Homologs in group_1199

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06930 FBDBKF_06930 94.3 Morganella morganii S1 hisG ATP phosphoribosyltransferase
EHELCC_04040 EHELCC_04040 94.3 Morganella morganii S2 hisG ATP phosphoribosyltransferase
NLDBIP_04040 NLDBIP_04040 94.3 Morganella morganii S4 hisG ATP phosphoribosyltransferase
LHKJJB_09870 LHKJJB_09870 94.3 Morganella morganii S3 hisG ATP phosphoribosyltransferase
HKOGLL_09105 HKOGLL_09105 94.3 Morganella morganii S5 hisG ATP phosphoribosyltransferase
PMI_RS03275 PMI_RS03275 85.6 Proteus mirabilis HI4320 hisG ATP phosphoribosyltransferase

Distribution of the homologs in the orthogroup group_1199

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1199

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N6I0 0.0 539 87 0 299 3 hisG ATP phosphoribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JPV9 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66C48 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKK2 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CGX2 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2K3 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZFX4 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pestis
B2JZN0 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C9Q9 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FJG9 0.0 527 85 0 299 3 hisG ATP phosphoribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B4ET04 0.0 525 85 0 299 3 hisG ATP phosphoribosyltransferase Proteus mirabilis (strain HI4320)
C6DF77 0.0 523 84 0 299 3 hisG ATP phosphoribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GC80 0.0 521 84 0 299 3 hisG ATP phosphoribosyltransferase Serratia proteamaculans (strain 568)
A1JTV7 0.0 521 84 0 299 3 hisG ATP phosphoribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TBC2 0.0 521 85 0 299 3 hisG ATP phosphoribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XPE8 0.0 521 85 0 299 3 hisG ATP phosphoribosyltransferase Klebsiella pneumoniae (strain 342)
B4SX40 0.0 520 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella newport (strain SL254)
B5RBR1 0.0 520 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL1 0.0 520 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella enteritidis PT4 (strain P125109)
Q6D412 0.0 520 84 0 299 3 hisG ATP phosphoribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4TMR4 0.0 519 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella schwarzengrund (strain CVM19633)
B5EX38 0.0 519 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella agona (strain SL483)
Q8Z5K1 0.0 518 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella typhi
B5BFC1 0.0 518 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PDP2 0.0 518 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5FM40 0.0 518 85 0 299 3 hisG ATP phosphoribosyltransferase Salmonella dublin (strain CT_02021853)
Q323J3 0.0 516 85 0 299 3 hisG ATP phosphoribosyltransferase Shigella boydii serotype 4 (strain Sb227)
B7NQH1 0.0 516 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P00499 0.0 516 84 0 299 1 hisG ATP phosphoribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q1K3 0.0 516 84 0 299 3 hisG ATP phosphoribosyltransferase Salmonella paratyphi C (strain RKS4594)
B4T9N3 0.0 516 84 0 299 3 hisG ATP phosphoribosyltransferase Salmonella heidelberg (strain SL476)
Q57MS4 0.0 516 84 0 299 3 hisG ATP phosphoribosyltransferase Salmonella choleraesuis (strain SC-B67)
B7LUF0 0.0 516 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3Z0G6 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Shigella sonnei (strain Ss046)
B2TYG1 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RA54 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LP22 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I846 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain SE11)
P60757 0.0 515 85 0 299 1 hisG ATP phosphoribosyltransferase Escherichia coli (strain K12)
B1IZ55 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60758 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TG68 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ACN1 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O1:K1 / APEC
A8A1P3 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O9:H4 (strain HS)
B1X6V6 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZSA8 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3Z8 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O8 (strain IAI1)
B5YU75 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8T4 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O157:H7
B7L9P6 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MDH3 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UT56 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZNJ1 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NC59 0.0 515 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32EE8 0.0 514 84 0 299 3 hisG ATP phosphoribosyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
A4WC68 0.0 514 84 0 299 3 hisG ATP phosphoribosyltransferase Enterobacter sp. (strain 638)
B7MWT8 0.0 513 85 0 299 3 hisG ATP phosphoribosyltransferase Escherichia coli O81 (strain ED1a)
B2VFL7 0.0 512 83 0 299 3 hisG ATP phosphoribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q83KJ7 0.0 511 84 0 299 3 hisG ATP phosphoribosyltransferase Shigella flexneri
Q0T3A8 0.0 511 84 0 299 3 hisG ATP phosphoribosyltransferase Shigella flexneri serotype 5b (strain 8401)
C5BG10 0.0 504 82 0 299 3 hisG ATP phosphoribosyltransferase Edwardsiella ictaluri (strain 93-146)
Q1LT66 1.33e-176 492 78 0 299 3 hisG ATP phosphoribosyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q2NTX0 8.59e-175 488 79 0 299 3 hisG ATP phosphoribosyltransferase Sodalis glossinidius (strain morsitans)
Q7VQX1 2.01e-170 476 77 0 299 3 hisG ATP phosphoribosyltransferase Blochmanniella floridana
Q9RQ89 7.99e-164 460 72 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Diuraphis noxia
Q492K4 1.04e-163 459 75 0 299 3 hisG ATP phosphoribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
B8D705 3.81e-161 453 72 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57200 3.81e-161 453 72 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8Q1 3.81e-161 453 72 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P59453 2.92e-159 448 71 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9ZHE7 6.06e-158 445 71 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9RQ83 1.69e-156 441 70 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Melaphis rhois
P57919 1.14e-155 439 70 0 298 3 hisG ATP phosphoribosyltransferase Pasteurella multocida (strain Pm70)
Q9RQ86 6.06e-154 435 68 0 299 3 hisG ATP phosphoribosyltransferase Buchnera aphidicola subsp. Schlechtendalia chinensis
Q65RB0 1.67e-151 429 70 0 298 3 hisG ATP phosphoribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A4SMP5 2.4e-150 426 70 0 298 3 hisG ATP phosphoribosyltransferase Aeromonas salmonicida (strain A449)
A0KKB9 9.66e-150 424 69 0 298 3 hisG ATP phosphoribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LFH8 2.92e-149 423 68 0 297 3 hisG ATP phosphoribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0BU47 7.98e-148 419 68 0 298 3 hisG ATP phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N3V7 7.98e-148 419 68 0 298 3 hisG ATP phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3GZG5 9.41e-148 419 68 0 298 3 hisG ATP phosphoribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A5UA21 2e-144 411 67 0 295 3 hisG ATP phosphoribosyltransferase Haemophilus influenzae (strain PittEE)
P43853 6.81e-144 409 67 0 295 3 hisG ATP phosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN75 6.81e-144 409 67 0 295 3 hisG ATP phosphoribosyltransferase Haemophilus influenzae (strain 86-028NP)
Q8EFB0 8.12e-144 409 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KWB6 1.85e-143 408 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella sp. (strain ANA-3)
A7H5U7 2.89e-143 408 63 0 299 3 hisG ATP phosphoribosyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q0HUP0 7.17e-143 407 64 0 298 3 hisG ATP phosphoribosyltransferase Shewanella sp. (strain MR-7)
A9L4B4 1.06e-142 406 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella baltica (strain OS195)
A6WP16 1.06e-142 406 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella baltica (strain OS185)
A3D5A5 1.06e-142 406 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9A5 1.06e-142 406 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella baltica (strain OS223)
Q083J5 2.42e-142 405 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
A3QF15 5.14e-142 405 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5UGY0 1.27e-141 404 67 0 295 3 hisG ATP phosphoribosyltransferase Haemophilus influenzae (strain PittGG)
Q12NS4 1.55e-141 403 65 0 298 3 hisG ATP phosphoribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0TRH1 1.22e-140 401 63 0 298 3 hisG ATP phosphoribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
B8CR48 3.29e-140 400 63 0 298 3 hisG ATP phosphoribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q7MLS7 4.32e-140 400 64 0 298 3 hisG ATP phosphoribosyltransferase Vibrio vulnificus (strain YJ016)
Q8D8P9 4.32e-140 400 64 0 298 3 hisG ATP phosphoribosyltransferase Vibrio vulnificus (strain CMCP6)
A8H5D9 2.52e-139 398 63 0 298 3 hisG ATP phosphoribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
P62365 6.3e-139 397 64 0 298 3 hisG ATP phosphoribosyltransferase Photobacterium profundum (strain SS9)
A8FNQ9 2.22e-138 395 64 0 299 3 hisG ATP phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W1J9 2.62e-138 395 64 0 299 3 hisG ATP phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B5FD98 5.44e-138 394 64 0 298 3 hisG ATP phosphoribosyltransferase Aliivibrio fischeri (strain MJ11)
Q5HSJ4 6.08e-138 394 64 0 299 1 hisG ATP phosphoribosyltransferase Campylobacter jejuni (strain RM1221)
Q9PM78 6.08e-138 394 64 0 299 3 hisG ATP phosphoribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5E639 6.7e-138 394 64 0 298 3 hisG ATP phosphoribosyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KSX4 1.18e-137 394 64 0 298 1 hisG ATP phosphoribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A7MX14 1.7e-137 393 63 0 298 3 hisG ATP phosphoribosyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q87QL2 3.17e-137 392 64 0 298 3 hisG ATP phosphoribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6EJ87 4.59e-137 392 64 0 294 3 hisG ATP phosphoribosyltransferase Aliivibrio salmonicida (strain LFI1238)
B1KRG9 1.87e-136 390 63 0 298 3 hisG ATP phosphoribosyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A8FWC5 3.8e-136 390 63 0 298 3 hisG ATP phosphoribosyltransferase Shewanella sediminis (strain HAW-EB3)
A1SVD5 2.46e-135 388 61 0 296 3 hisG ATP phosphoribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B9KEH8 2.85e-133 382 62 0 298 3 hisG ATP phosphoribosyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q0AP80 7.13e-90 272 48 2 295 3 hisG ATP phosphoribosyltransferase Maricaulis maris (strain MCS10)
Q11TY6 3.18e-84 257 46 4 293 3 hisG ATP phosphoribosyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6L2V6 6.91e-83 254 45 4 292 3 hisG ATP phosphoribosyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q64RE6 1.24e-82 253 44 4 292 3 hisG ATP phosphoribosyltransferase Bacteroides fragilis (strain YCH46)
Q5LAZ7 1.24e-82 253 44 4 292 3 hisG ATP phosphoribosyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8ABB0 5.96e-82 251 43 4 292 3 hisG ATP phosphoribosyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A6LAM0 1.76e-77 240 42 4 292 3 hisG ATP phosphoribosyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q5H0L2 1.37e-75 236 42 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SKN9 1.37e-75 236 42 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P3K4 1.37e-75 236 42 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PLH0 2.33e-75 235 42 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q3BUF8 1.41e-74 233 42 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2FPL8 1.78e-71 226 42 1 295 3 hisG ATP phosphoribosyltransferase Stenotrophomonas maltophilia (strain K279a)
B4STN6 1.97e-71 225 42 1 295 3 hisG ATP phosphoribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q4UU39 2.22e-70 223 41 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
B0U3B4 2.82e-70 223 42 1 295 3 hisG ATP phosphoribosyltransferase Xylella fastidiosa (strain M12)
Q8P9P3 3.46e-70 222 41 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q87C28 3.57e-70 222 42 1 295 3 hisG ATP phosphoribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5Y2 3.57e-70 222 42 1 295 3 hisG ATP phosphoribosyltransferase Xylella fastidiosa (strain M23)
B0RSL3 4.25e-70 222 41 1 295 3 hisG ATP phosphoribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
B6YQ21 4.44e-70 221 39 3 292 3 hisG ATP phosphoribosyltransferase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q9PBC4 1.31e-69 221 42 1 295 3 hisG ATP phosphoribosyltransferase Xylella fastidiosa (strain 9a5c)
C1A4M2 1.52e-55 184 36 6 307 3 hisG ATP phosphoribosyltransferase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
P05148 1.57e-54 175 86 0 100 3 hisG ATP phosphoribosyltransferase (Fragment) Klebsiella pneumoniae
A4FXY0 5.9e-53 177 33 3 292 3 hisG ATP phosphoribosyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q5UYR5 7.2e-53 177 37 4 294 3 hisG ATP phosphoribosyltransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P60807 7.56e-53 177 33 3 292 3 hisG ATP phosphoribosyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VFN8 9.75e-52 174 33 3 292 3 hisG ATP phosphoribosyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A9AAZ7 2.07e-51 173 33 3 292 3 hisG ATP phosphoribosyltransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q970Z3 7e-50 169 35 4 295 3 hisG ATP phosphoribosyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q7URL0 1.52e-46 161 35 5 294 3 hisG ATP phosphoribosyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A6UTA7 5.61e-46 159 31 4 292 3 hisG ATP phosphoribosyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q12WC7 7.26e-46 159 32 4 294 3 hisG ATP phosphoribosyltransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q58601 1.32e-45 158 32 4 291 3 hisG ATP phosphoribosyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q46CW7 1.69e-45 158 33 7 299 3 hisG ATP phosphoribosyltransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q3ITB2 4.74e-45 157 34 7 293 3 hisG ATP phosphoribosyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9HN53 1.43e-44 155 34 4 294 3 hisG ATP phosphoribosyltransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R7E9 1.43e-44 155 34 4 294 3 hisG ATP phosphoribosyltransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O27550 4.74e-44 154 34 5 295 1 hisG ATP phosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q18EV8 4.81e-44 154 33 5 295 3 hisG ATP phosphoribosyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q4J8J2 7.04e-44 154 33 5 295 3 hisG ATP phosphoribosyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8PWS3 7.73e-44 154 31 6 298 3 hisG ATP phosphoribosyltransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TU56 4.67e-42 149 32 5 298 3 hisG ATP phosphoribosyltransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TYD5 8.09e-42 149 33 4 293 3 hisG ATP phosphoribosyltransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q0W6K3 2e-40 145 31 3 293 3 hisG ATP phosphoribosyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
O33771 1.04e-38 140 31 4 296 3 hisG ATP phosphoribosyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A4YI31 4.99e-38 139 31 4 295 3 hisG ATP phosphoribosyltransferase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
B9LU14 5.97e-37 136 31 4 298 3 hisG ATP phosphoribosyltransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
A8AAI4 8.36e-37 135 31 6 297 3 hisG ATP phosphoribosyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
B1YAM9 7.13e-36 133 32 6 292 3 hisG ATP phosphoribosyltransferase Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
Q8ZY36 2.25e-35 132 31 7 295 3 hisG ATP phosphoribosyltransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
P40373 1.17e-34 130 31 6 305 2 his1 ATP phosphoribosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1R5S0 6.34e-34 128 33 8 294 3 hisG ATP phosphoribosyltransferase Paenarthrobacter aurescens (strain TC1)
A1RTU8 6.78e-34 128 31 7 295 3 hisG ATP phosphoribosyltransferase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
A3MSF5 7.69e-34 127 30 6 295 3 hisG ATP phosphoribosyltransferase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
C3PG93 8.35e-34 127 32 7 287 3 hisG ATP phosphoribosyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
B8H6U1 2.33e-33 126 32 7 292 3 hisG ATP phosphoribosyltransferase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q9Z472 2.8e-33 126 33 6 289 3 hisG ATP phosphoribosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QE90 2.8e-33 126 33 6 289 3 hisG ATP phosphoribosyltransferase Corynebacterium glutamicum (strain R)
A0JVK4 6.01e-33 125 33 8 294 3 hisG ATP phosphoribosyltransferase Arthrobacter sp. (strain FB24)
Q4JVP1 1.38e-32 124 31 8 291 3 hisG ATP phosphoribosyltransferase Corynebacterium jeikeium (strain K411)
C4LIL5 2.8e-32 124 30 6 289 3 hisG ATP phosphoribosyltransferase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
P60803 3.87e-32 123 31 7 291 3 hisG ATP phosphoribosyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
C5CBK0 6.75e-32 122 33 9 295 3 hisG ATP phosphoribosyltransferase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
C0ZZV7 8.51e-32 122 31 6 293 3 hisG ATP phosphoribosyltransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
P9WMN1 4.65e-31 120 30 5 288 1 hisG ATP phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMN0 4.65e-31 120 30 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4E7 4.65e-31 120 30 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AQ37 4.65e-31 120 30 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KKG4 4.65e-31 120 30 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P60760 4.65e-31 120 30 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q99145 8.21e-31 120 31 7 297 3 HIS1 ATP phosphoribosyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q8FTD5 1.56e-30 119 31 5 289 3 hisG ATP phosphoribosyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8G695 3.11e-30 118 30 8 292 3 hisG ATP phosphoribosyltransferase Bifidobacterium longum (strain NCC 2705)
B2GGU8 3.79e-30 118 33 8 292 3 hisG ATP phosphoribosyltransferase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
C1ASQ7 7.72e-30 117 31 6 289 3 hisG ATP phosphoribosyltransferase Rhodococcus opacus (strain B4)
B7GRM4 1.17e-29 117 30 8 292 3 hisG ATP phosphoribosyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q6CID6 1.74e-29 116 30 5 295 3 HIS1 ATP phosphoribosyltransferase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P00498 1.77e-29 116 30 5 295 1 HIS1 ATP phosphoribosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P60805 2.53e-29 115 29 5 288 3 hisG ATP phosphoribosyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFA5 2.53e-29 115 29 5 288 3 hisG ATP phosphoribosyltransferase Mycobacterium avium (strain 104)
B3DS05 2.9e-29 115 30 8 292 3 hisG ATP phosphoribosyltransferase Bifidobacterium longum (strain DJO10A)
P46586 3.34e-29 115 31 5 295 1 HIS1 ATP phosphoribosyltransferase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q0SIE9 3.46e-29 115 31 6 289 3 hisG ATP phosphoribosyltransferase Rhodococcus jostii (strain RHA1)
Q92E83 2.25e-28 111 35 5 213 3 hisG ATP phosphoribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1A1J3 3.56e-28 112 28 4 290 3 hisG ATP phosphoribosyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B8DA57 3.97e-28 110 34 5 213 3 hisG ATP phosphoribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
A3Q1A9 4.04e-28 112 30 6 289 3 hisG ATP phosphoribosyltransferase Mycobacterium sp. (strain JLS)
Q1B782 4.25e-28 112 30 6 289 3 hisG ATP phosphoribosyltransferase Mycobacterium sp. (strain MCS)
A1UHU3 4.25e-28 112 30 6 289 3 hisG ATP phosphoribosyltransferase Mycobacterium sp. (strain KMS)
Q722Y2 4.55e-28 110 34 5 213 3 hisG ATP phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1L0J7 4.55e-28 110 34 5 213 3 hisG ATP phosphoribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q1IKB7 7.9e-28 112 27 5 294 3 hisG ATP phosphoribosyltransferase Koribacter versatilis (strain Ellin345)
Q5YUV9 1.62e-27 111 30 5 289 3 hisG ATP phosphoribosyltransferase Nocardia farcinica (strain IFM 10152)
A0AG20 2.06e-27 108 34 5 213 3 hisG ATP phosphoribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q2W1X8 3.71e-27 108 37 5 202 3 hisG ATP phosphoribosyltransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q75AK8 3.73e-27 110 31 5 300 3 HIS1 ATP phosphoribosyltransferase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A4FBW8 4.21e-27 110 30 5 292 3 hisG ATP phosphoribosyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q8Y9G0 5.09e-27 108 34 5 213 3 hisG ATP phosphoribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B6YWA4 6.49e-27 107 38 4 183 3 hisG ATP phosphoribosyltransferase Thermococcus onnurineus (strain NA1)
Q6FLT7 1.04e-26 109 29 6 301 3 HIS1 ATP phosphoribosyltransferase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q03K77 1.33e-26 107 33 4 211 3 hisG ATP phosphoribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q2KTT7 1.59e-26 107 39 4 186 3 hisG ATP phosphoribosyltransferase Bordetella avium (strain 197N)
Q8DTQ6 2.54e-26 106 34 5 213 3 hisG ATP phosphoribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8U0D4 4.69e-26 105 35 6 208 3 hisG ATP phosphoribosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q1J0A0 6.4e-26 105 38 5 194 3 hisG ATP phosphoribosyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2S4L6 7.01e-26 106 27 5 289 3 hisG ATP phosphoribosyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q2G469 1.07e-25 104 34 4 201 3 hisG ATP phosphoribosyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q9RH04 2.42e-25 103 37 6 202 3 hisG ATP phosphoribosyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A4TB83 2.42e-25 105 30 6 285 3 hisG ATP phosphoribosyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
Q2RGV7 2.69e-25 103 35 5 198 3 hisG ATP phosphoribosyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B8DUC3 3.13e-25 105 28 7 292 3 hisG ATP phosphoribosyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
C1CVJ5 3.52e-25 103 35 5 196 3 hisG ATP phosphoribosyltransferase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q6BRU4 6.43e-25 104 29 4 300 3 HIS1 ATP phosphoribosyltransferase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A8AY29 6.79e-25 102 34 4 201 3 hisG ATP phosphoribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A3CNT5 7.08e-25 102 34 4 201 3 hisG ATP phosphoribosyltransferase Streptococcus sanguinis (strain SK36)
B8D111 7.15e-25 102 33 5 215 3 hisG ATP phosphoribosyltransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q8R881 7.16e-25 102 32 4 208 3 hisG ATP phosphoribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9RUE2 1.17e-24 102 36 5 190 3 hisG ATP phosphoribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A7GX39 1.19e-24 101 33 6 208 3 hisG ATP phosphoribosyltransferase Campylobacter curvus (strain 525.92)
A4X642 1.55e-24 103 29 6 291 3 hisG ATP phosphoribosyltransferase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A5N7Q5 1.58e-24 101 33 9 224 3 hisG ATP phosphoribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E166 1.58e-24 101 33 9 224 3 hisG ATP phosphoribosyltransferase Clostridium kluyveri (strain NBRC 12016)
B5YJ68 1.69e-24 103 29 7 294 3 hisG ATP phosphoribosyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
C6E7G0 2e-24 101 36 7 212 3 hisG ATP phosphoribosyltransferase Geobacter sp. (strain M21)
B5EDS0 2e-24 101 36 7 212 3 hisG ATP phosphoribosyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q7W2Y5 2.39e-24 101 38 5 184 3 hisG ATP phosphoribosyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WDY5 2.39e-24 101 38 5 184 3 hisG ATP phosphoribosyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VSZ2 2.57e-24 101 38 5 184 3 hisG ATP phosphoribosyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q3A132 2.69e-24 100 33 4 199 3 hisG ATP phosphoribosyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q67KH5 4.44e-24 100 36 4 175 3 hisG ATP phosphoribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A0PXP3 4.94e-24 100 32 7 224 3 hisG ATP phosphoribosyltransferase Clostridium novyi (strain NT)
B1XX72 4.96e-24 100 36 4 176 3 hisG ATP phosphoribosyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A9BJZ4 5.02e-24 100 36 6 184 3 hisG ATP phosphoribosyltransferase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q8GSJ1 6.67e-24 103 24 9 330 1 HISN1B ATP phosphoribosyltransferase 2, chloroplastic Arabidopsis thaliana
Q827L7 7.3e-24 101 30 9 298 3 hisG ATP phosphoribosyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q10S55 7.43e-24 103 25 10 325 3 Os03g0134300 ATP phosphoribosyltransferase, chloroplastic Oryza sativa subsp. japonica
Q21U97 9.12e-24 99 38 5 178 3 hisG ATP phosphoribosyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
C5CQI9 1.02e-23 99 35 6 210 3 hisG ATP phosphoribosyltransferase Variovorax paradoxus (strain S110)
Q49776 1.09e-23 100 28 6 291 3 hisG ATP phosphoribosyltransferase Mycobacterium leprae (strain TN)
B9MJR9 1.13e-23 99 34 6 220 3 hisG ATP phosphoribosyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q31BX4 1.81e-23 98 33 5 214 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9312)
C5A797 2.13e-23 98 38 7 192 3 hisG ATP phosphoribosyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q01ZU0 2.2e-23 100 26 5 293 3 hisG ATP phosphoribosyltransferase Solibacter usitatus (strain Ellin6076)
Q7VJU4 2.26e-23 98 31 6 204 3 hisG ATP phosphoribosyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q8F6P1 2.48e-23 98 35 5 210 3 hisG ATP phosphoribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62382 2.49e-23 98 35 5 210 3 hisG ATP phosphoribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B0K623 3.05e-23 98 30 5 221 3 hisG ATP phosphoribosyltransferase Thermoanaerobacter sp. (strain X514)
B0K733 3.05e-23 98 30 5 221 3 hisG ATP phosphoribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A2SE03 5.51e-23 97 38 6 179 3 hisG ATP phosphoribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
C1FN36 6.42e-23 97 32 7 225 3 hisG ATP phosphoribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A7FU76 6.42e-23 97 32 7 225 3 hisG ATP phosphoribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
A7GDQ1 6.83e-23 97 32 6 223 3 hisG ATP phosphoribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A0RQ26 7.28e-23 96 29 7 219 3 hisG ATP phosphoribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
B1ILA4 9.51e-23 96 32 7 225 3 hisG ATP phosphoribosyltransferase Clostridium botulinum (strain Okra / Type B1)
P60836 9.81e-23 96 36 5 186 3 hisG2 ATP phosphoribosyltransferase 2 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q39YP8 1e-22 96 37 6 187 3 hisG ATP phosphoribosyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8FP18 1.2e-22 96 33 5 206 3 hisG ATP phosphoribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q7P0F7 1.25e-22 96 37 6 187 3 hisG ATP phosphoribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5F7E0 1.3e-22 96 33 7 224 3 hisG ATP phosphoribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q24QI9 1.3e-22 96 31 6 232 3 hisG ATP phosphoribosyltransferase Desulfitobacterium hafniense (strain Y51)
Q47AL4 1.4e-22 96 33 6 209 3 hisG ATP phosphoribosyltransferase Dechloromonas aromatica (strain RCB)
A2BVM2 2.16e-22 95 34 5 195 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9515)
B7KGT7 2.48e-22 95 35 5 196 3 hisG ATP phosphoribosyltransferase Gloeothece citriformis (strain PCC 7424)
B0SM42 2.53e-22 95 35 2 174 3 hisG ATP phosphoribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDL3 2.53e-22 95 35 2 174 3 hisG ATP phosphoribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5P789 2.88e-22 95 35 7 222 3 hisG ATP phosphoribosyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0A6H9 3.14e-22 95 32 7 229 3 hisG ATP phosphoribosyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1BIW8 3.43e-22 97 26 5 294 3 hisG ATP phosphoribosyltransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A6TKT0 4.47e-22 94 32 6 217 3 hisG ATP phosphoribosyltransferase Alkaliphilus metalliredigens (strain QYMF)
A5D3N6 5.69e-22 96 26 8 303 3 hisG ATP phosphoribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1I190 5.92e-22 96 28 7 302 3 hisG ATP phosphoribosyltransferase Desulforudis audaxviator (strain MP104C)
Q2JL97 5.98e-22 95 37 3 170 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q1GRI4 6.2e-22 94 36 6 195 3 hisG ATP phosphoribosyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A1KV03 7.82e-22 94 33 7 224 3 hisG ATP phosphoribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P64347 7.82e-22 94 33 7 224 3 hisG ATP phosphoribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P64346 7.82e-22 94 33 7 224 3 hisG ATP phosphoribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q46WL1 7.95e-22 94 31 6 210 3 hisG ATP phosphoribosyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1K3M9 8.29e-22 94 35 7 222 3 hisG ATP phosphoribosyltransferase Azoarcus sp. (strain BH72)
Q8CK28 8.84e-22 95 29 8 294 3 hisG ATP phosphoribosyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q04ZI7 9.54e-22 94 34 4 210 3 hisG ATP phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04U38 9.54e-22 94 34 4 210 3 hisG ATP phosphoribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q3AD54 9.74e-22 94 34 5 198 3 hisG ATP phosphoribosyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1TKY3 9.85e-22 94 33 5 199 3 hisG ATP phosphoribosyltransferase Paracidovorax citrulli (strain AAC00-1)
B1WSL8 1.01e-21 94 34 4 197 3 hisG ATP phosphoribosyltransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
O67543 1.02e-21 94 35 5 191 3 hisG ATP phosphoribosyltransferase Aquifex aeolicus (strain VF5)
Q1AX11 1.06e-21 94 35 6 202 3 hisG ATP phosphoribosyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A7ZF95 1.15e-21 93 31 5 202 3 hisG ATP phosphoribosyltransferase Campylobacter concisus (strain 13826)
B8HQZ8 1.29e-21 93 39 2 147 3 hisG ATP phosphoribosyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q1LIA5 1.58e-21 93 31 6 209 3 hisG ATP phosphoribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B7JZB1 1.7e-21 93 34 5 198 3 hisG ATP phosphoribosyltransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
B7HHG0 1.85e-21 93 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain B4264)
Q0K686 2.11e-21 93 31 6 210 3 hisG ATP phosphoribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q39K92 2.15e-21 93 35 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B3R7A1 2.16e-21 93 31 6 210 3 hisG ATP phosphoribosyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A1W428 2.33e-21 93 34 7 196 3 hisG ATP phosphoribosyltransferase Acidovorax sp. (strain JS42)
B9MDV1 2.33e-21 93 34 7 196 3 hisG ATP phosphoribosyltransferase Acidovorax ebreus (strain TPSY)
Q81G07 2.39e-21 92 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1JU98 2.4e-21 93 35 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia orbicola (strain MC0-3)
A8G3S5 2.5e-21 92 32 5 214 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9215)
Q7V2C0 2.63e-21 92 33 5 195 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A5VA16 2.9e-21 92 35 6 195 3 hisG ATP phosphoribosyltransferase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B4S561 2.97e-21 94 25 5 297 3 hisG ATP phosphoribosyltransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q9S762 3.04e-21 96 24 10 330 1 HISN1A ATP phosphoribosyltransferase 1, chloroplastic Arabidopsis thaliana
P62366 3.12e-21 92 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
C3KVX0 3.36e-21 92 31 7 225 3 hisG ATP phosphoribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q18C67 3.94e-21 92 36 6 186 3 hisG ATP phosphoribosyltransferase Clostridioides difficile (strain 630)
Q845V4 3.98e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q1BS24 4.28e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia orbicola (strain AU 1054)
B4E634 4.28e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K3V1 4.28e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia cenocepacia (strain HI2424)
B8DQ42 4.42e-21 94 27 4 299 3 hisG ATP phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q0BIX1 4.51e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YRV4 4.51e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia ambifaria (strain MC40-6)
A4JAW2 4.69e-21 92 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B3WED6 4.72e-21 92 35 6 182 3 hisG ATP phosphoribosyltransferase Lacticaseibacillus casei (strain BL23)
A6T382 4.75e-21 92 34 5 190 3 hisG ATP phosphoribosyltransferase Janthinobacterium sp. (strain Marseille)
Q2SUA1 4.95e-21 92 35 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2YZB3 4.97e-21 92 34 8 218 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A2BQ41 4.97e-21 92 31 5 214 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain AS9601)
Q02129 5.26e-21 92 33 5 186 1 hisG ATP phosphoribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q5SM15 6.12e-21 91 33 6 192 3 hisG ATP phosphoribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62381 6.12e-21 91 33 6 192 1 hisG ATP phosphoribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8DMD9 6.29e-21 91 35 4 195 3 hisG ATP phosphoribosyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3AYI1 6.39e-21 92 35 4 176 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain CC9902)
A4G9J2 6.55e-21 92 32 5 208 3 hisG ATP phosphoribosyltransferase Herminiimonas arsenicoxydans
A6Q7C5 6.86e-21 91 29 7 223 3 hisG ATP phosphoribosyltransferase Sulfurovum sp. (strain NBC37-1)
B7IN98 7.12e-21 91 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain G9842)
B8I5U9 8.25e-21 91 33 8 212 3 hisG ATP phosphoribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q6GDC5 9.13e-21 91 34 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain MRSA252)
Q8KB10 9.83e-21 93 25 5 300 3 hisG ATP phosphoribosyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1AWP5 1.06e-20 90 34 6 207 3 hisG ATP phosphoribosyltransferase Ruthia magnifica subsp. Calyptogena magnifica
O34520 1.14e-20 91 32 6 226 1 hisG ATP phosphoribosyltransferase Bacillus subtilis (strain 168)
Q039B0 1.15e-20 91 34 6 182 3 hisG ATP phosphoribosyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q88UD9 1.25e-20 91 27 5 229 3 hisG ATP phosphoribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q63Q85 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia pseudomallei (strain K96243)
A3NEA0 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia pseudomallei (strain 668)
Q3JMZ5 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia pseudomallei (strain 1710b)
A3P034 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia pseudomallei (strain 1106a)
A1V8G8 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia mallei (strain SAVP1)
Q62GD8 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia mallei (strain ATCC 23344)
A2S747 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia mallei (strain NCTC 10229)
A3MPV1 1.25e-20 91 34 5 186 3 hisG ATP phosphoribosyltransferase Burkholderia mallei (strain NCTC 10247)
A1VK36 1.3e-20 91 36 6 179 3 hisG ATP phosphoribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
A8Z5H9 1.53e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FDI2 1.53e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain USA300)
A3DJF0 1.57e-20 90 33 6 180 3 hisG ATP phosphoribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q97KI3 1.75e-20 90 31 5 214 3 hisG ATP phosphoribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A3PBT4 1.85e-20 90 31 5 214 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9301)
Q63DX3 2.05e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain ZK / E33L)
C1EMQ2 2.05e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain 03BB102)
Q81T63 2.05e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus anthracis
C3L9Q2 2.05e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P501 2.05e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus anthracis (strain A0248)
B4SCC0 2.11e-20 92 24 4 286 3 hisG ATP phosphoribosyltransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q6HLE8 2.23e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JFZ0 2.23e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain AH820)
P64350 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain MW2)
Q6G5Z6 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain MSSA476)
P64349 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain N315)
P64348 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QKG7 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain Newman)
Q5HCL8 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain COL)
A5IWA6 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain JH9)
Q2FUT7 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U564 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain JH1)
A7X770 2.24e-20 90 35 8 215 3 hisG ATP phosphoribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q46GM0 2.61e-20 90 34 3 167 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain NATL2A)
A2C117 2.61e-20 90 34 3 167 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain NATL1A)
B9IUZ5 2.91e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain Q1)
B7HKC9 2.91e-20 90 29 4 207 3 hisG ATP phosphoribosyltransferase Bacillus cereus (strain AH187)
Q2YAU4 3.31e-20 90 34 7 222 3 hisG ATP phosphoribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0AW37 3.41e-20 90 31 3 206 3 hisG ATP phosphoribosyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A9KNX6 3.55e-20 89 30 8 219 3 hisG ATP phosphoribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A6Q469 4.19e-20 89 32 6 209 3 hisG ATP phosphoribosyltransferase Nitratiruptor sp. (strain SB155-2)
B1XPZ8 5.01e-20 89 33 6 212 3 hisG ATP phosphoribosyltransferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3B6A2 5.31e-20 90 24 4 286 3 hisG ATP phosphoribosyltransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8ESR7 6.88e-20 89 30 7 218 3 hisG ATP phosphoribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1H4R9 7.42e-20 89 33 5 207 3 hisG ATP phosphoribosyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A9VLH2 7.72e-20 89 31 4 180 3 hisG ATP phosphoribosyltransferase Bacillus mycoides (strain KBAB4)
B0C9G3 8.57e-20 89 34 5 200 3 hisG ATP phosphoribosyltransferase Acaryochloris marina (strain MBIC 11017)
A4XL26 9.86e-20 88 35 6 194 3 hisG ATP phosphoribosyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q7M9N0 1.17e-19 88 29 5 201 3 hisG ATP phosphoribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q5JFR6 1.18e-19 88 34 6 192 3 hisG ATP phosphoribosyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q7NFZ1 1.23e-19 88 40 3 147 3 hisG ATP phosphoribosyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9K6Z1 2e-19 87 32 9 225 3 hisG ATP phosphoribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A2RKS3 2.1e-19 87 31 4 207 3 hisG ATP phosphoribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
A8FHR4 2.13e-19 87 31 6 217 3 hisG ATP phosphoribosyltransferase Bacillus pumilus (strain SAFR-032)
Q987S8 2.36e-19 88 30 10 236 3 hisG ATP phosphoribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3AU36 2.73e-19 89 23 4 286 3 hisG ATP phosphoribosyltransferase Chlorobium chlorochromatii (strain CaD3)
Q8YVL0 2.86e-19 87 31 6 224 3 hisG ATP phosphoribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B8FLE8 3.24e-19 89 27 4 253 3 hisG ATP phosphoribosyltransferase Desulfatibacillum aliphaticivorans
A1AT72 5.71e-19 88 25 4 293 3 hisG ATP phosphoribosyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q2RQM6 7.2e-19 86 33 5 189 3 hisG ATP phosphoribosyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3SHP3 7.87e-19 86 34 5 191 3 hisG ATP phosphoribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q8CTV1 8.43e-19 85 32 4 173 3 hisG ATP phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A4ISR7 8.45e-19 85 33 7 220 3 hisG ATP phosphoribosyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q5N426 8.53e-19 86 33 9 234 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31Q54 8.53e-19 86 33 9 234 3 hisG ATP phosphoribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B0JK88 9.55e-19 85 34 5 196 3 hisG ATP phosphoribosyltransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q55503 9.85e-19 85 37 2 147 3 hisG ATP phosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2IY34 1.02e-18 85 36 2 147 3 hisG ATP phosphoribosyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B5YE84 1.08e-18 85 32 4 193 3 hisG ATP phosphoribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A4SCX0 1.15e-18 87 24 5 294 3 hisG ATP phosphoribosyltransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B1HVP7 1.2e-18 85 30 6 229 3 hisG ATP phosphoribosyltransferase Lysinibacillus sphaericus (strain C3-41)
Q3M4Z2 1.27e-18 85 36 2 147 3 hisG ATP phosphoribosyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A7GMU5 1.34e-18 85 29 5 209 3 hisG ATP phosphoribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2SBJ5 1.54e-18 85 34 8 214 3 hisG ATP phosphoribosyltransferase Hahella chejuensis (strain KCTC 2396)
Q5HKN7 1.67e-18 85 32 3 173 3 hisG ATP phosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q606Q1 2.01e-18 85 31 7 226 3 hisG ATP phosphoribosyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B8E2C2 2.34e-18 84 32 6 215 3 hisG ATP phosphoribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
C4Z0B1 2.73e-18 84 30 7 226 3 hisG ATP phosphoribosyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A5CWJ0 2.87e-18 84 34 6 194 3 hisG ATP phosphoribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A7Z967 2.93e-18 84 31 5 218 3 hisG ATP phosphoribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3QR09 3.42e-18 85 25 4 286 3 hisG ATP phosphoribosyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B4U858 3.82e-18 84 33 7 196 3 hisG ATP phosphoribosyltransferase Hydrogenobaculum sp. (strain Y04AAS1)
A9BEI4 5.28e-18 84 31 5 195 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9211)
Q5FS84 5.39e-18 84 32 4 197 3 hisG ATP phosphoribosyltransferase Gluconobacter oxydans (strain 621H)
Q4ZNV8 7.03e-18 83 33 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q87WV4 7.25e-18 83 33 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6VBC2 7.63e-18 83 33 7 213 3 hisG ATP phosphoribosyltransferase Pseudomonas aeruginosa (strain PA7)
B5EQE6 7.77e-18 83 33 5 186 3 hisG ATP phosphoribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JA13 7.77e-18 83 33 5 186 3 hisG ATP phosphoribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q0VS39 7.93e-18 83 30 5 218 3 hisG ATP phosphoribosyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q6FEC9 8.47e-18 83 30 6 221 3 hisG ATP phosphoribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B9DQ89 8.9e-18 83 32 6 194 3 hisG ATP phosphoribosyltransferase Staphylococcus carnosus (strain TM300)
Q5WDH7 9.63e-18 83 29 5 211 3 hisG ATP phosphoribosyltransferase Shouchella clausii (strain KSM-K16)
Q65EF8 1.03e-17 83 30 5 224 3 hisG ATP phosphoribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q82W27 1.25e-17 82 34 5 194 3 hisG ATP phosphoribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7U5Z9 1.31e-17 82 36 3 147 3 hisG ATP phosphoribosyltransferase Parasynechococcus marenigrum (strain WH8102)
C5D7P3 1.52e-17 82 32 7 219 3 hisG ATP phosphoribosyltransferase Geobacillus sp. (strain WCH70)
Q7V6G9 1.58e-17 82 36 3 147 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain MIT 9313)
Q02GZ2 1.63e-17 82 33 7 213 3 hisG ATP phosphoribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3AL07 1.75e-17 82 36 3 147 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain CC9605)
Q48EC8 2e-17 82 33 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C1DQ66 2.06e-17 82 34 7 214 3 hisG ATP phosphoribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4XQN5 2.53e-17 82 32 6 222 3 hisG ATP phosphoribosyltransferase Pseudomonas mendocina (strain ymp)
C4XTP0 2.56e-17 83 25 5 301 3 hisG ATP phosphoribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q3KHZ3 2.74e-17 82 33 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q4A043 4e-17 81 35 3 162 3 hisG ATP phosphoribosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7VD22 4.58e-17 81 36 3 147 3 hisG ATP phosphoribosyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A5GJK6 9.45e-17 80 34 4 167 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain WH7803)
P62364 1.13e-16 81 24 4 296 3 hisG ATP phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q30S64 1.16e-16 80 29 9 225 3 hisG ATP phosphoribosyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5KVC5 1.29e-16 80 34 5 193 3 hisG ATP phosphoribosyltransferase Geobacillus kaustophilus (strain HTA426)
A1VHE4 1.47e-16 81 24 4 296 3 hisG ATP phosphoribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
B9K9R7 1.6e-16 79 33 7 184 3 hisG ATP phosphoribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q2IMV6 2.37e-16 79 34 7 182 3 hisG ATP phosphoribosyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q9HVW8 2.64e-16 79 33 7 213 3 hisG ATP phosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UZY8 2.64e-16 79 33 7 213 3 hisG ATP phosphoribosyltransferase Pseudomonas aeruginosa (strain LESB58)
B4UAY5 2.68e-16 79 34 7 182 3 hisG ATP phosphoribosyltransferase Anaeromyxobacter sp. (strain K)
B8JAT9 2.68e-16 79 34 7 182 3 hisG ATP phosphoribosyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q4KI74 2.72e-16 79 32 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5GS82 5.89e-16 78 35 2 147 3 hisG ATP phosphoribosyltransferase Synechococcus sp. (strain RCC307)
A1U458 6.31e-16 78 30 7 221 3 hisG ATP phosphoribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0AGS2 7.46e-16 78 33 6 195 3 hisG ATP phosphoribosyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
C3K8X5 9.57e-16 77 34 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas fluorescens (strain SBW25)
Q31GZ0 1.02e-15 77 33 5 209 3 hisG ATP phosphoribosyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A5VZ55 1.06e-15 77 32 7 228 3 hisG ATP phosphoribosyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A9GD69 1.33e-15 77 31 5 193 3 hisG ATP phosphoribosyltransferase Sorangium cellulosum (strain So ce56)
Q88P87 1.49e-15 77 33 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KQJ4 1.86e-15 77 32 7 228 3 hisG ATP phosphoribosyltransferase Pseudomonas putida (strain GB-1)
Q11LA2 1.88e-15 77 31 8 225 3 hisG ATP phosphoribosyltransferase Chelativorans sp. (strain BNC1)
Q1QVE4 2.16e-15 76 30 7 208 3 hisG ATP phosphoribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B7GL41 2.22e-15 76 34 7 187 3 hisG ATP phosphoribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A5INE0 2.63e-15 76 32 6 183 3 hisG ATP phosphoribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A7HI48 2.72e-15 76 29 8 224 3 hisG ATP phosphoribosyltransferase Anaeromyxobacter sp. (strain Fw109-5)
B3E177 3.15e-15 77 26 9 303 3 hisG ATP phosphoribosyltransferase Methylacidiphilum infernorum (isolate V4)
B1L867 3.88e-15 75 32 5 183 3 hisG ATP phosphoribosyltransferase Thermotoga sp. (strain RQ2)
Q9X0D2 3.88e-15 75 32 5 183 1 hisG ATP phosphoribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A4Z0T3 4.4e-15 77 28 9 244 3 hisG ATP phosphoribosyltransferase Bradyrhizobium sp. (strain ORS 278)
Q21FV3 7.6e-15 75 31 8 227 3 hisG ATP phosphoribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B1JBC2 7.78e-15 75 32 7 228 3 hisG ATP phosphoribosyltransferase Pseudomonas putida (strain W619)
P60804 8.69e-15 76 23 3 285 3 hisG1 ATP phosphoribosyltransferase 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
C5BSW3 9e-15 75 30 8 226 3 hisG ATP phosphoribosyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1IE99 1.13e-14 74 32 6 213 3 hisG ATP phosphoribosyltransferase Pseudomonas entomophila (strain L48)
A6VY00 1.9e-14 74 33 7 187 3 hisG ATP phosphoribosyltransferase Marinomonas sp. (strain MWYL1)
Q3SPH2 2.08e-14 75 26 9 246 3 hisG ATP phosphoribosyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B3E6L6 2.17e-14 75 23 5 293 3 hisG ATP phosphoribosyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A1WYW5 2.25e-14 73 34 5 185 3 hisG ATP phosphoribosyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q8YB47 2.44e-14 74 32 8 209 3 hisG ATP phosphoribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q4FQF7 2.72e-14 73 32 6 179 1 hisG ATP phosphoribosyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A6X3C3 3.52e-14 73 31 10 229 3 hisG ATP phosphoribosyltransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
C0RKC9 3.7e-14 73 32 8 209 3 hisG ATP phosphoribosyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01115
Feature type CDS
Gene hisG
Product ATP phosphoribosyltransferase
Location 235736 - 236635 (strand: -1)
Length 900 (nucleotides) / 299 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1199
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01634 ATP phosphoribosyltransferase
PF08029 HisG, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0040 Amino acid transport and metabolism (E) E ATP phosphoribosyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MLDKSRLRIAIQKSGRLSEDSRELLSRCGIKINLQQQRLIAFAENMPIDILRVRDDDIPGLVMDGVVDLGIIGENVLEEELLSRQAQGQNPRYFTLRRLDFGTCRLALAAPVDFNYSGVECLQDSRIATSYPFLLKRYLDQKGIPFKSCLLNGSVEVAPRAGLADAICDLVSTGATLEANGLREVEVIYRSKACLIQRDGKMAEEKQQLIDKMMTRICGVIQARESKYIMMHAPANRLDDVIALLPGAERPTLLPLAGEPDLLAMHMVSSETLFWETMEKLKALGCSSILVLPIEKMME

Flanking regions ( +/- flanking 50bp)

CCGGGGGTTTTTTTATACCCGGAGAATAATAAAATTAAAGGATAATCAAAATGTTAGATAAATCGCGCTTACGGATAGCCATTCAGAAGTCAGGTCGTTTAAGTGAAGATTCCCGCGAGTTGCTGTCACGCTGCGGCATAAAAATTAATTTACAACAGCAGCGCCTGATAGCTTTCGCCGAAAATATGCCAATCGATATTCTGCGTGTCCGCGATGACGATATCCCGGGACTGGTGATGGATGGTGTGGTTGATCTCGGTATTATCGGGGAAAACGTACTGGAAGAGGAATTATTAAGCCGTCAGGCTCAGGGACAAAACCCGCGCTATTTCACACTGCGCCGCCTGGACTTCGGCACCTGCCGCCTTGCTCTCGCCGCACCTGTGGATTTTAATTACAGCGGCGTTGAATGTCTTCAGGACAGCCGCATCGCAACCTCTTACCCGTTCCTGCTCAAGCGCTATTTAGACCAGAAAGGCATTCCTTTCAAATCCTGCCTGCTGAACGGCTCTGTGGAAGTTGCCCCGCGCGCCGGGCTGGCTGATGCCATCTGTGATCTGGTTTCCACCGGTGCCACACTCGAAGCAAACGGACTGCGCGAAGTGGAAGTGATTTACCGCTCCAAAGCCTGTCTTATCCAGCGAGACGGCAAAATGGCAGAAGAAAAACAACAGCTTATCGACAAGATGATGACCCGTATCTGCGGCGTTATTCAGGCGCGTGAGTCCAAATACATCATGATGCACGCCCCGGCGAACCGCCTGGATGATGTGATAGCTCTGCTGCCGGGAGCTGAGCGCCCGACCCTGCTGCCGCTCGCCGGAGAGCCGGATCTGCTGGCAATGCACATGGTCAGCAGTGAAACCCTGTTCTGGGAAACCATGGAGAAACTGAAAGCACTCGGGTGCAGCTCCATTCTGGTTCTGCCGATTGAAAAAATGATGGAGTGACACTGATGCCCGCAACTATCTTTAATACCCTGATCCGCTGGGAAGAACTG