Homologs in group_1527

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09550 FBDBKF_09550 89.7 Morganella morganii S1 lptB LPS export ABC transporter ATP-binding protein
EHELCC_04350 EHELCC_04350 89.7 Morganella morganii S2 lptB LPS export ABC transporter ATP-binding protein
NLDBIP_04350 NLDBIP_04350 89.7 Morganella morganii S4 lptB LPS export ABC transporter ATP-binding protein
LHKJJB_14280 LHKJJB_14280 89.7 Morganella morganii S3 lptB LPS export ABC transporter ATP-binding protein
HKOGLL_12255 HKOGLL_12255 89.7 Morganella morganii S5 lptB LPS export ABC transporter ATP-binding protein
PMI_RS03040 PMI_RS03040 73.8 Proteus mirabilis HI4320 - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_1527

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1527

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9U2 0.0 833 70 0 578 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 0.0 833 70 0 578 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P37624 1.87e-63 227 41 3 294 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 7.2e-36 147 34 7 269 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 2.74e-33 139 28 4 263 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 4.63e-32 135 35 3 215 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P94440 6.64e-46 167 36 1 226 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 2.79e-34 135 27 2 290 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q1BWI2 4.16e-44 162 37 2 236 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 2.95e-35 137 36 2 226 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q39GT7 6.67e-43 159 36 3 245 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.81e-37 144 37 2 231 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P32010 2.5e-42 158 35 1 225 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
P32010 4.47e-35 138 35 3 254 1 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA Streptomyces peucetius
Q8KLG1 4.79e-42 157 36 1 220 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 6.13e-35 137 32 5 296 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P55476 5.48e-42 157 36 1 221 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 6.32e-38 146 37 4 230 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8XXY9 5.93e-42 157 34 1 229 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 1.06e-34 137 35 2 220 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1LKJ2 1.21e-41 155 34 1 219 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 5.9e-35 137 37 3 211 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P72335 3.21e-41 154 36 1 222 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 4.67e-38 145 33 6 314 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q3JSQ0 3.89e-41 154 36 3 235 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 1.33e-35 139 37 2 226 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 3.89e-41 154 36 3 235 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 1.33e-35 139 37 2 226 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 4.01e-41 154 36 3 235 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 1.51e-35 138 37 2 226 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
O52618 4.47e-41 154 37 1 227 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 1.26e-37 145 33 6 313 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q8GNH6 1.24e-40 153 34 3 259 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 5.13e-38 146 32 5 308 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
P26050 1.38e-40 152 37 1 218 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26050 1.48e-35 139 36 2 231 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P50332 1.39e-40 154 35 2 238 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 1.38e-31 129 36 4 231 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q8TQ05 1.45e-40 159 27 19 572 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P42332 9.06e-40 150 33 9 307 3 bcrA Bacitracin transport ATP-binding protein BcrA Bacillus licheniformis
P42332 4.71e-38 145 31 4 257 3 bcrA Bacitracin transport ATP-binding protein BcrA Bacillus licheniformis
Q2SVP3 2.93e-39 149 35 2 236 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 5.57e-37 142 38 2 226 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6YRJ4 6.1e-39 154 25 14 565 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
P23703 7.96e-39 149 35 3 230 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 9.28e-35 137 34 2 228 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P36879 1.86e-38 147 36 2 226 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
P36879 1.28e-29 122 32 2 237 1 yadG Uncharacterized ABC transporter ATP-binding protein YadG Escherichia coli (strain K12)
Q13ZJ1 4.76e-38 145 35 3 253 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 1.46e-33 133 37 4 232 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q832R5 7.48e-38 150 26 18 560 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 6.34e-12 72 28 9 231 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q9Z3I3 8.4e-38 145 37 2 218 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q9Z3I3 7.14e-33 131 35 3 231 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
O07016 1.38e-37 144 31 8 305 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 1.18e-32 130 34 5 235 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
P54592 8.1e-37 142 36 4 214 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
P54592 1.98e-25 110 33 6 241 3 yhcH Uncharacterized ABC transporter ATP-binding protein YhcH Bacillus subtilis (strain 168)
P08720 1.32e-36 142 34 1 218 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 1.89e-35 138 32 5 305 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q1M7W6 1.42e-36 141 34 1 218 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.96e-35 138 32 5 305 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q46YX6 5.93e-36 140 32 1 242 3 nodI Nod factor export ATP-binding protein I Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46YX6 1.6e-27 116 34 4 227 3 nodI Nod factor export ATP-binding protein I Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P9WQL9 5.25e-35 137 35 0 204 1 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL9 1.14e-34 137 34 1 221 1 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL8 5.25e-35 137 35 0 204 3 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQL8 1.14e-34 137 34 1 221 3 drrA Doxorubicin resistance ATP-binding protein DrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5WNX0 6.68e-35 137 34 3 214 2 bcrA Bacitracin transport ATP-binding protein BcrA Enterococcus faecalis
Q5WNX0 3.69e-25 109 29 8 303 2 bcrA Bacitracin transport ATP-binding protein BcrA Enterococcus faecalis
P78363 1.24e-34 144 39 2 217 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 1.96e-32 137 36 1 220 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 1.55e-29 128 36 4 208 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
P78363 7.74e-23 107 31 1 210 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Homo sapiens
Q8T674 3.91e-34 141 35 0 208 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
Q8T674 2.92e-31 132 30 2 242 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
Q5SSE9 1.38e-33 140 39 4 223 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 1.37e-25 116 33 3 214 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 6.55e-24 110 32 4 224 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
Q5SSE9 6.63e-21 101 32 3 215 1 Abca13 ATP-binding cassette sub-family A member 13 Mus musculus
O35600 1.84e-33 140 37 3 231 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 4.17e-31 133 36 1 220 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 1.01e-28 125 34 2 205 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
O35600 9.54e-24 110 34 3 206 1 Abca4 Retinal-specific phospholipid-transporting ATPase ABCA4 Mus musculus
Q9STT8 3.44e-33 139 37 4 200 3 ABCA4 ABC transporter A family member 4 Arabidopsis thaliana
Q9STT8 4.43e-31 132 34 7 260 3 ABCA4 ABC transporter A family member 4 Arabidopsis thaliana
Q67JX4 4.39e-33 131 36 6 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67JX4 5.6e-20 94 34 6 213 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
F1MWM0 5.68e-33 139 36 3 231 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 3.01e-31 133 36 1 220 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 3.64e-29 127 34 3 217 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
F1MWM0 8.56e-24 110 32 1 210 1 ABCA4 Retinal-specific phospholipid-transporting ATPase ABCA4 Bos taurus
Q55EH8 5.79e-33 137 32 4 224 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
Q55EH8 1.96e-30 130 28 5 264 3 abcG23 ABC transporter G family member 23 Dictyostelium discoideum
O86311 8.92e-33 131 33 3 219 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O86311 3.55e-24 106 33 5 223 1 Rv1218c Multidrug efflux system ATP-binding protein Rv1218c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P42246 1.16e-32 130 33 3 212 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 1.74e-30 124 29 8 306 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
O34362 2.56e-32 134 26 17 562 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 2.68e-14 79 29 6 210 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q54DT1 3.99e-32 135 34 2 214 3 abcA9 ABC transporter A family member 9 Dictyostelium discoideum
Q54DT1 4.08e-30 129 31 2 224 3 abcA9 ABC transporter A family member 9 Dictyostelium discoideum
Q9STT7 5.49e-32 135 36 6 242 3 ABCA5 ABC transporter A family member 5 Arabidopsis thaliana
Q9STT7 2.33e-31 133 36 4 203 3 ABCA5 ABC transporter A family member 5 Arabidopsis thaliana
Q81CT8 6.09e-32 133 25 15 536 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 5.26e-12 72 28 7 215 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P45073 6.37e-32 126 33 3 223 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45073 2.89e-28 116 31 4 218 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P56344 1.11e-31 125 32 4 241 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P56344 3.62e-30 121 32 5 227 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q9A7X1 1.38e-31 128 33 6 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A7X1 7.39e-26 112 33 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9STT5 1.4e-31 134 34 7 260 3 ABCA7 ABC transporter A family member 7 Arabidopsis thaliana
Q9STT5 2.47e-30 130 34 4 210 3 ABCA7 ABC transporter A family member 7 Arabidopsis thaliana
Q1PEH6 1.49e-31 134 34 7 261 2 ABCA3 ABC transporter A family member 3 Arabidopsis thaliana
Q1PEH6 8.76e-30 128 34 4 202 2 ABCA3 ABC transporter A family member 3 Arabidopsis thaliana
Q8T6J0 1.84e-31 133 35 2 214 3 abcA7 ABC transporter A family member 7 Dictyostelium discoideum
Q8T6J0 3.5e-30 129 32 4 238 3 abcA7 ABC transporter A family member 7 Dictyostelium discoideum
Q9FLT4 2.05e-31 133 36 4 199 1 ABCA10 ABC transporter A family member 10 Arabidopsis thaliana
Q9FLT4 2.25e-28 124 35 6 234 1 ABCA10 ABC transporter A family member 10 Arabidopsis thaliana
P46903 2.78e-31 125 30 3 220 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
P46903 3.19e-31 125 31 3 226 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
Q8T5Z7 2.79e-31 133 31 4 243 2 abcA1 ABC transporter A family member 1 Dictyostelium discoideum
Q8T5Z7 4.77e-24 110 31 2 206 2 abcA1 ABC transporter A family member 1 Dictyostelium discoideum
Q8Z0H0 2.85e-31 127 33 5 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 4.71e-29 121 31 5 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q86UQ4 3.23e-31 133 37 6 240 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q86UQ4 6.81e-28 123 33 3 215 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q86UQ4 1.16e-27 122 34 5 231 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q86UQ4 7.11e-22 104 32 3 215 1 ABCA13 ATP-binding cassette sub-family A member 13 Homo sapiens
Q8T6J2 3.37e-31 133 35 4 228 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q8T6J2 1.85e-26 118 33 6 241 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q8T6J2 1.41e-22 106 31 1 219 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q8T6J2 4.62e-17 89 27 2 198 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q8LPK0 3.5e-31 132 33 5 263 2 ABCA8 ABC transporter A family member 8 Arabidopsis thaliana
Q8LPK0 6.53e-29 125 34 3 198 2 ABCA8 ABC transporter A family member 8 Arabidopsis thaliana
P0C0E2 3.91e-31 124 31 3 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 9.88e-25 106 32 4 197 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 3.91e-31 124 31 3 206 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 9.88e-25 106 32 4 197 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P94374 5.27e-31 125 37 3 202 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
P94374 3.88e-29 120 34 3 209 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q91V24 5.99e-31 132 35 1 221 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q91V24 6.09e-30 129 36 2 217 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q91V24 7.69e-27 120 32 1 205 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q91V24 2.45e-24 112 31 6 249 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
Q8IZY2 6.49e-31 132 34 1 239 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q8IZY2 1.62e-30 131 38 2 217 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q8IZY2 6.78e-27 120 30 1 227 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q8IZY2 4.06e-24 111 31 3 217 1 ABCA7 Phospholipid-transporting ATPase ABCA7 Homo sapiens
Q63H29 7.27e-31 126 36 6 223 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q63H29 1.65e-20 96 30 5 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q8G838 7.74e-31 131 26 17 544 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.02e-18 94 29 4 225 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.45e-13 77 28 2 213 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8DIA0 8.01e-31 126 34 4 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8DIA0 4.32e-29 121 32 5 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q63TY1 9.53e-31 126 31 7 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q63TY1 1.73e-25 111 34 7 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q62K82 1e-30 126 31 7 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q62K82 1.71e-25 111 34 7 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q7TNJ2 1.21e-30 131 34 2 237 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q7TNJ2 1.01e-28 125 35 2 217 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q7TNJ2 3.58e-28 124 32 1 206 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q7TNJ2 6.39e-26 117 30 5 249 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
P14788 1.47e-30 125 34 4 226 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14788 5.29e-28 118 31 3 219 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
C0SPB4 1.98e-30 124 29 2 216 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
C0SPB4 5.97e-27 114 26 7 305 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q81VM2 2.43e-30 125 36 6 219 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q81VM2 1.76e-20 96 30 5 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q84M24 2.81e-30 130 33 5 243 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q84M24 5.81e-30 129 33 2 219 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q84M24 9.1e-27 119 35 2 209 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q84M24 4.95e-25 114 36 1 188 2 ABCA1 ABC transporter A family member 1 Arabidopsis thaliana
Q9BZC7 3.25e-30 130 36 3 222 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q9BZC7 2.48e-28 124 34 1 206 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q9BZC7 3.34e-28 124 32 3 227 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
Q9BZC7 3.88e-27 120 32 1 213 1 ABCA2 ATP-binding cassette sub-family A member 2 Homo sapiens
P41234 3.37e-30 130 33 3 240 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P41234 6.79e-30 129 35 1 206 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P41234 2.84e-27 121 33 1 213 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P41234 3.84e-27 120 32 2 207 1 Abca2 ATP-binding cassette sub-family A member 2 Mus musculus
P96605 3.52e-30 124 31 3 215 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
P96605 1.67e-23 104 30 6 239 3 ydbJ Uncharacterized ABC transporter ATP-binding protein YdbJ Bacillus subtilis (strain 168)
Q8CF82 3.54e-30 130 33 5 211 2 Abca5 Cholesterol transporter ABCA5 Rattus norvegicus
Q8CF82 4.59e-28 123 33 4 217 2 Abca5 Cholesterol transporter ABCA5 Rattus norvegicus
Q8CF82 3.77e-25 114 33 4 215 2 Abca5 Cholesterol transporter ABCA5 Rattus norvegicus
Q8CF82 1.21e-20 100 32 3 215 2 Abca5 Cholesterol transporter ABCA5 Rattus norvegicus
Q8K440 3.56e-30 130 35 4 214 1 Abca8b ABC-type organic anion transporter ABCA8B Mus musculus
Q8K440 6.08e-26 117 32 4 216 1 Abca8b ABC-type organic anion transporter ABCA8B Mus musculus
Q8K440 8.74e-23 107 33 5 218 1 Abca8b ABC-type organic anion transporter ABCA8B Mus musculus
Q8K440 9.86e-16 84 25 8 270 1 Abca8b ABC-type organic anion transporter ABCA8B Mus musculus
Q9ESR9 4.53e-30 130 33 3 240 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 3.44e-29 127 35 1 206 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 6.02e-28 123 33 2 207 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
Q9ESR9 2.74e-27 121 33 1 213 1 Abca2 ATP-binding cassette sub-family A member 2 Rattus norvegicus
P34358 5.88e-30 129 36 3 208 1 ced-7 ABC transporter ced-7 Caenorhabditis elegans
P34358 2.26e-27 121 33 5 244 1 ced-7 ABC transporter ced-7 Caenorhabditis elegans
P34358 2.61e-25 115 31 7 244 1 ced-7 ABC transporter ced-7 Caenorhabditis elegans
P34358 2.81e-21 102 30 8 245 1 ced-7 ABC transporter ced-7 Caenorhabditis elegans
Q0SFW6 8.13e-30 123 34 5 220 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q0SFW6 1.11e-19 94 31 3 204 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q8K448 8.69e-30 129 33 5 211 1 Abca5 Cholesterol transporter ABCA5 Mus musculus
Q8K448 2.59e-28 124 33 4 217 1 Abca5 Cholesterol transporter ABCA5 Mus musculus
Q8K448 5e-25 114 33 4 215 1 Abca5 Cholesterol transporter ABCA5 Mus musculus
Q8K448 1.17e-20 100 31 3 218 1 Abca5 Cholesterol transporter ABCA5 Mus musculus
Q9STT6 1.02e-29 128 35 4 202 3 ABCA6 ABC transporter A family member 6 Arabidopsis thaliana
Q9STT6 2.96e-29 127 34 5 246 3 ABCA6 ABC transporter A family member 6 Arabidopsis thaliana
Q58429 1.08e-29 121 30 2 217 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 3.82e-28 116 29 2 229 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8WWZ7 1.19e-29 128 30 3 223 1 ABCA5 Cholesterol transporter ABCA5 Homo sapiens
Q8WWZ7 4.24e-28 124 32 4 217 1 ABCA5 Cholesterol transporter ABCA5 Homo sapiens
Q8WWZ7 6.74e-26 117 33 4 215 1 ABCA5 Cholesterol transporter ABCA5 Homo sapiens
Q8WWZ7 4.3e-20 98 31 3 215 1 ABCA5 Cholesterol transporter ABCA5 Homo sapiens
P41233 1.25e-29 128 35 3 207 1 Abca1 Phospholipid-transporting ATPase ABCA1 Mus musculus
P41233 3.16e-25 115 36 4 204 1 Abca1 Phospholipid-transporting ATPase ABCA1 Mus musculus
P41233 7.73e-23 107 31 1 207 1 Abca1 Phospholipid-transporting ATPase ABCA1 Mus musculus
P41233 4.98e-22 105 32 1 205 1 Abca1 Phospholipid-transporting ATPase ABCA1 Mus musculus
Q86UK0 1.37e-29 128 32 3 231 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q86UK0 1.54e-29 128 34 5 263 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q86UK0 1.05e-26 119 33 3 214 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q86UK0 1.15e-24 113 32 5 239 1 ABCA12 Glucosylceramide transporter ABCA12 Homo sapiens
Q8R420 1.39e-29 128 33 1 206 1 Abca3 Phospholipid-transporting ATPase ABCA3 Mus musculus
Q8R420 9.99e-29 125 35 3 231 1 Abca3 Phospholipid-transporting ATPase ABCA3 Mus musculus
Q8R420 2.43e-26 118 35 3 203 1 Abca3 Phospholipid-transporting ATPase ABCA3 Mus musculus
Q8R420 6.55e-25 114 35 2 191 1 Abca3 Phospholipid-transporting ATPase ABCA3 Mus musculus
Q8WWZ4 1.53e-29 128 39 3 189 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
Q8WWZ4 2.14e-27 121 30 5 256 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
Q8WWZ4 3.28e-24 111 32 5 229 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
Q8WWZ4 5.25e-23 107 31 5 237 2 ABCA10 ATP-binding cassette sub-family A member 10 Homo sapiens
Q73F11 1.57e-29 122 35 6 219 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73F11 1.67e-18 90 30 7 259 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q87DT9 1.63e-29 122 32 7 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87DT9 6.36e-22 100 32 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7NIW1 1.92e-29 122 33 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7NIW1 3.79e-26 113 29 4 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A0A0G2K1Q8 2.18e-29 127 33 1 206 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
A0A0G2K1Q8 1.04e-28 125 33 2 237 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
A0A0G2K1Q8 1.91e-27 121 36 3 203 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
A0A0G2K1Q8 1.4e-25 115 36 2 191 1 Abca3 Phospholipid-transporting ATPase ABCA3 Rattus norvegicus
O94911 2.22e-29 127 34 4 214 1 ABCA8 ABC-type organic anion transporter ABCA8 Homo sapiens
O94911 1.16e-27 122 35 4 215 1 ABCA8 ABC-type organic anion transporter ABCA8 Homo sapiens
O94911 4.32e-23 108 32 5 219 1 ABCA8 ABC-type organic anion transporter ABCA8 Homo sapiens
O94911 1.33e-18 94 26 9 294 1 ABCA8 ABC-type organic anion transporter ABCA8 Homo sapiens
Q132E8 2.23e-29 120 34 8 243 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q132E8 1.06e-17 87 30 7 229 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
Q897I2 2.62e-29 124 23 11 458 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 8.59e-16 83 27 7 206 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q8IUA7 3.04e-29 127 34 4 214 1 ABCA9 ATP-binding cassette sub-family A member 9 Homo sapiens
Q8IUA7 8.16e-27 119 37 3 189 1 ABCA9 ATP-binding cassette sub-family A member 9 Homo sapiens
Q8IUA7 2.99e-23 108 32 5 219 1 ABCA9 ATP-binding cassette sub-family A member 9 Homo sapiens
Q8IUA7 1.78e-21 103 29 6 245 1 ABCA9 ATP-binding cassette sub-family A member 9 Homo sapiens
Q92G36 3.57e-29 119 32 7 222 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q92G36 1.97e-23 102 27 7 252 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
E9Q876 4.52e-29 127 34 5 263 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
E9Q876 6.21e-28 123 33 2 207 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
E9Q876 1.22e-26 119 33 3 214 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
E9Q876 1.36e-23 110 31 4 225 1 Abca12 Glucosylceramide transporter ABCA12 Mus musculus
Q8ZPK4 4.86e-29 122 33 6 236 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZPK4 3.46e-22 102 30 6 230 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q81IZ6 5.21e-29 121 35 6 223 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81IZ6 3.55e-22 101 30 5 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P9WQL6 5.51e-29 120 36 3 222 3 MT2762 Fluoroquinolones export ATP-binding protein MT2762 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQL6 1.36e-20 95 29 2 227 3 MT2762 Fluoroquinolones export ATP-binding protein MT2762 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8E8K8 5.91e-29 121 34 5 233 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8E8K8 1.54e-26 114 31 4 229 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q93DX8 6.3e-29 119 31 7 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 3.19e-25 108 33 7 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q98HF7 6.46e-29 121 32 4 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98HF7 3.06e-22 102 31 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q50801 6.71e-29 119 33 5 222 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q50801 4.84e-17 85 29 5 215 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
P9WQL7 6.97e-29 120 36 3 222 1 Rv2688c Fluoroquinolones export ATP-binding protein Rv2688c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL7 1.71e-20 95 29 2 228 1 Rv2688c Fluoroquinolones export ATP-binding protein Rv2688c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8Y4L8 7e-29 120 31 6 246 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y4L8 1.12e-17 88 35 3 172 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9PDN2 7.01e-29 121 32 7 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q9PDN2 2.34e-21 99 33 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q99758 7.24e-29 126 32 7 269 1 ABCA3 Phospholipid-transporting ATPase ABCA3 Homo sapiens
Q99758 7.3e-29 126 34 2 237 1 ABCA3 Phospholipid-transporting ATPase ABCA3 Homo sapiens
Q99758 1.61e-28 125 33 1 206 1 ABCA3 Phospholipid-transporting ATPase ABCA3 Homo sapiens
Q99758 4.45e-27 120 35 2 195 1 ABCA3 Phospholipid-transporting ATPase ABCA3 Homo sapiens
Q6D201 8.05e-29 120 33 9 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 1.08e-24 108 31 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q55BC0 8.99e-29 125 31 2 240 3 abcA8 ABC transporter A family member 8 Dictyostelium discoideum
Q55BC0 3.32e-19 95 27 3 222 3 abcA8 ABC transporter A family member 8 Dictyostelium discoideum
Q87G35 9.57e-29 124 25 19 572 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9FLT8 9.85e-29 125 37 4 209 3 ABCA12 ABC transporter A family member 12 Arabidopsis thaliana
Q9FLT8 3.3e-28 123 33 4 201 3 ABCA12 ABC transporter A family member 12 Arabidopsis thaliana
Q552P3 1.12e-28 125 34 4 206 3 abcA11 ABC transporter A family member 11 Dictyostelium discoideum
Q552P3 5.93e-27 119 31 8 231 3 abcA11 ABC transporter A family member 11 Dictyostelium discoideum
Q928L8 1.2e-28 120 32 6 246 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q928L8 1.46e-17 87 35 3 172 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71X09 1.31e-28 120 31 6 246 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q71X09 1.18e-17 88 35 3 172 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
O95477 1.39e-28 125 35 3 207 1 ABCA1 Phospholipid-transporting ATPase ABCA1 Homo sapiens
O95477 2.99e-25 115 36 4 204 1 ABCA1 Phospholipid-transporting ATPase ABCA1 Homo sapiens
O95477 4.1e-23 108 31 1 207 1 ABCA1 Phospholipid-transporting ATPase ABCA1 Homo sapiens
O95477 2.31e-21 102 28 5 285 1 ABCA1 Phospholipid-transporting ATPase ABCA1 Homo sapiens
Q82WT5 1.47e-28 120 32 6 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82WT5 1.6e-22 102 30 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8T6J1 1.54e-28 125 35 2 193 3 abcA6 ABC transporter A family member 6 Dictyostelium discoideum
Q8T6J1 1.26e-26 119 32 5 242 3 abcA6 ABC transporter A family member 6 Dictyostelium discoideum
Q8T6J1 1.34e-22 106 32 0 169 3 abcA6 ABC transporter A family member 6 Dictyostelium discoideum
Q8T6J1 3.77e-15 83 29 2 197 3 abcA6 ABC transporter A family member 6 Dictyostelium discoideum
A2RKA7 1.58e-28 122 33 5 223 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 2.36e-14 79 28 5 236 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RKA7 6.6e-10 65 28 7 225 1 nupA Nucleoside import ATP-binding protein NupA Lactococcus lactis subsp. cremoris (strain MG1363)
Q8D653 1.61e-28 120 33 7 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8D653 1.52e-24 108 30 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
P25885 1.96e-28 117 32 4 246 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P25885 6.05e-25 107 32 6 249 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
P74548 2.09e-28 119 32 5 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 6.8e-27 115 30 4 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9TKX3 2.23e-28 119 32 4 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 1.06e-26 114 33 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q2ISN3 3.39e-28 117 32 6 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q2ISN3 4.17e-19 91 30 7 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q8K449 3.44e-28 124 33 3 212 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8K449 6.7e-27 120 35 4 215 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8K449 3.82e-23 108 34 5 218 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8K449 6.36e-21 101 29 5 254 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8N139 3.49e-28 124 34 5 214 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
Q8N139 7.59e-27 120 29 8 298 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
Q8N139 1.43e-25 115 33 4 215 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
Q8N139 3.24e-18 92 28 4 236 1 ABCA6 ATP-binding cassette sub-family A member 6 Homo sapiens
P9WQM1 4.71e-28 119 35 5 220 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM1 2.05e-25 111 33 3 208 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 4.71e-28 119 35 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQM0 2.05e-25 111 33 3 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 4.71e-28 119 35 5 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0A4W3 2.05e-25 111 33 3 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8K442 5.92e-28 123 31 4 214 1 Abca8a ABC-type organic anion transporter ABCA8A Mus musculus
Q8K442 5.56e-27 120 34 3 199 1 Abca8a ABC-type organic anion transporter ABCA8A Mus musculus
Q8K442 1.27e-24 113 30 9 283 1 Abca8a ABC-type organic anion transporter ABCA8A Mus musculus
Q8K442 2.97e-17 89 27 6 233 1 Abca8a ABC-type organic anion transporter ABCA8A Mus musculus
P55339 6.37e-28 115 28 2 225 1 ecsA ABC-type transporter ATP-binding protein EcsA Bacillus subtilis (strain 168)
P55339 6.27e-26 110 31 1 208 1 ecsA ABC-type transporter ATP-binding protein EcsA Bacillus subtilis (strain 168)
Q89UD2 6.54e-28 118 32 7 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 3.53e-23 104 30 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9FLT5 8.18e-28 122 30 11 315 1 ABCA9 ABC transporter A family member 9 Arabidopsis thaliana
Q9FLT5 7.18e-24 110 32 3 210 1 ABCA9 ABC transporter A family member 9 Arabidopsis thaliana
Q2RFS8 8.6e-28 116 33 3 224 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RFS8 3.16e-23 103 33 5 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9ZCC4 9.39e-28 114 32 8 224 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q9ZCC4 1.2e-22 100 28 6 221 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q9G4F5 1.05e-27 117 32 5 228 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 7.93e-25 109 31 5 229 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q3KJS6 1.28e-27 118 34 4 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q3KJS6 8.82e-17 85 29 5 219 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
O34992 1.45e-27 117 29 6 230 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
O34992 1.62e-24 108 28 7 249 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q4UJW5 1.47e-27 114 31 7 222 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q4UJW5 3.11e-23 102 29 6 225 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8EPK1 1.68e-27 117 34 5 204 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EPK1 1.46e-18 90 27 5 223 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8F6Z1 1.76e-27 117 31 6 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F6Z1 1.31e-23 105 31 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.76e-27 117 31 6 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72PE5 1.31e-23 105 31 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q73XU8 1.87e-27 117 33 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XU8 3.35e-26 113 34 6 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8T6J5 1.92e-27 121 32 5 239 3 abcA2 ABC transporter A family member 2 Dictyostelium discoideum
Q8T6J5 3.03e-27 121 35 3 211 3 abcA2 ABC transporter A family member 2 Dictyostelium discoideum
Q8T6J5 7.52e-27 120 33 2 206 3 abcA2 ABC transporter A family member 2 Dictyostelium discoideum
Q8T6J5 9.48e-22 103 29 2 207 3 abcA2 ABC transporter A family member 2 Dictyostelium discoideum
Q7NWX3 2.26e-27 117 33 5 222 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 1.46e-19 94 33 6 229 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
O26236 2.27e-27 115 31 5 229 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O26236 2.53e-16 83 29 7 217 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9MUN1 2.47e-27 116 29 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 1.16e-26 114 30 3 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9I6L0 2.87e-27 115 32 6 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 4.13e-24 107 31 6 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0AGF4 3.22e-27 116 30 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0AGF4 1.81e-23 105 31 3 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
P0A9V4 3.57e-27 113 31 5 235 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V4 2.05e-26 111 31 3 219 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Shigella flexneri
P0A9V1 3.57e-27 113 31 5 235 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V1 2.05e-26 111 31 3 219 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli (strain K12)
P0A9V2 3.57e-27 113 31 5 235 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V2 2.05e-26 111 31 3 219 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9V3 3.57e-27 113 31 5 235 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P0A9V3 2.05e-26 111 31 3 219 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Escherichia coli O157:H7
P22040 3.84e-27 116 31 8 289 3 sll0415 Uncharacterized ABC transporter ATP-binding protein sll0415 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P22040 5.52e-26 112 32 6 207 3 sll0415 Uncharacterized ABC transporter ATP-binding protein sll0415 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9FKF2 4.29e-27 120 33 6 239 3 ABCA11 ABC transporter A family member 11 Arabidopsis thaliana
Q9FKF2 6.93e-26 116 33 3 214 3 ABCA11 ABC transporter A family member 11 Arabidopsis thaliana
Q7W9U5 4.43e-27 115 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W9U5 3.99e-25 110 32 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q68Y13 5.2e-27 112 31 8 229 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q68Y13 2.21e-21 96 28 6 224 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7NX01 5.47e-27 115 31 5 234 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 3.16e-24 107 32 5 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7VZE5 5.52e-27 115 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZE5 3.88e-25 110 32 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9KUI0 5.65e-27 116 31 7 279 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KUI0 2.79e-25 111 30 7 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7WGW1 5.79e-27 115 32 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WGW1 2.63e-25 110 32 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P33982 7.29e-27 113 29 2 229 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P33982 8.85e-25 107 31 3 232 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
E9PU17 7.75e-27 120 34 3 206 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
E9PU17 1.06e-26 119 29 6 298 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
E9PU17 4.53e-25 114 31 3 231 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
E9PU17 2.46e-24 112 32 4 210 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
Q6NBT1 8.28e-27 115 33 6 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBT1 6.24e-22 100 31 6 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P46920 8.85e-27 116 31 4 228 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
P46920 9.06e-23 104 32 4 210 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q9X196 8.9e-27 115 30 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X196 8.52e-22 100 29 5 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88AS5 9.31e-27 114 31 6 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 1.17e-25 111 33 6 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P24693 1.11e-26 112 29 3 241 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P24693 7.43e-25 107 33 2 209 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q6NBX6 1.3e-26 112 33 7 237 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBX6 5.33e-18 87 30 7 229 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q88CL2 1.38e-26 114 31 6 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88CL2 2.13e-23 104 31 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8PNN4 2e-26 114 31 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 8.71e-21 97 30 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q53I83 2.14e-26 114 31 6 244 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q53I83 3.47e-19 92 31 5 236 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
P31134 2.41e-26 114 29 4 246 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
P31134 1.21e-22 103 31 4 228 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q92VJ2 2.65e-26 114 30 5 239 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 1.1e-21 100 30 5 229 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q6A6X6 2.99e-26 114 30 6 257 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6A6X6 5.95e-18 89 28 4 209 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5KVK2 3.17e-26 113 31 4 210 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q5KVK2 2.75e-23 104 31 6 263 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q84K47 3.42e-26 117 29 9 320 2 ABCA2 ABC transporter A family member 2 Arabidopsis thaliana
Q84K47 3.91e-25 114 33 3 215 2 ABCA2 ABC transporter A family member 2 Arabidopsis thaliana
E9PX95 3.49e-26 117 32 3 230 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
E9PX95 9.53e-26 116 35 4 205 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
E9PX95 1.12e-24 113 31 1 206 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
E9PX95 2.55e-24 112 33 3 206 1 Abca17 ATP-binding cassette sub-family A member 17 Mus musculus
P10091 3.69e-26 113 33 3 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
P10091 7.26e-22 101 29 4 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
P14175 3.7e-26 114 32 4 209 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
P14175 4.54e-18 90 28 4 215 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q85A69 3.78e-26 114 32 3 210 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q85A69 4.26e-23 104 29 4 220 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q0KDG3 4.37e-26 112 35 6 223 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0KDG3 2.74e-20 95 31 8 228 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q82TL6 5.41e-26 113 29 3 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82TL6 2e-23 105 31 3 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A0PXX7 6.68e-26 110 31 5 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium novyi (strain NT)
A0PXX7 7.13e-18 87 27 3 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium novyi (strain NT)
Q110U3 7.41e-26 113 29 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q110U3 3.75e-19 93 27 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
P17328 7.5e-26 113 32 4 209 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P17328 4.14e-18 90 28 4 215 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6LX68 8.07e-26 110 31 4 210 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LX68 3.48e-16 82 28 7 238 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q609Q1 8.21e-26 112 33 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 1.4e-24 108 29 6 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8XZP8 8.29e-26 112 33 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZP8 3.6e-25 110 34 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q65P77 8.85e-26 110 33 4 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65P77 7.23e-25 107 30 3 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q97UY8 8.91e-26 112 30 5 227 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97UY8 6.8e-19 92 30 3 231 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q0ASQ1 8.99e-26 110 32 7 255 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q0ASQ1 1.24e-19 92 29 8 244 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q6MCV4 9.61e-26 112 30 5 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q6MCV4 3.78e-21 99 30 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q2K8C8 1.08e-25 112 32 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K8C8 1.24e-21 100 31 4 223 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q45460 1.09e-25 112 29 8 257 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q45460 1.44e-25 112 28 6 230 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q8K441 1.16e-25 116 35 4 200 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q8K441 3.66e-25 114 31 4 218 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q8K441 3.82e-25 114 34 6 213 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q8K441 8.04e-20 97 29 4 236 1 Abca6 ATP-binding cassette sub-family A member 6 Mus musculus
Q3KBH4 1.17e-25 112 32 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q3KBH4 1.04e-21 100 30 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q73P71 1.18e-25 109 29 4 221 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P71 1.85e-21 97 27 8 241 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8EBC3 1.19e-25 112 29 5 249 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8EBC3 5.62e-25 110 33 5 234 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q65T42 1.2e-25 112 32 6 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65T42 1.43e-23 105 31 5 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q38WL5 1.22e-25 111 32 4 208 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q38WL5 1.61e-22 102 29 3 212 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q035B2 1.33e-25 110 29 4 251 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q035B2 3.28e-20 94 32 4 207 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8U3E0 1.43e-25 109 33 4 205 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U3E0 4.87e-16 82 25 3 224 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q7N8B9 1.44e-25 111 32 4 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8B9 6.51e-21 97 25 3 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5YZY9 1.49e-25 111 32 4 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q5YZY9 6.3e-24 106 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q1AS06 1.53e-25 112 30 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AS06 1.69e-20 97 28 6 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P63354 1.59e-25 111 31 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 6.74e-25 109 33 6 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.59e-25 111 31 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 6.74e-25 109 33 6 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q54BT5 1.73e-25 115 33 3 213 3 abcA3 ABC transporter A family member 3 Dictyostelium discoideum
Q54BT5 3.99e-25 114 35 5 228 3 abcA3 ABC transporter A family member 3 Dictyostelium discoideum
Q54BT5 7e-23 107 28 0 210 3 abcA3 ABC transporter A family member 3 Dictyostelium discoideum
Q54BT5 1.39e-20 100 33 4 203 3 abcA3 ABC transporter A family member 3 Dictyostelium discoideum
Q60AI1 1.89e-25 112 30 4 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q60AI1 1.65e-14 79 29 5 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9L1C3 2.07e-25 111 32 3 221 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9L1C3 7.56e-18 89 30 4 236 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q03A07 2.12e-25 111 35 5 205 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03A07 3.36e-19 92 29 6 224 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P54537 2.18e-25 108 31 4 209 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 4.56e-24 104 29 3 223 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q1RGL1 2.34e-25 108 31 7 222 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 1.7e-21 97 29 6 222 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q67JX3 2.45e-25 109 33 3 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q67JX3 1.74e-18 89 30 5 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8D0W8 2.48e-25 111 32 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8D0W8 1.61e-23 105 30 6 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q92XW1 2.51e-25 110 30 5 239 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92XW1 1.2e-20 97 33 7 222 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q3A9G5 2.64e-25 110 31 3 205 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3A9G5 1.02e-21 100 29 4 221 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q58488 2.84e-25 108 30 5 229 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58488 8.94e-20 93 30 5 209 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6F9A8 2.9e-25 110 32 6 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9A8 1.85e-20 96 26 7 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q89C51 3.32e-25 108 32 6 237 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89C51 1.02e-18 89 32 8 230 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92WJ0 3.34e-25 110 31 4 231 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q92WJ0 6.89e-22 100 31 4 225 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
D4GP38 3.49e-25 111 29 4 217 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GP38 3.13e-16 84 29 5 219 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q07LY2 4.07e-25 108 32 7 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q07LY2 2.8e-18 88 31 9 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
O31339 4.18e-25 110 30 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
O31339 6.33e-24 107 30 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q49W48 4.77e-25 109 31 4 223 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49W48 5.86e-20 95 30 7 227 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2JLH7 4.98e-25 108 30 6 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JLH7 2.47e-23 103 28 6 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8PC11 5.37e-25 109 30 5 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 2.76e-22 101 31 5 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q6D734 5.76e-25 109 31 7 279 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D734 3.34e-21 99 27 5 224 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q04G50 6.24e-25 110 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 1.63e-18 90 26 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q2YAD6 6.96e-25 109 29 3 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 3.83e-21 99 30 4 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q668K6 7.51e-25 109 32 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 1.23e-23 106 30 6 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8UH62 7.65e-25 109 32 5 230 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UH62 1.92e-24 108 30 4 223 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9V2C0 8.14e-25 109 30 4 210 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2C0 3.44e-18 89 30 4 189 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q5PCG9 9.27e-25 108 32 4 206 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 2.06e-19 93 30 4 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q20Y31 9.35e-25 107 32 6 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q20Y31 7.83e-18 87 30 7 224 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q578K3 9.58e-25 109 31 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q578K3 1.2e-22 103 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 9.58e-25 109 31 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q2YKX3 1.2e-22 103 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q18AM3 9.86e-25 108 28 4 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q18AM3 1.29e-15 82 25 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q3IM24 1.01e-24 107 31 6 227 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3IM24 7.24e-22 99 30 8 258 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q7NQN5 1.02e-24 109 32 5 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 2.4e-20 96 29 5 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0T9T7 1.04e-24 107 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0T9T7 1.05e-18 89 29 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5HQQ9 1.09e-24 108 32 3 207 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQQ9 2.19e-17 87 29 7 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CTB2 1.22e-24 108 32 3 210 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CTB2 4.07e-17 86 29 6 230 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8FVV5 1.3e-24 108 31 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8FVV5 2e-22 102 32 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q8FFB3 1.3e-24 108 32 7 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFB3 2.79e-23 105 31 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 1.31e-24 108 32 7 232 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
P16676 3.36e-23 105 31 3 223 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 1.37e-24 108 32 7 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8XBJ8 2.97e-23 105 31 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q47T99 1.43e-24 109 30 5 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q47T99 4.69e-19 92 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
A0LUE6 1.48e-24 109 32 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A0LUE6 8.29e-20 95 32 4 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q5L222 1.52e-24 108 29 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 5.81e-21 98 28 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q6AE21 1.66e-24 108 31 5 248 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q6AE21 2.93e-19 92 30 4 221 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q57S53 1.79e-24 108 32 4 206 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q57S53 1.11e-19 94 30 4 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q1R3F6 1.79e-24 106 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q1R3F6 1.11e-18 89 29 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q8ZR89 2.08e-24 107 32 4 206 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 3.87e-19 92 30 4 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8U6M1 2.08e-24 108 30 4 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U6M1 2.99e-22 102 31 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
E0SCY1 2.09e-24 108 30 3 224 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
E0SCY1 1.6e-17 88 29 5 209 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q8FV85 2.13e-24 108 30 4 242 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8FV85 1.8e-22 102 32 4 207 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.13e-24 108 30 4 242 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YD40 1.8e-22 102 32 4 207 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.13e-24 108 30 4 242 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q579H8 1.8e-22 102 32 4 207 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.13e-24 108 30 4 242 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2YIV5 1.8e-22 102 32 4 207 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q8ELA5 2.14e-24 108 33 5 225 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELA5 9.7e-17 85 26 6 265 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q97KD5 2.18e-24 107 30 3 224 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KD5 8.92e-19 90 29 4 225 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q4KK46 2.27e-24 108 29 5 241 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KK46 5.51e-19 92 30 5 219 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P37009 2.42e-24 107 32 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P37009 8.59e-20 94 25 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8XDV7 2.51e-24 105 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q8XDV7 3.08e-18 88 28 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q58762 2.59e-24 106 30 6 248 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58762 9.87e-20 93 36 1 133 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O32169 2.59e-24 107 29 3 210 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
O32169 8.47e-21 97 29 6 256 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q9K789 3.01e-24 107 31 3 210 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K789 3.99e-22 101 31 4 222 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0A0H2ZLL3 3.5e-24 105 33 4 200 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0A0H2ZLL3 6.92e-22 98 27 5 235 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7UC29 3.61e-24 107 29 10 320 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7UC29 3.09e-23 105 31 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q9AB70 3.66e-24 105 29 5 254 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9AB70 1.84e-17 85 27 7 247 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1DDP4 3.71e-24 107 33 3 221 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q1DDP4 4.39e-19 92 30 9 313 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q7AH43 3.96e-24 107 32 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q7AH43 2.87e-21 99 26 3 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
A1TAI4 4.54e-24 107 31 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1TAI4 1.03e-18 91 30 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P16677 4.69e-24 105 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
P16677 1.01e-18 89 29 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q81GU1 4.95e-24 107 30 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GU1 1.13e-22 103 30 5 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9RR46 5.33e-24 107 29 3 226 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9RR46 2.47e-21 99 30 4 209 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q0RAT5 5.89e-24 108 30 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q0RAT5 2.01e-16 85 29 4 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q02R79 6e-24 107 30 4 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02R79 6.23e-24 107 30 6 262 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1B8V9 6.11e-24 107 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
Q1B8V9 7.12e-19 92 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 6.11e-24 107 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
A1UG51 7.12e-19 92 29 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q02ME3 6.13e-24 107 30 5 231 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02ME3 5.82e-20 95 31 4 221 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q72FW5 6.16e-24 107 28 5 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72FW5 1.17e-20 97 29 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
P45769 6.18e-24 104 29 6 259 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
P45769 5.9e-21 95 27 4 224 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q31TP8 6.2e-24 104 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q31TP8 4.37e-18 87 28 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q9HY19 6.23e-24 107 30 4 240 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HY19 6.53e-24 107 30 6 262 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z4V6 6.27e-24 107 28 9 317 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8Z4V6 3.9e-22 101 30 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q827Y0 6.68e-24 106 30 3 218 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q827Y0 4.58e-18 89 30 4 236 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q97KS6 6.82e-24 106 28 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 1.54e-20 96 28 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O65934 7.09e-24 110 34 2 210 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O65934 6.01e-19 94 28 2 211 1 Rv1747 ABC transporter ATP-binding/permease protein Rv1747 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9A502 7.18e-24 106 31 7 282 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A502 7.18e-24 106 33 4 210 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P40735 7.25e-24 105 31 3 206 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
P40735 5.21e-23 102 31 3 213 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
Q329I3 8.11e-24 104 29 6 238 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q329I3 4.5e-19 90 30 7 237 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
O05253 8.69e-24 108 31 4 216 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 1.13e-15 83 28 6 253 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 1.17e-09 64 27 6 227 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
O05253 1.45e-05 51 22 5 212 1 nupO Guanosine import ATP-binding protein NupO Bacillus subtilis (strain 168)
P40860 9.09e-24 106 28 9 317 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40860 4.03e-22 101 30 3 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7M8M4 9.17e-24 104 32 9 237 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8M4 9.38e-22 99 28 5 228 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q60350 9.41e-24 103 30 4 207 3 MJ0035 Uncharacterized ABC transporter ATP-binding protein MJ0035 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q60350 5.54e-14 75 26 4 215 3 MJ0035 Uncharacterized ABC transporter ATP-binding protein MJ0035 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O83658 9.88e-24 106 29 3 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
O83658 1.57e-20 97 30 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q8XHV2 1e-23 104 32 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain 13 / Type A)
Q8XHV2 5.12e-17 85 27 3 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain 13 / Type A)
Q0TMS7 1e-23 104 32 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TMS7 5.12e-17 85 27 3 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8FAV1 1.15e-23 103 29 5 238 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FAV1 2.5e-18 88 29 7 234 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P26946 1.17e-23 103 30 2 194 3 BpOF4_11395 Uncharacterized ABC transporter ATP-binding protein BpOF4_11395 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P26946 2.22e-19 91 25 5 273 3 BpOF4_11395 Uncharacterized ABC transporter ATP-binding protein BpOF4_11395 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q05067 1.26e-23 105 34 4 207 3 all4389 Uncharacterized ABC transporter ATP-binding protein all4389 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q05067 1.45e-17 87 31 7 245 3 all4389 Uncharacterized ABC transporter ATP-binding protein all4389 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3YUN6 1.26e-23 103 29 5 241 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q3YUN6 5.7e-19 90 29 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q81LM1 1.27e-23 104 34 4 206 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q81LM1 1.08e-15 80 27 8 226 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q555Z5 1.31e-23 109 32 5 220 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q555Z5 1.02e-22 107 29 2 232 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q555Z5 1.38e-20 100 29 5 221 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q555Z5 7.04e-20 98 29 4 221 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q6NJ07 1.38e-23 105 30 6 249 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q6NJ07 2.23e-22 102 30 4 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q16BC5 1.43e-23 103 34 7 219 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q16BC5 4.81e-19 90 26 9 262 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6HBS0 1.55e-23 105 30 4 212 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HBS0 5.23e-19 92 31 5 222 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8YCG3 1.62e-23 105 30 3 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YCG3 1.97e-21 99 31 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q58639 1.82e-23 107 30 5 249 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 5.9e-15 81 25 6 256 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 8.25e-14 77 27 5 240 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58639 7.06e-10 65 24 6 259 3 MJ1242 Uncharacterized ABC transporter ATP-binding protein MJ1242 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q0SQH5 1.84e-23 103 32 4 212 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain SM101 / Type A)
Q0SQH5 2.35e-17 86 27 3 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain SM101 / Type A)
Q38UT9 1.89e-23 103 29 3 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q38UT9 7.56e-19 90 28 4 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q4FL37 1.91e-23 105 32 4 213 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q4FL37 1.95e-14 78 29 5 193 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q1LQF6 2.04e-23 105 34 6 223 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LQF6 1.33e-21 99 32 8 229 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q07756 2.08e-23 104 28 2 219 3 nodI Nod factor export ATP-binding protein I Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q07756 6.02e-20 94 30 1 202 3 nodI Nod factor export ATP-binding protein I Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q92EZ6 2.22e-23 105 32 5 226 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92EZ6 4.37e-20 95 29 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4QMH4 2.26e-23 105 32 5 222 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q4QMH4 5.99e-21 97 28 5 232 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q8YA75 2.27e-23 105 31 5 226 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8YA75 1.03e-20 97 29 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P44785 2.53e-23 105 32 5 222 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44785 9.84e-21 97 28 5 232 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SRL2 2.59e-23 105 28 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 1.16e-19 94 28 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q03ZQ0 2.64e-23 105 25 6 262 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 2.88e-22 102 28 3 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q9JUX4 2.65e-23 105 31 7 248 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JUX4 6.18e-23 103 31 8 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q03PF2 2.72e-23 105 31 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 3e-20 96 29 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8Y8T6 2.8e-23 105 28 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8T6 1.44e-20 97 28 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q63E84 2.82e-23 104 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 1.29e-18 90 25 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.82e-23 104 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 1.29e-18 90 25 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.82e-23 104 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 1.29e-18 90 25 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 3.04e-23 104 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 1.52e-18 90 25 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8G5P8 3.09e-23 105 30 3 204 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q8G5P8 1.68e-22 103 30 5 230 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q6LKD4 3.13e-23 104 28 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6LKD4 3.31e-23 104 31 4 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q9K876 3.17e-23 104 29 5 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 9.89e-23 103 30 7 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q89AJ0 3.25e-23 102 29 4 226 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 6.37e-16 80 25 5 226 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q4ZZK0 3.27e-23 105 29 4 247 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZK0 3.94e-16 84 27 4 215 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q46Y69 3.27e-23 104 34 6 223 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46Y69 1.7e-18 90 29 5 225 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8Z8R5 3.28e-23 104 32 4 206 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 9.45e-18 88 30 4 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8RFN2 3.34e-23 104 28 3 220 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RFN2 4.8e-18 89 27 3 220 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q48PN3 3.49e-23 105 31 3 210 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PN3 3.54e-17 87 28 4 215 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q724C0 3.63e-23 104 31 5 226 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q724C0 1.7e-20 96 29 4 222 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q65F80 3.81e-23 104 30 3 210 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65F80 1.41e-18 90 28 6 242 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q72Y96 3.84e-23 104 29 4 212 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q72Y96 2.6e-19 93 31 4 204 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q815Y7 3.99e-23 104 29 4 212 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q815Y7 2.55e-19 93 31 4 204 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81TH8 4.01e-23 103 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 3.46e-18 89 25 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
A0AGP9 4.04e-23 104 28 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AGP9 1.25e-20 97 28 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9KHT9 4.12e-23 105 29 6 241 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
Q9KHT9 7.62e-23 104 27 6 240 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 4.12e-23 105 29 6 241 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
G2JZ44 7.62e-23 104 27 6 240 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q04BY7 4.14e-23 102 30 4 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04BY7 1.14e-12 72 26 6 217 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1MQ44 4.56e-23 104 29 6 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q1MQ44 6.03e-21 98 28 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
A0PY57 4.63e-23 104 27 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
A0PY57 1.8e-22 102 27 4 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
O34977 4.98e-23 101 29 2 196 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
O34977 2.14e-21 96 31 4 208 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
Q5FA19 5.09e-23 104 32 5 212 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 9.23e-21 97 28 4 217 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1GIE5 5.29e-23 104 32 8 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q1GIE5 1.03e-20 97 31 7 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
P10346 5.45e-23 101 29 4 224 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P10346 5.77e-23 101 30 5 225 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q722B1 5.5e-23 104 28 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q722B1 1.79e-20 97 28 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q5JEB0 5.54e-23 103 31 6 218 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 1.84e-19 93 33 3 184 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q1GB17 5.66e-23 104 28 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GB17 3.09e-20 96 26 6 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q6FAN3 5.76e-23 103 29 4 223 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FAN3 3.62e-21 99 30 5 216 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9JZW0 5.79e-23 103 30 6 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JZW0 7.6e-23 103 31 8 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q831K6 6.19e-23 103 31 6 214 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q831K6 4.77e-22 101 27 6 274 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q5L3R0 6.61e-23 102 30 3 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)
Q5L3R0 6.53e-21 96 28 4 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)
Q81XL3 6.77e-23 103 29 4 212 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q81XL3 3.11e-19 92 31 4 204 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q9I1C8 6.79e-23 103 29 5 231 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1C8 1.78e-19 94 31 5 222 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92DL6 7.02e-23 103 28 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92DL6 1.53e-20 97 28 5 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5WJP0 7.03e-23 103 30 6 260 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q5WJP0 2.98e-17 87 29 3 203 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q92LX3 7.09e-23 103 32 5 224 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q92LX3 1.83e-19 93 30 7 233 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q631Y4 7.1e-23 103 29 4 212 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q631Y4 3.08e-19 92 31 4 204 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q3SGJ8 7.21e-23 101 30 7 233 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q3SGJ8 5.99e-22 99 27 5 247 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
Q042G7 8.28e-23 103 30 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q042G7 3.1e-22 102 27 6 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q9KIF7 9.77e-23 104 28 4 229 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q9KIF7 6.26e-21 99 30 4 202 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q3JHC9 9.86e-23 103 31 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q3JHC9 3.62e-22 102 33 4 217 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q73F67 1.02e-22 101 30 3 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73F67 7.89e-21 96 30 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7N6Z2 1.02e-22 103 31 6 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 1.29e-22 103 31 6 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2W1R8 1.05e-22 103 34 6 212 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W1R8 9.91e-16 82 30 7 223 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q63NI4 1.13e-22 103 31 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q63NI4 4.01e-22 102 33 4 217 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q8ELR4 1.17e-22 103 27 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELR4 1.86e-21 99 28 6 252 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9CL63 1.2e-22 105 29 4 234 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 3.71e-18 91 22 16 552 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q8U4K3 1.22e-22 102 30 5 218 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4K3 1.98e-17 87 29 3 197 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q62B84 1.26e-22 103 31 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q62B84 3.59e-22 102 33 4 217 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
P44531 1.27e-22 102 30 4 221 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44531 1.75e-22 102 28 3 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87UV4 1.32e-22 103 28 3 233 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UV4 1.85e-16 85 28 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P55662 1.33e-22 100 30 5 236 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55662 1.79e-19 91 27 6 240 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q57293 1.35e-22 102 30 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q57293 2.51e-22 102 29 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
A3CVD3 1.37e-22 101 31 6 227 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A3CVD3 9e-18 87 31 6 204 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q3MAR5 1.41e-22 103 28 4 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MAR5 1.25e-19 94 28 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q1BR30 1.41e-22 103 30 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
Q1BR30 1.15e-21 100 31 8 277 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 1.41e-22 103 30 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
A0B344 1.15e-21 100 31 8 277 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q81GC1 1.42e-22 102 29 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 2.01e-19 93 26 3 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8FRX8 1.45e-22 102 32 5 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8FRX8 5.06e-20 95 29 4 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0I5E9 1.5e-22 102 31 6 241 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q0I5E9 4.36e-19 92 30 4 210 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q1GBJ0 1.5e-22 101 30 4 230 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GBJ0 2e-12 71 26 6 217 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q890R2 1.55e-22 101 28 5 236 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium tetani (strain Massachusetts / E88)
Q890R2 3.75e-18 88 27 3 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium tetani (strain Massachusetts / E88)
Q2YKZ7 1.59e-22 102 29 3 220 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q2YKZ7 2.56e-18 90 27 3 223 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.59e-22 102 29 3 220 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q578M5 2.56e-18 90 27 3 223 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8NSN2 1.68e-22 102 31 5 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NSN2 4.12e-18 89 28 4 223 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2NHA1 1.77e-22 100 31 8 259 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q2NHA1 1.41e-12 72 26 5 212 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q8FVT0 1.79e-22 102 29 3 220 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q8FVT0 2.63e-18 90 27 3 223 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q04BG2 1.79e-22 102 28 6 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04BG2 8.51e-20 94 26 6 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
P47425 1.92e-22 100 29 2 203 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47425 2.91e-17 85 27 6 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P33360 1.97e-22 101 32 7 223 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
P33360 9.57e-20 93 27 5 231 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q8NY21 1.98e-22 102 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q8NY21 2.59e-13 75 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 1.98e-22 102 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q6GC27 2.59e-13 75 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q39AT4 2.03e-22 103 30 3 208 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39AT4 6.84e-21 98 32 5 222 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q83P97 2.08e-22 100 29 5 238 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q83P97 1.6e-17 86 29 7 237 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q0SXV5 2.08e-22 100 29 5 238 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
Q0SXV5 1.6e-17 86 29 7 237 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
Q14Q07 2.12e-22 102 29 8 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 1.54e-17 87 27 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q72AQ6 2.15e-22 100 33 7 216 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72AQ6 5.69e-17 84 29 5 222 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9CM80 2.19e-22 102 27 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q9CM80 8.79e-22 100 29 6 253 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q2IYS5 2.2e-22 100 33 6 219 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q2IYS5 2.39e-20 94 29 6 253 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q4L4R9 2.26e-22 102 29 5 228 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q4L4R9 3.26e-18 89 29 7 226 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
O57896 2.36e-22 102 28 4 210 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57896 1.88e-17 87 30 3 184 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O31427 2.41e-22 99 28 2 211 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
O31427 1.97e-20 94 32 2 199 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q24XJ2 2.44e-22 102 27 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q24XJ2 3.54e-16 83 26 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q5HIL5 2.51e-22 102 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q5HIL5 7.43e-14 76 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.51e-22 102 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2G0V2 7.43e-14 76 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.51e-22 102 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q2FJI0 7.43e-14 76 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q18C09 2.53e-22 101 28 3 219 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 9.12e-16 82 28 5 227 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q0AU85 2.57e-22 102 30 4 223 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AU85 5.09e-17 86 35 2 161 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0I2Z4 2.57e-22 102 29 4 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q0I2Z4 2.04e-21 99 27 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q326G9 2.58e-22 99 32 5 208 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q326G9 4.98e-21 95 30 2 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q8UCD5 2.82e-22 102 34 6 198 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UCD5 9.54e-15 79 24 5 229 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
O34677 2.84e-22 99 30 5 225 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
O34677 4.17e-20 93 30 5 222 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q0T8D1 2.92e-22 99 32 5 208 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q0T8D1 4.88e-21 95 30 2 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q8YM92 3e-22 102 28 4 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YM92 1.81e-19 94 28 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7A7E3 3.09e-22 101 29 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q7A7E3 1.59e-13 75 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.09e-22 101 29 6 246 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99WE1 1.59e-13 75 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q66D26 3.32e-22 100 26 6 275 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66D26 2.96e-13 73 23 4 226 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CFV9 3.32e-22 100 26 6 275 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CFV9 2.96e-13 73 23 4 226 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGU5 3.32e-22 100 26 6 275 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q8ZGU5 2.96e-13 73 23 4 226 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q1C9L0 3.32e-22 100 26 6 275 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C9L0 2.96e-13 73 23 4 226 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
P19844 3.32e-22 100 28 4 222 1 nosF Probable ABC transporter ATP-binding protein NosF Stutzerimonas stutzeri
P19844 1.21e-21 99 35 3 198 1 nosF Probable ABC transporter ATP-binding protein NosF Stutzerimonas stutzeri
Q8XIZ5 3.41e-22 101 28 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q8XIZ5 1.53e-19 94 29 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 3.41e-22 101 28 3 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ3 1.53e-19 94 29 5 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8PYH5 3.43e-22 101 29 5 227 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PYH5 6.76e-18 88 30 5 217 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q18CI9 3.47e-22 100 31 6 222 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridioides difficile (strain 630)
Q18CI9 1.72e-17 86 27 7 218 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridioides difficile (strain 630)
Q2K4V4 3.59e-22 102 27 4 234 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K4V4 1.48e-16 85 28 6 224 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6F9P2 3.62e-22 101 30 5 222 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9P2 1.43e-20 96 27 6 243 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5KYQ7 3.67e-22 103 29 5 231 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 7.67e-15 80 27 9 261 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 4.26e-14 78 27 8 249 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5KYQ7 1.88e-12 73 29 5 212 3 GK1894 Putative ribose/galactose/methyl galactoside import ATP-binding protein Geobacillus kaustophilus (strain HTA426)
Q5UW69 3.68e-22 99 30 6 223 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5UW69 2.62e-20 94 30 8 235 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5FL41 3.77e-22 101 27 6 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FL41 3.64e-21 99 28 3 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q81J16 3.87e-22 100 29 3 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81J16 9.81e-21 95 30 4 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q04F14 4.06e-22 101 30 4 224 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04F14 4.91e-17 86 27 4 205 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P54591 4.18e-22 98 28 5 207 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
P54591 3.03e-15 79 28 7 223 3 yhcG Uncharacterized ABC transporter ATP-binding protein YhcG Bacillus subtilis (strain 168)
Q6D3Q6 4.26e-22 101 28 3 204 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3Q6 5.43e-17 85 28 5 226 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q166X0 4.37e-22 99 28 4 235 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q166X0 5.32e-16 82 27 10 273 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1QE80 4.38e-22 102 26 3 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 4.92e-19 93 27 4 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3Z5U5 4.38e-22 98 32 5 208 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q3Z5U5 4.73e-20 92 30 2 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q1QVQ7 4.39e-22 101 32 4 217 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1QVQ7 1.15e-19 94 33 6 223 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q74K65 4.43e-22 101 29 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74K65 8.21e-22 100 27 6 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q2KVK2 4.62e-22 101 30 4 220 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q2KVK2 1.79e-19 94 31 3 204 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q6HPN0 4.72e-22 99 30 3 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HPN0 9.09e-21 95 30 3 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 4.72e-22 99 30 3 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
Q81VQ2 9.09e-21 95 30 3 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 4.72e-22 99 30 3 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
A0R8K8 9.09e-21 95 30 3 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q8ELQ6 4.76e-22 101 29 6 254 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ELQ6 8.38e-18 88 30 4 204 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9KLQ5 5.11e-22 101 31 5 221 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 2.26e-21 99 27 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7VV72 5.27e-22 101 29 4 228 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VV72 8.87e-18 88 30 3 201 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 5.27e-22 101 29 4 228 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W4E1 8.87e-18 88 30 3 201 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 5.27e-22 101 29 4 228 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WFU9 8.87e-18 88 30 3 201 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q92W60 5.28e-22 103 30 6 221 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 2.53e-11 69 30 7 211 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 3.69e-09 63 23 6 219 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q92W60 4.27e-08 59 25 9 249 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Rhizobium meliloti (strain 1021)
Q6GIH9 5.33e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q6GIH9 1.32e-17 87 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q839D5 5.45e-22 99 30 4 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q839D5 3.91e-18 88 29 3 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8NXH5 5.53e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q8NXH5 1.07e-17 88 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 5.53e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q6GB18 1.07e-17 88 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 5.53e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q5HHK4 1.07e-17 88 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 5.53e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FZZ2 1.07e-17 88 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 5.53e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q2FII2 1.07e-17 88 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q1IGN4 5.84e-22 101 31 4 202 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q1IGN4 7.56e-21 98 28 5 228 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q7A6M2 6.07e-22 100 30 3 215 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q7A6M2 1.62e-17 87 30 7 226 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 6.07e-22 100 30 3 215 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99VG8 1.62e-17 87 30 7 226 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5FM63 6.46e-22 99 29 4 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FM63 1.05e-18 90 29 4 204 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q9KTJ5 6.47e-22 100 30 7 249 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KTJ5 7.85e-20 94 32 3 204 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6GJL2 6.49e-22 100 29 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q6GJL2 1.82e-13 75 25 3 204 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q0B6I6 6.55e-22 101 29 4 226 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B6I6 8.81e-22 101 34 6 226 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6HP89 6.79e-22 100 30 5 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HP89 1.16e-21 100 29 4 223 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q98K23 6.92e-22 100 31 5 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98K23 3.19e-19 92 31 5 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q667L9 7.14e-22 100 30 6 251 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q667L9 2.02e-18 90 31 3 201 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q81ZF5 7.18e-22 100 30 5 236 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81ZF5 1.16e-21 100 29 4 223 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q2YWP2 7.33e-22 100 30 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWP2 1.66e-17 87 30 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1GMA8 8.12e-22 98 28 8 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q1GMA8 1.63e-14 77 25 7 256 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q65S66 8.16e-22 100 29 4 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65S66 2.36e-20 96 27 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2NRN5 8.22e-22 100 28 5 241 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q2NRN5 5.43e-20 95 31 4 221 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q5ZUG5 8.36e-22 100 30 3 216 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZUG5 3.08e-19 92 28 5 236 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q4W575 8.43e-22 100 32 5 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 5.04e-19 92 28 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 8.43e-22 100 32 5 212 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 5.04e-19 92 28 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9V2E4 8.47e-22 98 34 3 193 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2E4 2.57e-16 82 28 5 217 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q5YRD1 8.59e-22 100 31 5 224 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q5YRD1 1.64e-17 87 32 4 194 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q63H62 8.94e-22 99 30 3 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q63H62 4.83e-20 94 30 3 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q5WKL3 8.99e-22 100 29 5 238 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q5WKL3 7.57e-19 91 28 6 261 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q1RGD0 9.01e-22 97 32 5 208 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q1RGD0 4.6e-19 90 29 2 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q58967 9.03e-22 99 29 6 219 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58967 5.41e-17 85 28 6 234 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q83MG3 9.27e-22 97 32 5 202 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q83MG3 2.28e-20 93 30 3 209 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q8UA73 9.9e-22 100 29 5 217 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA73 2.81e-21 99 32 5 225 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8XNY7 1e-21 99 29 5 212 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q8XNY7 5.82e-17 85 27 7 232 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00815
Feature type CDS
Gene -
Product ATP-binding cassette domain-containing protein
Location 168310 - 170055 (strand: -1)
Length 1746 (nucleotides) / 581 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1527
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1131 Defense mechanisms (V) V ABC-type multidrug transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K25182 drug efflux transport system ATP-binding protein - -

Protein Sequence

MPDITITLNGVEKNFPGLNSPAVDRLSTTISGGGVTGLAGPDGAGKTTLIRMLAGLLKPDSGEIRVAGLDPITDSVALRARLGYMPQKFGLYEDLTVMENLRLYAELRGLPQSEQQNTFDRLLTFTDLTHFTGRMAGKLSGGMKQKLGLACTLLGQPQVLLLDEPGVGVDPIARRELWRMVHTLADDGMLILWSTSYLDEAEQCRDVLLLNQGKLLYEGKPEKLTDTMSGRSFLLAAQPAERRRLLQDALVQPDVTDGVIQGRYVRLIVKPQTDTRALLNTLNCPDAELQTAKPRFEDAFIDLLGGGPSHRSALAQIMPQIPAAPDETVIEAISLTKKFGDFAATDHVDFQVKRGEIFGLLGPNGAGKSTTFKMMCGLMIPTTGRALVLGLDLKTSSAKARSRLGYMAQKFSLYGNLTVAQNLTFFSGVYGLRGKAQKQKMADMVSTFNFDPILRQTTEDLPLGFKQRLALACALMHEPDILFLDEPTSGVDPLTRREFWLHINGMVDKGVTVMVTTHFMDEAEYCDRIGLVYHGKIIAAGTPDQLKASVANDAHPDPSMEDAFIGLVEQYDKEHTPEDVS

Flanking regions ( +/- flanking 50bp)

GAATGCCGGTAACTGTCCGTTTTGACAGCGAACAGCCGCAGGGATAAAGGATGCCGGACATCACAATCACCCTGAATGGCGTAGAAAAAAACTTCCCCGGACTGAACAGCCCGGCAGTTGACCGGCTGAGTACCACAATTTCCGGCGGCGGTGTTACCGGTCTGGCAGGTCCTGACGGTGCCGGAAAAACCACGCTTATCCGTATGCTCGCCGGACTGCTGAAACCGGACAGCGGCGAGATCCGCGTTGCCGGGTTAGACCCGATCACTGACAGTGTCGCGCTGCGCGCCCGGCTCGGTTATATGCCGCAGAAATTCGGGCTGTATGAAGACCTGACGGTGATGGAAAATCTCCGCTTATATGCTGAGCTGCGCGGATTGCCACAATCTGAACAGCAGAATACGTTTGATCGTCTGCTCACCTTTACCGATCTCACGCATTTTACCGGACGCATGGCCGGGAAGCTTTCCGGCGGCATGAAACAGAAGCTGGGGCTCGCCTGCACCCTTCTCGGGCAGCCGCAGGTATTGCTGCTCGATGAGCCGGGTGTCGGAGTTGATCCTATCGCCCGCCGCGAACTGTGGCGCATGGTTCACACGCTGGCAGATGACGGCATGCTAATCCTCTGGAGCACCTCTTATCTGGATGAAGCAGAGCAGTGCCGCGATGTGCTGCTGCTGAATCAGGGAAAACTGCTCTATGAGGGCAAACCGGAAAAACTGACTGACACCATGAGCGGACGCTCATTTTTGCTGGCAGCACAGCCCGCAGAACGGCGGCGTTTGTTGCAGGATGCATTAGTTCAGCCGGATGTCACCGACGGGGTTATTCAGGGGCGTTATGTCCGCCTGATCGTCAAACCTCAGACCGATACCCGCGCCCTGCTCAACACACTGAATTGCCCGGATGCCGAATTACAGACAGCAAAACCCCGTTTTGAGGATGCCTTTATCGATCTGCTCGGCGGCGGCCCCTCTCATCGCTCTGCGCTGGCACAAATTATGCCGCAAATTCCTGCCGCACCGGACGAAACCGTTATTGAGGCCATCAGTCTGACCAAGAAATTCGGGGATTTTGCCGCCACAGATCATGTGGATTTTCAGGTAAAACGCGGGGAAATTTTTGGTCTGCTCGGTCCGAATGGTGCAGGGAAATCCACCACCTTTAAAATGATGTGCGGGCTGATGATCCCGACGACCGGACGTGCACTTGTACTGGGGCTGGATCTGAAAACCAGTTCTGCCAAAGCCCGCAGCCGTCTGGGGTATATGGCACAGAAATTCTCGCTGTACGGTAACCTTACCGTCGCACAGAACCTGACATTTTTCTCCGGTGTATACGGGCTGCGCGGCAAAGCGCAGAAACAAAAAATGGCGGATATGGTCAGTACCTTCAATTTTGACCCGATCCTGCGCCAGACCACAGAAGATCTGCCGCTTGGCTTTAAACAGCGGCTGGCACTCGCCTGCGCACTGATGCATGAACCGGATATTCTGTTTCTGGATGAACCGACCTCCGGGGTTGATCCGCTCACCCGCCGTGAATTTTGGCTGCATATCAACGGTATGGTGGACAAAGGCGTAACCGTAATGGTAACGACCCACTTTATGGATGAAGCGGAATATTGTGACCGTATCGGGCTGGTCTATCACGGCAAAATTATAGCTGCCGGGACGCCGGACCAGCTGAAAGCAAGTGTGGCAAATGACGCGCATCCAGATCCGTCCATGGAAGACGCGTTTATCGGGCTGGTCGAACAATATGATAAAGAGCACACACCGGAGGACGTATCATGAATACACAATCTGCCACACCTTCCGGTTTTTCATGGCGCCGCCTGCGGGCG