Homologs in group_328

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09915 FBDBKF_09915 91.6 Morganella morganii S1 nagE Phosphotransferase system IIA component
EHELCC_04715 EHELCC_04715 91.6 Morganella morganii S2 nagE Phosphotransferase system IIA component
NLDBIP_04715 NLDBIP_04715 91.6 Morganella morganii S4 nagE Phosphotransferase system IIA component
LHKJJB_13915 LHKJJB_13915 91.6 Morganella morganii S3 nagE Phosphotransferase system IIA component
HKOGLL_12620 HKOGLL_12620 91.6 Morganella morganii S5 nagE Phosphotransferase system IIA component
PMI_RS02280 PMI_RS02280 75.0 Proteus mirabilis HI4320 nagE N-acetylglucosamine-specific PTS transporter subunit IIBC
PMI_RS11320 PMI_RS11320 41.6 Proteus mirabilis HI4320 ptsG PTS glucose transporter subunit IIBC

Distribution of the homologs in the orthogroup group_328

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_328

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P09323 0.0 571 47 7 684 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
P45604 0.0 540 46 8 686 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
Q4L945 3.31e-143 436 37 14 693 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
P20166 1.02e-142 436 37 16 713 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q57071 4.05e-142 433 38 17 700 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q7CCJ4 1.65e-140 429 37 14 681 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 1.65e-140 429 37 14 681 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 1.65e-140 429 37 14 681 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q53922 7.49e-139 425 37 19 708 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q2YUZ1 1.09e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NYM1 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 1.13e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q4A0C4 1.49e-138 424 36 12 681 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GKB7 2.44e-138 424 38 17 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q7A807 8.39e-138 422 37 16 692 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 8.39e-138 422 37 16 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 8.39e-138 422 37 16 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 8.39e-138 422 37 16 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 8.39e-138 422 37 16 692 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
P39816 2.04e-129 399 36 14 661 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
A5IVW5 4.85e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
A6U4R9 4.85e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q2YWC1 5.06e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NUS2 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
Q6GDR0 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
A6QK27 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
Q2FV87 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 6.33e-126 392 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
Q7A3G4 4.72e-125 389 35 19 720 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 4.72e-125 389 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 4.72e-125 389 35 19 720 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
O34521 3.84e-99 314 41 9 503 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P37439 2.04e-95 305 36 15 518 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q89AG6 1.04e-94 304 37 12 511 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P69786 1.41e-94 303 35 14 518 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 1.41e-94 303 35 14 518 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 1.41e-94 303 35 14 518 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
P57437 9.55e-90 291 35 13 520 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9S2H4 1.65e-87 283 42 8 419 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P19642 2.7e-80 268 31 10 537 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
Q8K9J0 1.78e-79 264 34 14 513 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P35595 8.7e-78 266 30 22 731 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9AGA7 1.23e-62 221 30 15 534 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
P42015 8.91e-62 212 34 4 334 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P54715 1.63e-60 214 29 14 537 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
O06900 1.55e-57 206 28 11 532 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
C7NB69 4.34e-56 202 30 15 536 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
P47315 1.08e-55 207 30 11 453 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 9.82e-21 100 29 7 247 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75569 2.42e-52 198 31 14 463 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 6.01e-24 111 32 8 256 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A283 2.37e-42 154 49 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A284 2.37e-42 154 49 1 150 1 crr PTS system glucose-specific EIIA component Salmonella typhi
P69785 4.68e-41 150 48 1 150 3 crr PTS system glucose-specific EIIA component Shigella flexneri
P69783 4.68e-41 150 48 1 150 1 crr PTS system glucose-specific EIIA component Escherichia coli (strain K12)
P69784 4.68e-41 150 48 1 150 3 crr PTS system glucose-specific EIIA component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q44840 1.85e-40 149 52 0 131 3 crr PTS system glucose-specific EIIA component Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q89B05 3.27e-40 148 45 1 151 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P45338 1.67e-38 143 44 1 158 1 crr PTS system glucose-specific EIIA component Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9WXI7 5.41e-38 141 42 2 149 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8KA51 1.3e-34 132 41 0 131 3 crr PTS system glucose-specific EIIA component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P31452 3.63e-33 134 29 6 348 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
Q9KCQ4 1.38e-32 127 44 0 141 3 crr PTS system glucose-specific EIIA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q93P61 1.99e-32 126 42 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus
Q5HFZ9 1.99e-32 126 42 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain COL)
Q6GGY5 2.15e-32 126 42 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MRSA252)
Q8CP79 6.02e-32 125 41 1 146 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPB5 6.02e-32 125 41 1 146 3 crr PTS system glucose-specific EIIA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NWR1 6.64e-32 124 41 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MW2)
Q6G9D9 6.64e-32 124 41 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain MSSA476)
P60857 8e-32 124 41 1 157 1 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain N315)
P60856 8e-32 124 41 1 157 3 crr PTS system glucose-specific EIIA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8CZD5 2.01e-31 123 40 0 149 3 crr PTS system glucose-specific EIIA component Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P50829 1.96e-30 120 44 0 119 4 ptsA Phosphotransferase enzyme IIA component PtsA Bacillus subtilis (strain 168)
Q814U8 7.54e-30 119 38 1 150 3 crr PTS system glucose-specific EIIA component Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81JY0 1.28e-29 118 38 1 150 3 crr PTS system glucose-specific EIIA component Bacillus anthracis
P40739 3.21e-28 123 40 1 159 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
P45618 4.01e-28 114 41 1 144 1 crr PTS system glucose-specific EIIA component Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9KF90 1.28e-25 115 36 2 161 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P26207 1.6e-25 115 39 1 172 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
Q46072 1.76e-24 112 36 0 146 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P12655 2.67e-23 108 38 2 160 1 scrA PTS system sucrose-specific EIIBCA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q45298 2.67e-22 105 36 0 131 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
P08722 2.97e-21 102 32 1 170 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
P23936 2.78e-19 95 42 1 117 3 lacS Lactose permease Streptococcus thermophilus
P43470 1.36e-18 93 36 0 141 3 scrA PTS system sucrose-specific EIIBCA component Pediococcus pentosaceus
P43466 1.63e-17 90 34 1 147 3 rafP Raffinose carrier protein Pediococcus pentosaceus
P22733 6.58e-16 85 34 1 122 3 lacY Lactose permease Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P69790 9.42e-16 78 38 5 140 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 9.42e-16 78 38 5 140 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q7WTB2 7.16e-15 82 38 3 123 2 lacS Lactose permease Lactobacillus helveticus
Q9S2H6 2.6e-12 66 42 1 76 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q83QN3 6.26e-08 59 39 4 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
P77272 2.06e-07 57 38 4 104 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q8XBJ1 3.02e-07 57 38 4 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q1R8U3 3.1e-07 57 38 4 103 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q8FFA9 3.35e-07 57 38 4 103 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32DC5 5.7e-07 56 37 4 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
P24241 1.12e-06 55 37 3 85 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q31Y50 1.31e-06 55 37 4 104 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
Q48624 6.67e-06 53 26 3 145 3 lacS Lactose permease Leuconostoc lactis
O32292 0.00012 44 31 0 69 3 yyzE Putative phosphotransferase enzyme IIA component YyzE Bacillus subtilis (strain 168)
Q87FD5 0.000126 48 30 3 112 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7A1Y1 0.000241 47 32 6 120 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 0.000241 47 32 6 120 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 0.000241 47 32 6 120 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 0.000241 47 32 6 120 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 0.000241 47 32 6 120 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 0.000241 47 32 6 120 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 0.000241 47 32 6 120 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q6GKB4 0.000258 47 32 6 120 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 0.000258 47 32 6 120 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8D4Z3 0.000458 47 32 3 84 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
Q7MBS2 0.000466 47 32 3 84 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00435
Feature type CDS
Gene nagE
Product N-acetylglucosamine-specific PTS transporter subunit IIBC
Location 92047 - 94083 (strand: 1)
Length 2037 (nucleotides) / 678 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_328
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00358 phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1
PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02804 N-acetylglucosamine PTS system EIICBA or EIICB component [EC:2.7.1.193] Amino sugar and nucleotide sugar metabolism
Phosphotransferase system (PTS)		 -

Protein Sequence

MGILSYLQRIGRALMVPVATLPAAAILMGVGYWIDPTGWGADNVVAAFLIKSGAAIIDNMSMLFAIGIAYGMSKDKDGAAALTGFVSFMVVTTLCSTATVGMIQGIPVEQVPAAFGKINNQFVGILVGVISAELYNRYSSVELPMALSFFSGRRLVPILASFVMILVSAILMYVWPLIYDALVSFGKSIKDLGAWGAGIYGFFNRLLIPVGLHHALNSVFWFNVADINDIPNFLGGQQSIDSGSAIAGITGRYQAGFFPIMMFGIPGAALAIYHCAKPENKAKVAGIMLAGAFAAFFTGITEPIEFSFMFVAPVLYVIHAFLTGISLFIAASMQWISGFGFSAGLVDMALSSRNPLATNWYMLIAQGLVFFALYYVVFRFVIKKFNLLTPGREAAMATNDTIDGYSENVSTSKTAKDEKKSIHSEARQYIAAIGGSDNLTGIDACITRLRLNVKDSALVSDTYAKQIGASGVIRLNKESVQVIVGTRAELIASAMRDVLKDGPVPAAQVTAAAQAESKASAKGNGKIVLSLVAPFDGEVVDLSDVPDEAFSGRVVGDGLAIKPESELVLAPAAGTVVKIFDTNHAFCLETDEGAEIIVHIGVDTVMLKGNGFTRLVEEGAQVAVGDPVLKLDLVYLNEHAKSMISPVIISNIDDYDKVEIVAKGVVKANESVLYHVMK

Flanking regions ( +/- flanking 50bp)

ATAATGCTGTAAAACAAAAAGCTGTCCGTGAGGGCAGCAAGGGGGAGTGAGTGGGTATATTAAGCTATTTGCAGCGGATTGGCCGTGCACTGATGGTGCCGGTTGCGACACTGCCGGCTGCGGCAATTCTGATGGGGGTCGGGTACTGGATCGATCCGACAGGCTGGGGTGCGGATAATGTTGTCGCCGCTTTCCTGATCAAGTCCGGTGCGGCTATCATCGATAATATGTCGATGCTGTTCGCTATCGGTATCGCTTATGGTATGTCAAAAGACAAAGACGGTGCGGCTGCACTGACCGGTTTTGTCAGCTTTATGGTGGTGACAACGCTGTGTTCTACCGCAACAGTCGGTATGATTCAGGGGATCCCGGTTGAACAGGTGCCTGCAGCATTCGGTAAAATCAATAATCAGTTTGTCGGTATCCTGGTCGGTGTTATTTCTGCTGAACTGTATAACCGTTACAGCAGTGTTGAGCTGCCGATGGCGCTTTCCTTCTTCAGCGGACGTCGCCTGGTGCCGATTCTGGCCTCTTTCGTGATGATCCTCGTCTCTGCGATTCTGATGTATGTCTGGCCGCTTATTTATGATGCGCTGGTATCATTCGGTAAGAGCATTAAAGACCTGGGCGCATGGGGCGCGGGGATTTACGGCTTCTTTAACCGTCTGTTAATTCCTGTTGGTCTGCATCACGCGCTGAACTCAGTATTCTGGTTCAACGTGGCAGATATTAACGATATCCCGAACTTCCTGGGCGGTCAGCAATCGATTGATTCTGGTAGCGCGATTGCAGGGATAACCGGGCGTTATCAGGCAGGGTTCTTCCCGATCATGATGTTTGGTATTCCGGGCGCTGCGCTGGCGATTTATCACTGCGCCAAACCGGAGAATAAAGCAAAAGTTGCCGGTATCATGCTGGCGGGGGCATTTGCGGCATTCTTTACAGGTATTACCGAGCCGATTGAATTCTCCTTTATGTTTGTGGCACCGGTGCTGTATGTCATCCACGCATTCCTGACAGGTATTTCGCTGTTCATTGCGGCATCAATGCAGTGGATTTCCGGTTTCGGCTTCAGCGCCGGGCTGGTGGATATGGCGCTCTCTTCACGCAATCCGCTGGCAACCAACTGGTACATGCTGATTGCGCAGGGGCTGGTTTTCTTCGCGCTTTATTATGTTGTCTTCCGTTTTGTTATCAAAAAATTCAATCTGTTAACCCCGGGGCGTGAAGCGGCGATGGCCACAAACGATACCATTGATGGTTACAGTGAGAATGTCAGTACATCCAAGACTGCCAAAGACGAGAAAAAATCCATTCACAGCGAAGCGCGTCAGTACATTGCGGCAATCGGCGGTTCAGATAACCTGACCGGCATTGACGCCTGTATCACCCGTCTGCGCCTGAATGTAAAAGACTCTGCGCTGGTGAGTGATACGTATGCGAAGCAGATTGGTGCGTCAGGGGTTATCCGTCTGAATAAAGAGAGTGTGCAGGTAATTGTCGGCACACGCGCAGAACTTATCGCCAGTGCGATGCGTGATGTGCTCAAAGACGGTCCGGTTCCTGCGGCTCAGGTCACTGCTGCTGCACAGGCAGAAAGTAAAGCGTCTGCAAAAGGGAACGGAAAAATTGTTCTGAGCCTGGTGGCACCATTTGATGGTGAAGTGGTGGACTTATCCGATGTACCGGATGAAGCATTTTCAGGGCGTGTGGTCGGCGATGGTCTGGCGATCAAACCGGAAAGTGAGCTTGTTCTGGCACCGGCTGCCGGTACGGTAGTGAAAATTTTCGATACTAACCATGCATTTTGTCTGGAAACAGATGAGGGTGCCGAAATTATTGTCCACATCGGTGTTGATACGGTGATGCTGAAAGGTAACGGCTTTACCCGCCTGGTTGAAGAAGGCGCACAGGTTGCAGTCGGCGACCCGGTGCTGAAACTGGATCTGGTGTATCTGAATGAACATGCCAAATCTATGATAAGCCCGGTAATCATCAGTAATATCGATGATTACGATAAGGTAGAGATAGTGGCGAAAGGTGTGGTTAAAGCGAATGAATCTGTGCTGTATCATGTCATGAAATAAGTGATTGCAGTTATGATAATAACGGGAGGCTTCGGCTTCCCGTTTTTTAT