAGGCATTAAACATCCTACCACAGAACCGTTAGCAACACTGCAAACATTCCGTACAGATGAAAAAGGCGATGTGGATTTTGGTCAAAATATTATCATTCGCCAATCAGGTATTATTCGTGTTGGGGATAAAGTTGAAATATTAGCTTATAAAGAAGCGAAATCTTATTTACAAACAACAGAGCAAACAACCGAACCAGCAACTGACAATGCGGTTACAGCAGCCTCCGCTCAAGAGCCAAAACAAGCTGTCACTATTGAATTTAATGGCATCAGCTTTGATGGGAATAATCAAGAGGTGTTGTTAGAGCAACTGGAAAATCACGGTTATGCTATTCCCTATAGTTGTCGTGCGGGGATTTGTGGCTCTTGTGTTATTCAATTAGATGAAGGTGATGTCAATGCATTAAAAGCAGGTGCCATAAAACGTTCTGGCAGAATACTCGCATGTAGTTGTGTTCCTAAAGGCAATGTAAAACTTTCACTTAATAAAAAATAACGCTTATCTTTATCACAAATAAAAAGAAGGTAAACTGTCCTTATCTTCTT