Homologs in group_305

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08170 FBDBKF_08170 100.0 Morganella morganii S1 ilvE branched-chain amino acid transaminase
NLDBIP_13695 NLDBIP_13695 100.0 Morganella morganii S4 ilvE branched-chain amino acid transaminase
LHKJJB_12860 LHKJJB_12860 100.0 Morganella morganii S3 ilvE branched-chain amino acid transaminase
HKOGLL_12170 HKOGLL_12170 100.0 Morganella morganii S5 ilvE branched-chain amino acid transaminase
F4V73_RS18700 F4V73_RS18700 97.8 Morganella psychrotolerans - branched-chain amino acid transaminase
PMI_RS08325 PMI_RS08325 31.9 Proteus mirabilis HI4320 - D-amino-acid transaminase
PMI_RS16410 PMI_RS16410 90.0 Proteus mirabilis HI4320 - branched-chain amino acid transaminase

Distribution of the homologs in the orthogroup group_305

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_305

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A1A5 1.25e-152 429 89 0 229 1 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1A6 1.25e-152 429 89 0 229 3 ilvE Branched-chain-amino-acid aminotransferase Salmonella typhi
P0AB80 2.09e-151 426 88 0 229 1 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli (strain K12)
P0AB81 2.09e-151 426 88 0 229 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AB82 2.09e-151 426 88 0 229 3 ilvE Branched-chain-amino-acid aminotransferase Escherichia coli O157:H7
O27481 2.86e-84 255 56 1 224 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O86428 3.13e-73 228 51 2 223 1 ilvE Branched-chain-amino-acid aminotransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O67733 4.48e-52 173 41 5 232 3 ilvE Probable branched-chain-amino-acid aminotransferase Aquifex aeolicus (strain VF5)
O29329 8.23e-45 154 40 3 213 1 ilvE Putative branched-chain-amino-acid aminotransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q58414 8.32e-43 149 39 3 223 3 ilvE Putative branched-chain-amino-acid aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1RIJ2 5.52e-34 126 36 3 190 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia bellii (strain RML369-C)
P54691 4.03e-33 124 33 6 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q92I26 4.51e-33 124 34 3 190 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULR3 1.99e-31 119 33 3 190 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8CQ78 4.43e-31 120 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRJ8 5.4e-31 120 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P63513 1.35e-29 116 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MW2)
Q6GBT3 1.35e-29 116 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MSSA476)
P99138 1.35e-29 116 35 5 223 1 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain N315)
P63512 1.35e-29 116 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIC1 1.35e-29 116 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain COL)
Q6GJB4 3.96e-29 115 35 5 223 3 ilvE Probable branched-chain-amino-acid aminotransferase Staphylococcus aureus (strain MRSA252)
Q9AKE5 9.71e-29 112 32 3 190 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
O05970 6.5e-27 107 31 3 190 3 ilvE Probable branched-chain-amino-acid aminotransferase Rickettsia prowazekii (strain Madrid E)
O86505 8.51e-26 106 34 8 250 3 ilvE Probable branched-chain-amino-acid aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
K7QHS5 3.46e-25 105 34 6 217 1 BCAT2 Branched-chain amino acid aminotransferase 2, chloroplastic Humulus lupulus
Q9M401 1.54e-24 103 34 6 217 1 BCAT3 Branched-chain-amino-acid aminotransferase 3, chloroplastic Arabidopsis thaliana
Q9FYA6 2.29e-23 100 33 6 217 1 BCAT5 Branched-chain-amino-acid aminotransferase 5, chloroplastic Arabidopsis thaliana
P9WQ75 1.07e-22 97 34 9 230 1 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ74 1.07e-22 97 34 9 230 3 ilvE Branched-chain-amino-acid aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ASR4 1.46e-22 99 33 2 159 2 At5g27410 Branched-chain-amino-acid aminotransferase-like protein 2 Arabidopsis thaliana
P54692 1.08e-21 93 38 1 126 3 dat D-alanine aminotransferase Bacillus licheniformis
Q9LPM9 1.19e-21 94 32 7 223 1 BCAT6 Branched-chain-amino-acid aminotransferase 6 Arabidopsis thaliana
Q8W0Z7 5.54e-21 94 33 3 163 2 At3g05190 Branched-chain-amino-acid aminotransferase-like protein 1 Arabidopsis thaliana
O31461 2.84e-20 90 30 5 227 1 ilvE Branched-chain-amino-acid transaminase 1 Bacillus subtilis (strain 168)
O32954 1.21e-19 89 32 9 230 3 ilvE Probable branched-chain-amino-acid aminotransferase Mycobacterium leprae (strain TN)
Q9M439 1.48e-19 89 31 7 220 1 BCAT2 Branched-chain-amino-acid aminotransferase 2, chloroplastic Arabidopsis thaliana
Q9LPM8 2.07e-19 88 31 6 238 5 BCAT7 Putative branched-chain-amino-acid aminotransferase 7 Arabidopsis thaliana
P54694 2.31e-19 87 30 6 216 3 dat D-alanine aminotransferase Staphylococcus haemolyticus
P19938 8.77e-19 85 29 5 211 1 dat D-alanine aminotransferase Bacillus sp. (strain YM-1)
K7QKH1 1.28e-18 86 30 6 221 1 BCAT1 Branched-chain amino acid aminotransferase 1, mitochondrial Humulus lupulus
P39576 1.94e-18 85 30 6 227 1 ilvK Branched-chain-amino-acid aminotransferase 2 Bacillus subtilis (strain 168)
A0R066 1.94e-18 85 34 10 236 1 ilvE Branched-chain-amino-acid aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q93Y32 5.68e-18 84 32 7 224 1 BCAT1 Branched-chain-amino-acid aminotransferase 1, mitochondrial Arabidopsis thaliana
A0A179HME7 8.92e-18 84 28 7 230 2 lcsP Aminotransferase lcsP Purpureocillium lilacinum
Q9LE06 1.39e-17 83 29 6 214 1 BCAT4 Methionine aminotransferase BCAT4 Arabidopsis thaliana
O07597 2.29e-17 82 38 1 126 3 dat D-alanine aminotransferase Bacillus subtilis (strain 168)
Q9ZJF1 8.07e-17 81 29 8 239 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q5HF24 2.39e-16 79 37 0 98 3 dat D-alanine aminotransferase Staphylococcus aureus (strain COL)
Q6G8H7 2.42e-16 79 37 0 98 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MSSA476)
Q8NW24 2.44e-16 79 37 0 98 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MW2)
Q6GFV1 2.44e-16 79 37 0 98 3 dat D-alanine aminotransferase Staphylococcus aureus (strain MRSA252)
P99090 3.69e-16 78 36 0 98 1 dat D-alanine aminotransferase Staphylococcus aureus (strain N315)
P63511 3.69e-16 78 36 0 98 3 dat D-alanine aminotransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
O26004 4.89e-16 79 29 8 242 3 ilvE Branched-chain-amino-acid aminotransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8CS41 8.26e-16 77 28 4 213 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNG0 8.26e-16 77 28 4 213 3 dat D-alanine aminotransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0DJL9 8.96e-16 77 32 1 131 3 dat D-alanine aminotransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2JZ74 9.61e-16 77 32 1 131 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 1/2a (strain 10403S)
P54693 1.13e-15 77 28 4 206 3 dat D-alanine aminotransferase Lysinibacillus sphaericus
Q71Z49 1.15e-15 77 32 1 126 3 dat D-alanine aminotransferase Listeria monocytogenes serotype 4b (strain F2365)
Q9KQI0 1.61e-15 76 28 4 182 3 pabC Aminodeoxychorismate lyase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74921 2.48e-15 76 31 3 166 1 ilvE Probable branched-chain-amino-acid aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q92B90 7.11e-15 75 31 1 126 3 dat D-alanine aminotransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7SLW1 5.37e-14 73 27 7 238 3 v1g246094 Branched-chain-amino-acid aminotransferase Nematostella vectensis
Q54N47 2.55e-13 71 29 10 231 3 bcaA Branched-chain-amino-acid aminotransferase Dictyostelium discoideum
Q5AV04 2.38e-12 68 27 7 229 2 atnJ Aminotransferase atnJ Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
I1R9B6 6.66e-12 67 26 7 226 3 FGRAMPH1_01T00157 Aminotransferase FGSG_00049 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5AV02 1.05e-11 67 28 10 242 2 atnH Branched-chain-amino-acid aminotransferase atnH Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P54689 1.54e-11 66 29 10 248 3 ilvE Branched-chain-amino-acid aminotransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O14370 1.85e-11 66 32 12 243 1 eca39 Branched-chain-amino-acid aminotransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P28821 5.37e-11 64 30 1 126 3 pabC Aminodeoxychorismate lyase Bacillus subtilis (strain 168)
P24288 7.2e-11 64 34 10 196 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Mus musculus
P47176 9.42e-11 63 29 9 233 1 BAT2 Branched-chain-amino-acid aminotransferase, cytosolic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54687 4.49e-10 62 30 12 234 1 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Homo sapiens
K0E3V3 1.25e-09 60 26 7 231 1 htyB Transaminase htyB Aspergillus rugulosus
P54690 1.68e-09 60 33 10 196 1 Bcat1 Branched-chain-amino-acid aminotransferase, cytosolic Rattus norvegicus
C9K7B6 1.74e-09 60 25 7 234 2 AMT5 Transaminase AMT5 Alternaria alternata
Q9GKM4 1.91e-09 60 29 12 234 2 BCAT1 Branched-chain-amino-acid aminotransferase, cytosolic Ovis aries
Q5EA40 3.3e-09 59 27 8 193 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Bos taurus
C9K7D8 3.3e-09 59 25 7 234 3 AMT5-2 Transaminase AMT5-2 Alternaria alternata
O15382 4.62e-09 59 27 8 193 1 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Homo sapiens
Q5REP0 5.07e-09 58 27 7 193 2 BCAT2 Branched-chain-amino-acid aminotransferase, mitochondrial Pongo abelii
S7ZEI5 7.7e-09 58 26 7 226 1 poxL Aminotransferase poxL Penicillium oxalicum (strain 114-2 / CGMCC 5302)
P54688 8.3e-09 58 32 8 190 2 bcat-1 Branched-chain-amino-acid aminotransferase, cytosolic Caenorhabditis elegans
A0A1W5T1Y5 8.78e-09 58 26 7 226 1 poxL Aminotransferase poxL Penicillium oxalicum
Q9Y885 1.11e-08 57 24 7 230 3 TOXF Aminotransferase TOXF Cochliobolus carbonum
P28305 1.62e-08 57 29 0 102 1 pabC Aminodeoxychorismate lyase Escherichia coli (strain K12)
P38891 2.07e-08 57 29 10 234 1 BAT1 Branched-chain-amino-acid aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
S0DS11 2.55e-08 57 24 7 226 1 apf4 Aminotransferase apf4 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A9UZ24 2.72e-08 57 27 6 180 3 37018 Branched-chain-amino-acid aminotransferase Monosiga brevicollis
Q56693 4.19e-08 55 26 1 130 3 pabC Aminodeoxychorismate lyase Vibrio harveyi
O35855 2.97e-07 53 26 8 202 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Mus musculus
O35854 5e-07 53 27 8 202 1 Bcat2 Branched-chain-amino-acid aminotransferase, mitochondrial Rattus norvegicus
S3DQP8 1.11e-06 52 25 5 183 1 gloG Branched-chain amino acid aminotransferase gloG Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q8L493 3.01e-05 47 29 2 128 1 DAAT D-amino-acid transaminase, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_13355
Feature type CDS
Gene ilvE
Product branched-chain-amino-acid transaminase
Location 155503 - 156195 (strand: -1)
Length 693 (nucleotides) / 230 (amino acids)

Contig

Accession ZDB_222
Length 162442 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_305
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01063 Amino-transferase class IV

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0115 Amino acid transport and metabolism (E)
Coenzyme transport and metabolism (H)		 EH Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase

Kegg Ortholog Annotation(s)

Protein Sequence

MEACRATLRKNNLSSGYIRPLVFIGDVGMGVNPPQGYKTDVIIAAFPWGAYLGEEALDAGIDAMVSSWNRAAPNTIPTAAKAGGNYLSSLLVGSEARRHGYQEGIALDVNGYISEGAGENLFEVKNNIIFTPPFTSSALPGITRDAILTLAKELGYEIREQTLSRESLYLADEVFMTGTAAEVTPVRSVDGIQVGIGRCGPVTKEIQQAFFGLFTGKTEDKWGWLDPVNP

Flanking regions ( +/- flanking 50bp)

ACTCCGCCAAAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAATTAATGGAAGCCTGCCGCGCCACGCTGCGCAAAAATAATTTATCCAGTGGTTATATCCGTCCGCTGGTCTTTATCGGTGATGTCGGTATGGGTGTTAACCCGCCGCAGGGCTATAAAACCGATGTCATCATCGCGGCATTCCCGTGGGGTGCTTACCTGGGTGAGGAAGCGCTGGATGCAGGGATTGACGCGATGGTGTCATCCTGGAACCGCGCAGCCCCTAACACCATTCCGACAGCGGCCAAAGCAGGCGGTAACTACCTGTCCTCGTTACTGGTCGGCAGTGAAGCCCGCCGTCACGGTTATCAGGAAGGGATTGCGCTGGATGTGAACGGTTATATCTCTGAAGGGGCGGGTGAAAACCTGTTTGAAGTGAAAAATAACATTATCTTCACTCCGCCATTTACCTCTTCCGCACTGCCGGGTATTACCCGTGATGCGATTCTGACCCTGGCAAAAGAGCTGGGTTATGAAATCCGTGAGCAGACGCTATCCCGCGAATCACTCTATCTGGCGGATGAAGTCTTTATGACCGGTACTGCGGCGGAAGTTACGCCGGTACGCAGTGTTGACGGTATTCAGGTGGGTATCGGCCGCTGCGGACCGGTTACCAAAGAGATCCAGCAGGCATTCTTTGGCCTGTTCACCGGGAAAACAGAAGACAAATGGGGCTGGTTAGATCCGGTAAATCCATAATAACGAAACAGATTTGCAGGCGGGTCGTTCCCCCGCCTGATTTTTGCAAA