Homologs in group_3462

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15695 FBDBKF_15695 100.0 Morganella morganii S1 spoIVCA Site-specific DNA recombinase SpoIVCA/DNA invertase PinE
NLDBIP_16315 NLDBIP_16315 100.0 Morganella morganii S4 spoIVCA Site-specific DNA recombinase SpoIVCA/DNA invertase PinE
LHKJJB_16485 LHKJJB_16485 100.0 Morganella morganii S3 spoIVCA Site-specific DNA recombinase SpoIVCA/DNA invertase PinE
HKOGLL_16255 HKOGLL_16255 100.0 Morganella morganii S5 spoIVCA Site-specific DNA recombinase SpoIVCA/DNA invertase PinE

Distribution of the homologs in the orthogroup group_3462

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3462

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P03015 7.88e-52 168 49 6 199 1 gin Serine recombinase gin Escherichia phage Mu
Q38199 1.64e-51 167 49 7 199 2 gin Serine recombinase gin Escherichia phage D108
P03014 1.86e-48 159 50 7 194 3 pinE Serine recombinase PinE Escherichia coli (strain K12)
P18358 1.05e-43 147 42 4 188 3 tnpR Transposon Tn552 resolvase Staphylococcus aureus
P10311 1.75e-43 146 55 3 146 3 cin DNA-invertase Escherichia phage P1
P21703 2.32e-43 146 55 3 146 3 cin DNA-invertase Enterobacteria phage P7
P03013 1.71e-42 144 45 5 186 1 hin DNA-invertase hin Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P19241 2.98e-42 144 41 4 188 3 resR Transposon Tn552 DNA-invertase BinR Staphylococcus aureus
Q02869 2.41e-40 139 44 5 186 3 hin DNA-invertase Salmonella abortus-equi
P06693 3.83e-35 125 35 4 191 3 tnpR Transposon Tn917 resolvase Enterococcus faecalis
P18957 5.99e-30 112 37 4 192 3 uvp1 Protein uvp1 Escherichia coli
P07945 3e-29 110 31 2 185 3 res Resolvase Clostridium perfringens
P55389 7.02e-27 107 44 3 146 3 NGR_a00070 Probable DNA-invertase y4cG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P05823 1.07e-26 103 36 5 188 3 tnpR Transposon Tn2501 resolvase Escherichia coli
P04130 3.01e-26 102 36 4 188 3 tnpR Transposon Tn21 resolvase Escherichia coli
P0ADI0 6.94e-25 99 34 5 188 1 pinR Serine recombinase PinR Escherichia coli (strain K12)
P0ADI1 6.94e-25 99 34 5 188 3 pinR Putative DNA-invertase from lambdoid prophage Rac Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77170 1.4e-24 98 34 5 188 3 pinQ Serine recombinase PinQ Escherichia coli (strain K12)
Q93MD2 1.61e-24 98 30 2 185 3 res Resolvase Clostridium perfringens (strain 13 / Type A)
P0C1G3 2.32e-23 95 34 4 188 3 tnpR Transposons Tn4653 resolvase Pseudomonas putida
P0C1G2 2.32e-23 95 34 4 188 3 tnpR Transposons Tn1721 resolvase Escherichia coli
P06691 9.25e-23 93 34 4 188 3 tnpR Transposon Tn501 resolvase Pseudomonas aeruginosa
P03012 9.57e-23 93 33 3 188 1 tnpR Transposon gamma-delta resolvase Escherichia coli (strain K12)
P13606 2.5e-21 89 33 3 184 3 tnpR R46 site-specific recombinase Escherichia coli
P0ADI3 8.75e-21 88 32 3 184 3 tnpR Transposon Tn3 resolvase Klebsiella pneumoniae
P0ADI2 8.75e-21 88 32 3 184 1 tnpR Transposon Tn3 resolvase Escherichia coli
P55559 1.43e-20 87 38 7 184 3 NGR_a02590 Integrase-like protein y4lS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P21424 2.11e-20 87 32 3 184 3 tnpR Transposon Tn1331 resolvase Klebsiella pneumoniae
P30739 9.91e-19 82 33 4 184 3 None Resolvase/recombinase Pseudomonas putida
P20384 1.27e-15 75 30 6 200 1 bin3 Putative transposon Tn552 DNA-invertase bin3 Staphylococcus aureus
Q06237 4.82e-15 73 25 3 189 3 None Transposon Tn1546 resolvase Enterococcus faecium
P17867 3.03e-05 47 29 5 148 3 cisA Putative DNA recombinase Bacillus subtilis (strain 168)
O35034 7.54e-05 43 39 4 79 3 yefC Resolvase homolog YefC Bacillus subtilis (strain 168)
Q52563 0.000282 43 35 2 73 3 stbA Resolvase Pseudomonas syringae pv. tomato

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_16050
Feature type CDS
Gene spoIVCA
Product Site-specific DNA recombinase SpoIVCA/DNA invertase PinE
Location 73791 - 74405 (strand: 1)
Length 615 (nucleotides) / 204 (amino acids)
In genomic island GI15

Contig

Accession ZDB_227
Length 79950 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3462
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF00239 Resolvase, N terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1961 Replication, recombination and repair (L) L Site-specific DNA recombinase SpoIVCA/DNA invertase PinE

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14060 putative DNA-invertase from lambdoid prophage Rac - -

Protein Sequence

MLIGYMRVSKADGSQATDLQRDALIAAGVDPVHLYEDQASGMREDRPGLTSCLKALRTGDTLVVWKLDRLGRDLRHLINTVHDLTGRGIGLKVLTGHGAAIDTTTAAGKLVFGIFAALAEFERELIAERTIAGLASARARGRKGGRPFKMTAAKLRLAMAAMGQPETKVGDLCQELGVTRQTLYRHVSPKGELRPDGEKLLSRI

Flanking regions ( +/- flanking 50bp)

TTTCCGGTGCACACTGTCACATAATCGAACGTATATGTGACAGGTACGACATGCTGATAGGCTACATGCGGGTATCGAAGGCGGACGGCTCCCAGGCTACCGATTTGCAGCGCGACGCGCTGATTGCCGCCGGGGTCGATCCAGTACATCTTTACGAGGACCAGGCATCCGGCATGCGCGAGGATCGGCCCGGCTTGACGAGCTGCCTGAAGGCGTTGCGAACTGGCGACACACTGGTCGTGTGGAAACTGGATCGGCTCGGACGCGACCTGCGACATCTCATCAACACCGTGCACGACCTGACTGGGCGCGGCATCGGCTTGAAGGTATTAACCGGGCACGGCGCGGCCATCGACACTACGACCGCCGCCGGCAAGCTGGTCTTTGGCATCTTCGCCGCCCTGGCCGAGTTCGAGCGCGAGTTGATCGCGGAGCGCACGATTGCCGGCCTAGCCTCGGCCCGCGCGCGCGGGCGGAAAGGCGGCCGGCCGTTCAAGATGACCGCCGCCAAGCTGCGGCTGGCGATGGCGGCAATGGGTCAGCCAGAGACCAAGGTCGGCGACCTGTGCCAGGAACTTGGCGTCACGCGGCAGACCCTGTATCGGCATGTTTCACCCAAGGGTGAGCTACGTCCAGATGGCGAGAAGCTACTCAGCCGAATTTGATGCCGGCATGAGGCAACGTAGCGACAGCGTGGTTTGTCTCAATGGGAAGC