Homologs in group_415

Help

7 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18070 FBDBKF_18070 100.0 Morganella morganii S1 dcm DNA-cytosine methylase
NLDBIP_17680 NLDBIP_17680 100.0 Morganella morganii S4 dcm DNA-cytosine methylase
LHKJJB_17600 LHKJJB_17600 100.0 Morganella morganii S3 dcm DNA-cytosine methylase
HKOGLL_17415 HKOGLL_17415 100.0 Morganella morganii S5 dcm DNA-cytosine methylase
F4V73_RS02270 F4V73_RS02270 31.1 Morganella psychrotolerans - DNA cytosine methyltransferase
F4V73_RS10160 F4V73_RS10160 47.3 Morganella psychrotolerans - DNA cytosine methyltransferase
F4V73_RS10225 F4V73_RS10225 85.8 Morganella psychrotolerans - DNA cytosine methyltransferase

Distribution of the homologs in the orthogroup group_415

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_415

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P34877 2.14e-129 379 54 7 363 3 scrFIAM Type II methyltransferase M1.ScrFI Lactococcus lactis subsp. cremoris
P34879 4.49e-125 368 51 7 360 3 ssoIIM Type II methyltransferase M.SsoII Shigella sonnei
P50185 1.78e-122 360 50 6 346 3 dsaVm Type II methyltransferase M.DsaV Dactylococcopsis salina
P24581 8.29e-120 352 55 7 347 3 nlaXM Type II methyltransferase M.NlaX Neisseria lactamica
P15446 9.73e-80 251 40 10 370 1 hpaIIM Type II methyltransferase M.HpaII Haemophilus parainfluenzae
P05102 1.14e-69 224 38 8 346 1 hhaIM Type II methyltransferase M.HhaI Haemophilus parahaemolyticus
P05101 1.24e-69 229 38 13 399 1 ecoRIIM Type II methyltransferase M.EcoRII Escherichia coli
Q59603 6.65e-67 217 40 8 337 3 ngoBIM Type II methyltransferase M.NgoBI Neisseria gonorrhoeae
O30868 5.28e-66 214 41 9 346 3 haeIIM Type II methyltransferase M.HaeII Haemophilus aegyptius
P17044 2.31e-64 213 38 10 354 1 hsdFM Type II methyltransferase M.BsuFI Bacillus subtilis
P11408 3.76e-64 213 37 11 351 3 mspIM Type II methyltransferase M.MspI Moraxella sp.
P0AED9 2.23e-63 212 40 13 378 1 dcm DNA-cytosine methyltransferase Escherichia coli (strain K12)
P0AEE0 2.23e-63 212 40 13 378 3 dcm DNA-cytosine methyltransferase Escherichia coli O157:H7
P43420 6.01e-57 191 34 11 355 3 bsp6IM Type II methyltransferase M.Bsp6I Bacillus sp. (strain RFL6)
P19888 6.22e-48 171 40 5 246 1 banIM Type II methyltransferase M.BanI Aneurinibacillus aneurinilyticus
P19888 1.49e-07 56 53 1 49 1 banIM Type II methyltransferase M.BanI Aneurinibacillus aneurinilyticus
P25263 3.35e-47 169 48 4 191 1 hgiCIM Type II methyltransferase M.HgiCI Herpetosiphon aurantiacus
P25263 9.41e-05 47 47 2 51 1 hgiCIM Type II methyltransferase M.HgiCI Herpetosiphon aurantiacus
P50182 6.38e-46 165 44 7 230 3 nlaIVM Type II methyltransferase M.NlaIV Neisseria lactamica
Q59605 8.04e-45 162 45 5 210 3 ngoBVM Type II methyltransferase M.NgoBV Neisseria gonorrhoeae
P50196 4.41e-34 133 29 10 367 3 eco47IIM Type II methyltransferase M.Eco47II Escherichia coli
P20589 4.5e-33 129 27 9 364 1 haeIIIM Type II methyltransferase M.HaeIII Haemophilus aegyptius
P34906 3.85e-32 126 27 10 359 3 fnuDIM Type II methyltransferase M.FnuDI Fusobacterium nucleatum
P25266 9.88e-32 127 34 5 248 3 hgiEIM Type II methylase M.HgiEI Herpetosiphon aurantiacus
P25264 4.78e-31 125 36 5 219 3 hgiCIIM Type II methyltransferase M.HgiCII Herpetosiphon aurantiacus
P25262 5.28e-31 125 37 5 218 3 hgiBIM Type II methyltransferase M.HgiBI Herpetosiphon aurantiacus
P00476 5.82e-31 125 35 5 203 3 None Orphan methyltransferase M.SPRI Bacillus phage SPR
P00476 0.000212 46 40 1 57 3 None Orphan methyltransferase M.SPRI Bacillus phage SPR
P08455 4.52e-30 121 26 9 388 3 ngoPIIM Type II methyltransferase M.NgoPII Neisseria gonorrhoeae
P34882 5.16e-30 118 35 6 215 1 aquIMA Type II methyltransferase M.AquIA Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P09915 6.53e-30 123 36 4 193 3 None Orphan methyltransferase M.Rho11sI Bacillus phage rho11s
P09915 2.53e-05 49 47 1 57 3 None Orphan methyltransferase M.Rho11sI Bacillus phage rho11s
O33481 2.49e-29 120 28 9 377 3 pspPIM Type II methyltransferase M.PspPI Psychrobacter sp. (strain TA137)
Q59606 6.93e-29 118 28 12 356 3 ngoFVIIM Type II methyltransferase M.NgoFVII Neisseria gonorrhoeae
P29567 2.78e-27 113 26 9 354 1 mthTIM Type II methyltransferase M.MthTI Methanothermobacter thermautotrophicus
P50192 8.93e-25 107 28 14 372 3 hphIAM Type II methyltransferase M1.HphI Haemophilus parahaemolyticus
P31974 1.91e-24 107 36 5 192 3 aluIM Type II methyltransferase M.AluI Cellulosimicrobium cellulans
P34878 1.01e-23 103 28 11 311 3 scrFIBM Type II methyltransferase M2.ScrFI Lactococcus lactis subsp. cremoris
P52311 3.75e-22 100 27 13 391 3 xorIIM Type II methyltransferase M.XorII Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
P23737 1.4e-21 99 26 6 291 1 sau96IM Type II methyltransferase M.Sau96I Staphylococcus aureus
P68586 2.68e-20 95 29 5 225 3 mtbP Orphan methyltransferase M.Phi3TI Bacillus phage phi3T
P68586 0.000577 45 40 1 57 3 mtbP Orphan methyltransferase M.Phi3TI Bacillus phage phi3T
P68585 2.68e-20 95 29 5 225 3 mtbP Putative type II methyltransferase M.BsuMIIP Bacillus subtilis (strain 168)
P68585 0.000577 45 40 1 57 3 mtbP Putative type II methyltransferase M.BsuMIIP Bacillus subtilis (strain 168)
P09389 2.68e-20 95 29 5 225 3 mtbP Orphan methyltransferase M.SPBetaI Bacillus phage SPbeta
P09389 0.000577 45 40 1 57 3 mtbP Orphan methyltransferase M.SPBetaI Bacillus phage SPbeta
P09795 1.35e-18 90 25 15 382 3 sinIM Type II methyltransferase M.SinI Salmonella infantis
P10283 2.63e-18 89 26 9 317 1 bepIM Type II methyltransferase M.BepI Brevibacterium epidermidis
P31033 4.12e-18 87 25 12 359 3 ngoMIVM Type II methyltransferase M.NgoMIV Neisseria gonorrhoeae
D4ZX35 2.91e-17 85 26 13 350 1 aplIM Type II methyltransferase M.AplI Arthrospira platensis (strain NIES-39 / UTEX 3086 / IAM M-135)
P06530 7.86e-17 85 24 12 381 1 hsdRM Type II methyltransferase M.BsuRI Bacillus subtilis
P50188 5.57e-16 82 24 10 361 3 naeIM Type II methyltransferase M.NaeI Lentzea aerocolonigenes
P13906 8.6e-16 81 24 17 396 1 bspRIM Type II methyltransferase M.BspRI Lysinibacillus sphaericus
O34680 1.39e-15 80 26 4 212 1 ydiP Type II methyltransferase M2.BsuMI Bacillus subtilis (strain 168)
P05302 1.41e-15 81 30 5 193 1 ddeIM Type II methyltransferase M.DdeI Desulfomicrobium norvegicum (strain DSM 1741 / NCIMB 8310)
P94147 2.15e-15 80 29 6 214 3 ageIM Type II methyltransferase M.AgeI Thalassovita gelatinovora
P16668 2.83e-15 80 24 19 428 3 sau3AIM Type II methyltransferase M.Sau3AI Staphylococcus aureus
P34905 1.22e-14 77 24 13 380 3 bbvIM Type II methyltransferase M.BbvI Brevibacillus brevis
P0DW08 3.46e-14 77 27 13 318 1 drmMII Type II methyltransferase M.Bpa9945I Bacillus paralicheniformis (strain ATCC 9945a / NCIMB 11709 / CD-2)
Q9YDP3 1.33e-13 75 30 9 224 1 APE_0872.1 DNA (cytosine-5-)-methyltransferase M.ApeKI Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8EL95 2.61e-12 71 27 5 225 3 OB3336 Putative type II methyltransferase M.OihORF3336P Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O52702 3.96e-12 70 28 4 188 1 apaLIM Type II methyltransferase M.ApaLI Acetobacter pasteurianus
P15840 5.96e-12 70 25 14 314 1 sssIM Orphan methyltransferase M.SssI Spiroplasma monobiae (strain ATCC 33825 / MQ-1)
P36216 2.27e-11 68 27 8 217 3 CVIJIM Type II methyltransferase M.CviJI Paramecium bursaria Chlorella virus IL3A
P45000 1.06e-09 62 29 9 186 3 hindVM Type II methyltransferase M.HindV Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25265 1.84e-09 62 21 12 368 3 hgiDIIM Type II methylase M.HgiDII Herpetosiphon aurantiacus
P24600 4.22e-09 60 29 7 193 3 hgiDIM Type II methyltransferase M.HgiDI Herpetosiphon aurantiacus
O31073 2.39e-08 58 26 8 202 3 sacIM Type II methyltransferase M.SacI Streptomyces achromogenes
Q9M0S8 5.38e-08 58 27 3 169 2 MET2 DNA (cytosine-5)-methyltransferase 2 Arabidopsis thaliana
Q71TL0 8.29e-08 57 25 7 210 1 dmt DNA N-6-adenine-methyltransferase Escherichia phage P1
B1Q3J6 9.38e-08 57 25 8 226 2 MET1B DNA (cytosine-5)-methyltransferase 1B Oryza sativa subsp. japonica
Q58600 1.7e-07 56 24 11 303 3 MJ1200 Putative type II methyltransferase M.MjaORF1200P Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O23273 2.42e-07 56 24 7 225 1 MET4 DNA (cytosine-5)-methyltransferase 4 Arabidopsis thaliana
P13864 2.55e-07 56 24 7 225 1 Dnmt1 DNA (cytosine-5)-methyltransferase 1 Mus musculus
Q24K09 2.76e-07 56 24 7 225 1 DNMT1 DNA (cytosine-5)-methyltransferase 1 Bos taurus
P34881 2.94e-07 56 25 8 228 1 DMT1 DNA (cytosine-5)-methyltransferase 1 Arabidopsis thaliana
Q27746 3.29e-07 56 23 7 228 2 DNMT DNA (cytosine-5)-methyltransferase PliMCI Paracentrotus lividus
P25267 6.89e-07 51 33 5 117 3 hgiGIM Type II methyltransferase M.HgiGI (Fragment) Herpetosiphon aurantiacus
P26358 2.24e-06 53 24 7 225 1 DNMT1 DNA (cytosine-5)-methyltransferase 1 Homo sapiens
Q9Z330 2.71e-06 53 23 7 225 1 Dnmt1 DNA (cytosine-5)-methyltransferase 1 Rattus norvegicus
Q7Y1I7 2.74e-06 53 24 7 225 2 MET1A DNA (cytosine-5)-methyltransferase 1A Oryza sativa subsp. japonica
F4JWT7 5.32e-06 51 24 6 186 1 DNMT2 tRNA (cytosine(38)-C(5))-methyltransferase 2 Arabidopsis thaliana
Q9T0I1 5.4e-06 52 28 4 146 3 MET3 DNA (cytosine-5)-methyltransferase 3 Arabidopsis thaliana
Q92072 6.51e-06 52 23 7 221 1 DNMT1 DNA (cytosine-5)-methyltransferase 1 Gallus gallus

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_16770
Feature type CDS
Gene dcm
Product DNA-cytosine methylase
Location 14718 - 15839 (strand: -1)
Length 1122 (nucleotides) / 373 (amino acids)

Contig

Accession ZDB_230
Length 55766 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_415
Orthogroup size 8
N. genomes 6

Actions

Genomic region

Domains

PF00145 C-5 cytosine-specific DNA methylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0270 Replication, recombination and repair (L) L DNA-cytosine methylase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00558 DNA (cytosine-5)-methyltransferase 1 [EC:2.1.1.37] Cysteine and methionine metabolism
Metabolic pathways
MicroRNAs in cancer		 Methionine degradation

Protein Sequence

MKKHPEDAPFRQSPEDNCRFTFIDLFAGIGGIRLPFQQQGGRCVFTSEWDKFAQRTYFANFGEMPDGDITRIAAKDIPDHDILLGGFPCQAFSQAGARQGFNDTRGTMFFEVQRIMTEKRPKAFLLENVKQLRGHDGGRTLQTILDILRGQYEQTVPDNIPLSEETRSALSQKLNYWVDFRVLRAADFGIPQNRERIFIIGFDRDQFPDADFDTLFSWPEPTHQPTCLGDILQSKKALAEDAVRYKKDRFTISDKLWAGHQKRKREHKARGNGFGYCLFNKNSEYTNTLSARYYKDGSEILIDQSRDGKNPRKLTPRECANLQGFPENYITDAVSQGQIYKQFGNSVCMTVVEAIAEQLTAALVRAGAIPPVK

Flanking regions ( +/- flanking 50bp)

GATAAAACCGGCGCACTGCCCGGCGGCTGTTTCCCGAACCGGAGATGATTTTGAAAAAACACCCAGAGGACGCCCCTTTCCGGCAGTCACCCGAGGATAATTGCAGATTCACTTTTATCGATCTTTTTGCCGGCATCGGCGGGATCCGCCTGCCCTTTCAGCAACAGGGCGGTCGTTGTGTGTTTACCTCTGAGTGGGATAAATTCGCCCAGCGCACCTATTTTGCCAATTTCGGTGAGATGCCTGACGGCGATATCACCCGGATCGCGGCAAAAGATATTCCGGATCACGATATTCTTCTCGGCGGTTTTCCGTGCCAGGCATTTTCACAGGCGGGGGCGCGTCAGGGGTTTAACGACACCCGTGGTACCATGTTCTTTGAAGTTCAGCGCATCATGACGGAGAAACGGCCGAAGGCATTTCTGCTGGAGAACGTCAAACAGCTGCGCGGCCACGACGGCGGCCGGACATTACAGACTATCCTCGATATTCTGCGCGGACAGTATGAACAGACTGTGCCGGATAATATTCCGCTGAGTGAAGAGACCCGCAGCGCGCTGTCGCAAAAACTGAACTATTGGGTTGATTTCCGCGTGCTGCGTGCCGCCGATTTTGGTATTCCGCAGAACCGCGAGCGTATTTTTATTATCGGTTTTGATCGCGACCAGTTTCCGGATGCGGACTTTGACACCTTATTTTCCTGGCCGGAACCGACTCATCAGCCTACCTGTCTCGGTGATATTCTCCAGAGCAAAAAAGCGCTGGCGGAAGATGCGGTGCGCTATAAAAAAGATCGTTTTACCATCTCCGATAAATTATGGGCCGGCCATCAGAAACGCAAAAGAGAACATAAAGCCAGAGGTAACGGCTTCGGATATTGCCTGTTTAATAAAAACAGCGAATATACCAATACCCTGAGCGCCCGCTATTATAAAGACGGTTCTGAGATCCTGATTGACCAGTCGCGGGACGGTAAAAACCCGCGCAAACTCACCCCGCGTGAATGTGCTAACCTCCAGGGATTTCCGGAAAACTATATTACCGATGCTGTTTCCCAGGGGCAGATTTATAAACAGTTCGGCAACTCCGTCTGTATGACCGTCGTCGAAGCCATAGCTGAACAACTCACGGCGGCATTAGTCCGGGCCGGTGCAATACCGCCGGTAAAATAATCTTCCGGCGGTACGGCGCATATTTTCCCGGCGAAATAGGGTAATCTGGG