Homologs in group_2727

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07465 FBDBKF_07465 100.0 Morganella morganii S1 glmS methylaspartate mutase subunit S
NLDBIP_13740 NLDBIP_13740 100.0 Morganella morganii S4 glmS methylaspartate mutase subunit S
LHKJJB_09110 LHKJJB_09110 100.0 Morganella morganii S3 glmS methylaspartate mutase subunit S
HKOGLL_08660 HKOGLL_08660 100.0 Morganella morganii S5 glmS methylaspartate mutase subunit S
F4V73_RS13650 F4V73_RS13650 93.2 Morganella psychrotolerans glmS methylaspartate mutase subunit S

Distribution of the homologs in the orthogroup group_2727

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2727

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JSN5 1.46e-81 239 80 1 147 3 glmS Glutamate mutase sigma subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q32IJ3 1.03e-75 224 78 0 136 3 glmS Glutamate mutase sigma subunit Shigella dysenteriae serotype 1 (strain Sd197)
P58620 1.03e-75 224 78 0 136 3 glmS Glutamate mutase sigma subunit Escherichia coli O157:H7
Q24SG7 8.98e-57 176 60 0 135 3 glmS Glutamate mutase sigma subunit Desulfitobacterium hafniense (strain Y51)
Q890S0 3.18e-52 165 56 0 134 3 glmS Glutamate mutase sigma subunit Clostridium tetani (strain Massachusetts / E88)
P80078 8.24e-52 164 56 0 134 1 glmS Glutamate mutase sigma subunit Clostridium cochlearium
Q3AFA7 4.07e-51 162 55 0 134 3 glmS Glutamate mutase sigma subunit Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q05488 1.42e-49 158 56 0 132 1 glmS Glutamate mutase sigma subunit Clostridium tetanomorphum
P61191 5.15e-44 144 50 0 133 3 glmS Glutamate mutase sigma subunit Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8RHY7 3.08e-43 142 48 0 135 3 glmS Glutamate mutase sigma subunit Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5V3F0 1.45e-37 128 46 1 130 3 glmS2 Glutamate mutase sigma subunit 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V467 1.79e-35 123 41 1 138 3 glmS1 Glutamate mutase sigma subunit 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9HN21 6.76e-29 106 39 2 138 3 glmS Glutamate mutase sigma subunit Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
A6H5Y3 5.44e-05 45 28 1 105 1 Mtr Methionine synthase Mus musculus
P58982 7.27e-05 44 30 1 92 3 mttC1 Trimethylamine corrinoid protein 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q4JIJ3 0.000104 44 28 1 105 2 MTR Methionine synthase Bos taurus
Q9Z2Q4 0.000111 44 28 1 105 1 Mtr Methionine synthase Rattus norvegicus
Q99707 0.000121 44 28 1 105 1 MTR Methionine synthase Homo sapiens
Q59268 0.000141 43 28 2 125 1 mgm 2-methyleneglutarate mutase Eubacterium barkeri
Q57195 0.000179 43 33 1 78 3 HI_1042 Uncharacterized protein HI_1042 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
E3PY95 0.000301 43 32 5 118 1 oraE D-ornithine 4,5-aminomutase subunit beta Acetoanaerobium sticklandii (strain ATCC 12662 / DSM 519 / JCM 1433 / CCUG 9281 / NCIMB 10654 / HF)
Q09582 0.000392 42 37 0 59 3 metr-1 Probable methionine synthase Caenorhabditis elegans
A8XY95 0.000683 42 37 0 59 3 metr-1 Probable methionine synthase Caenorhabditis briggsae
Q5KUG0 0.000708 42 34 4 107 1 icmF Fused isobutyryl-CoA mutase Geobacillus kaustophilus (strain HTA426)
Q8TTA8 0.00084 41 28 1 89 3 mttC1 Trimethylamine corrinoid protein 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TS74 0.001 41 25 1 89 3 mttC2 Trimethylamine corrinoid protein 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_17135
Feature type CDS
Gene glmS
Product methylaspartate mutase subunit S
Location 33004 - 33444 (strand: 1)
Length 441 (nucleotides) / 146 (amino acids)

Contig

Accession ZDB_231
Length 52966 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2727
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF02310 B12 binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2185 Lipid transport and metabolism (I) I Methylmalonyl-CoA mutase, C-terminal domain/subunit (cobalamin-binding)

Kegg Ortholog Annotation(s)

Protein Sequence

MQKPTIVIGVIGADCHAVGNKVLDRVFSQHNFNVINLGVMVSQDEYIDAAIETGAQAIVVSSIYGHGEVDCLGMRERCIERGLGEILLYVGGNLVIGKQEPAEIEKKFSDMGFNRVFFPSTDLEYVCDVMKKDIEKSPARKEGMTA

Flanking regions ( +/- flanking 50bp)

ATTTTGTTTTAACTTTAATTCCGAACATTCAGTTTATTTAGAGGTATATCATGCAGAAGCCTACCATTGTTATTGGTGTAATTGGTGCCGATTGCCATGCCGTCGGTAACAAAGTTTTAGATCGCGTGTTTTCCCAGCACAATTTTAATGTGATTAACCTGGGTGTCATGGTCAGCCAGGACGAATATATCGACGCCGCTATTGAAACCGGCGCACAGGCAATCGTTGTTTCCTCTATTTACGGTCACGGCGAAGTGGACTGTTTAGGTATGCGTGAGCGCTGCATCGAACGTGGTCTGGGCGAAATTCTGCTGTATGTCGGCGGTAACCTGGTTATCGGTAAACAGGAACCGGCTGAAATCGAGAAAAAATTCAGCGACATGGGCTTTAACCGCGTGTTCTTCCCGAGCACAGACCTGGAATACGTCTGCGATGTCATGAAAAAAGACATTGAAAAAAGCCCGGCCCGCAAAGAAGGAATGACCGCGTAATGATCAACGTCTCGATAGATATCGGTTCAACCTGGACAAAAGGTGCCGTG