Homologs in group_2684

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05205 FBDBKF_05205 100.0 Morganella morganii S1 qseB quorum sensing response regulator transcription factor QseB
NLDBIP_12725 NLDBIP_12725 100.0 Morganella morganii S4 qseB quorum sensing response regulator transcription factor QseB
LHKJJB_12585 LHKJJB_12585 100.0 Morganella morganii S3 qseB quorum sensing response regulator transcription factor QseB
HKOGLL_11200 HKOGLL_11200 100.0 Morganella morganii S5 qseB quorum sensing response regulator transcription factor QseB
F4V73_RS05665 F4V73_RS05665 86.5 Morganella psychrotolerans qseB quorum sensing response regulator transcription factor QseB

Distribution of the homologs in the orthogroup group_2684

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2684

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P66795 8.94e-107 309 68 0 217 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 8.94e-107 309 68 0 217 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
P52076 4.33e-106 307 67 0 219 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q8XBS3 4.72e-106 307 67 0 219 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P45337 5.48e-98 287 63 0 218 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HV32 7.42e-69 213 51 0 214 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I0I1 8.82e-56 180 45 1 215 1 carR Response regulator protein CarR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0R3I8 1.19e-54 177 43 3 222 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1TEL7 2.4e-53 174 42 3 223 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1B3X8 7.92e-53 172 43 2 222 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 7.92e-53 172 43 2 222 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 7.92e-53 172 43 2 222 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
A0PWB4 1.76e-52 172 42 3 224 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q742C1 5.62e-52 170 41 2 222 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 5.62e-52 170 41 2 222 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q70FH0 9.31e-52 169 42 0 221 3 pmrA Transcriptional regulatory protein PmrA Pectobacterium parmentieri
P30843 1.53e-51 169 40 0 222 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
Q9CD68 3.42e-50 166 41 2 222 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A1KHB7 4.6e-50 166 40 2 222 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 4.6e-50 166 40 2 222 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P36556 1.06e-49 164 38 0 221 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGM9 3.03e-49 163 40 2 222 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 3.03e-49 163 40 2 222 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 3.03e-49 163 40 2 222 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P0ACZ8 4.08e-48 160 39 2 220 1 cusR Transcriptional regulatory protein CusR Escherichia coli (strain K12)
P0ACZ9 4.08e-48 160 39 2 220 3 cusR Transcriptional regulatory protein CusR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AD00 4.08e-48 160 39 2 220 3 cusR Transcriptional regulatory protein CusR Escherichia coli O157:H7
Q47456 5.66e-48 160 39 1 218 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
Q8GP20 1.89e-47 158 39 0 218 1 rssB Swarming motility regulation protein RssB Serratia marcescens
Q02540 4.47e-46 155 38 2 226 1 copR Transcriptional activator protein CopR Pseudomonas syringae pv. tomato
Q9ZHD3 6.02e-46 155 40 3 222 3 silR Probable transcriptional regulatory protein SilR Salmonella typhimurium
P0CL17 1.53e-45 154 39 2 223 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 1.53e-45 154 39 2 223 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P0DMK7 2.91e-45 153 40 2 219 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 2.91e-45 153 40 2 219 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q44006 3.96e-44 150 39 2 219 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
L7N689 4e-43 149 37 2 221 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P76340 1.98e-41 143 37 3 218 1 hprR Transcriptional regulatory protein HprR Escherichia coli (strain K12)
Q7D9K0 1.71e-40 142 39 1 218 3 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07776 1.71e-40 142 39 1 218 1 tcrA Transcriptional regulatory protein TcrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q01473 3.42e-40 148 38 1 219 3 rcaC Protein RcaC Microchaete diplosiphon
Q01473 4.42e-07 53 28 1 119 3 rcaC Protein RcaC Microchaete diplosiphon
P0A4H8 4.8e-40 139 38 7 225 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 4.8e-40 139 38 7 225 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q55933 1.95e-39 138 37 5 231 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9I4F9 7.86e-39 136 37 5 227 1 phoP Two-component response regulator PhoP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q50136 9.04e-39 137 39 4 209 3 prrA Transcriptional regulatory protein PrrA Mycobacterium leprae (strain TN)
P9WGM1 1.84e-38 136 38 2 207 1 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM0 1.84e-38 136 38 2 207 3 prrA Transcriptional regulatory protein PrrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z7 1.84e-38 136 38 2 207 3 prrA Transcriptional regulatory protein PrrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q47744 2.81e-38 135 35 2 214 3 vanRB Regulatory protein VanRB Enterococcus faecalis (strain ATCC 700802 / V583)
O69730 4.27e-38 135 38 2 219 1 tcrX Probable transcriptional regulatory protein TcrX Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P55701 4.72e-38 134 34 2 219 4 NGR_a00800 Probable transcriptional regulatory protein y4xI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0C001 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 6.98e-38 134 34 4 219 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 6.98e-38 134 34 4 219 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q4L6C6 1.04e-37 133 35 5 218 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P0A4I2 1.84e-37 133 38 1 215 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 1.84e-37 133 38 1 215 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q99U73 1.75e-36 130 33 4 218 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q82EB1 4.12e-36 130 35 3 227 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P32040 7.58e-36 129 37 3 232 3 SYNPCC7002_A0851 Probable transcriptional regulatory protein SYNPCC7002_A0851 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O34903 1.03e-35 129 35 3 220 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P94413 1.1e-35 128 34 6 233 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)
Q9ZEP4 1.24e-35 129 35 3 226 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q49XM7 1.53e-35 128 35 5 220 3 arlR Response regulator ArlR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P39663 1.55e-35 129 36 4 233 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P42244 6.03e-35 126 34 3 226 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
P0A4I0 5.74e-34 124 32 2 220 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 5.74e-34 124 32 2 220 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
B8H358 9.37e-34 124 34 3 229 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 9.37e-34 124 34 3 229 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8Z7H2 3.16e-33 122 34 1 219 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhi
Q8CP82 3.33e-33 122 35 3 217 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPC3 3.33e-33 122 35 3 217 3 arlR Response regulator ArlR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9F868 4.87e-33 122 34 3 222 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P23836 5.25e-33 121 33 1 219 1 phoP Transcriptional regulatory protein PhoP Escherichia coli (strain K12)
Q83RR0 6.1e-33 121 33 1 219 3 phoP Virulence transcriptional regulatory protein PhoP Shigella flexneri
Q8CXZ9 6.1e-33 121 33 1 219 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A6WZ81 7.11e-33 121 34 3 229 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0DM78 7.59e-33 121 34 1 219 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP95 7.59e-33 121 34 1 219 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA1 7.59e-33 121 34 1 219 2 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain SL1344)
D0ZV90 7.59e-33 121 34 1 219 1 phoP Virulence transcriptional regulatory protein PhoP Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ1 7.59e-33 121 34 1 219 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC3 7.59e-33 121 34 1 219 3 phoP Virulence transcriptional regulatory protein PhoP Salmonella choleraesuis (strain SC-B67)
P13792 8.66e-33 121 32 2 228 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P9WGL9 1.12e-32 120 35 4 222 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 1.12e-32 120 35 4 222 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 1.12e-32 120 35 4 222 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45606 1.17e-32 120 33 3 220 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
P0AFJ5 1.39e-32 120 33 3 220 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 1.39e-32 120 33 3 220 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q8FZ93 1.52e-32 120 34 3 229 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 1.52e-32 120 34 3 229 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 1.52e-32 120 34 3 229 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 1.52e-32 120 34 3 229 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 1.52e-32 120 34 3 229 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 1.52e-32 120 34 3 229 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 1.52e-32 120 34 3 229 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 1.52e-32 120 34 3 229 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
Q8X738 2.56e-32 120 33 1 219 3 phoP Transcriptional regulatory protein PhoP Escherichia coli O157:H7
Q93CB8 3.06e-32 119 36 2 221 3 mtrA DNA-binding response regulator MtrA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P9WGM7 3.52e-32 119 36 2 221 1 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM6 3.52e-32 119 36 2 221 3 mtrA DNA-binding response regulator MtrA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z5 3.52e-32 119 36 2 221 3 mtrA DNA-binding response regulator MtrA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0QTK2 4.7e-32 119 36 2 221 1 mtrA DNA-binding response regulator MtrA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45607 4.92e-32 119 33 3 220 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P45605 8.04e-32 119 33 3 220 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
Q9CCJ2 1.44e-31 118 36 2 221 3 mtrA DNA-binding response regulator MtrA Mycobacterium leprae (strain TN)
Q5HLN2 1.96e-31 117 30 2 223 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q55890 1.45e-30 115 33 3 233 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8CN92 4.24e-30 114 30 2 223 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A0U4 4.53e-30 114 32 4 235 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 4.53e-30 114 32 4 235 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 4.53e-30 114 32 4 235 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 4.53e-30 114 32 4 235 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 4.53e-30 114 32 4 235 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 4.53e-30 114 32 4 235 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 4.53e-30 114 32 4 235 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 4.53e-30 114 32 4 235 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q4LAJ9 5.86e-30 114 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus haemolyticus (strain JCSC1435)
Q8CQK0 7.49e-30 114 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK18 7.49e-30 114 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q52990 8.93e-30 113 33 3 220 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Rhizobium meliloti (strain 1021)
Q7A216 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MW2)
Q9RDT5 1.26e-29 113 28 3 231 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus
A8YYU1 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD72 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MSSA476)
Q6GKS7 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain MRSA252)
Q7A8E1 1.26e-29 113 28 3 231 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain N315)
Q99XF3 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QD57 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Newman)
Q5HJX7 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain COL)
Q2YUQ3 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INQ9 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH9)
Q2G2U6 1.26e-29 113 28 3 231 1 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN8 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain USA300)
A6TXG8 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain JH1)
A7WWQ5 1.26e-29 113 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P35163 1.86e-29 112 33 6 231 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q4A160 2.77e-29 112 28 3 231 3 walR Transcriptional regulatory protein WalR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KM23 2.47e-28 110 33 3 213 1 vxrB Transcriptional regulatory protein VxrB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P69228 5.5e-28 109 32 3 220 1 baeR Transcriptional regulatory protein BaeR Escherichia coli (strain K12)
P69229 5.5e-28 109 32 3 220 1 baeR Transcriptional regulatory protein BaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23620 7.5e-28 108 29 4 221 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DPL7 9.97e-28 108 31 4 232 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 9.97e-28 108 31 4 232 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 9.97e-28 108 31 4 232 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P45189 1.62e-27 107 29 3 219 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9AE24 7.57e-27 106 29 2 220 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
P54884 8.03e-27 105 34 4 195 3 rgx3 Sensory transduction protein RegX3 Mycobacterium leprae (strain TN)
P08368 1.45e-26 105 32 2 219 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
Q31S42 1.52e-26 105 32 3 226 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P48259 1.7e-26 105 31 4 228 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
O06978 2.18e-26 104 31 3 232 3 yvcP Uncharacterized transcriptional regulatory protein YvcP Bacillus subtilis (strain 168)
Q7A1J1 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain MW2)
Q6GBC4 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain MSSA476)
Q6GIT6 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain MRSA252)
Q7A6V3 3.13e-26 104 30 5 223 1 saeR Response regulator SaeR Staphylococcus aureus (strain N315)
Q99VR7 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q840P8 3.13e-26 104 30 5 223 1 saeR Response regulator SaeR Staphylococcus aureus (strain Newman)
Q5HHW4 3.13e-26 104 30 5 223 1 saeR Response regulator SaeR Staphylococcus aureus (strain COL)
Q2YSM5 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2G2 3.13e-26 104 30 5 223 1 saeR Response regulator SaeR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT4 3.13e-26 104 30 5 223 3 saeR Response regulator SaeR Staphylococcus aureus (strain USA300)
Q49ZT8 3.38e-26 103 28 2 215 3 hssR Heme response regulator HssR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P94504 5.72e-26 103 31 5 231 3 yvrH Transcriptional regulatory protein YvrH Bacillus subtilis (strain 168)
Q07783 9.03e-26 103 30 3 233 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
G3XCY6 1.09e-25 103 35 6 224 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28835 1.24e-25 103 31 4 228 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
P37478 1.79e-25 102 28 3 233 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q06239 2.13e-25 102 29 6 227 3 vanR Regulatory protein VanR Enterococcus faecium
P50351 2.21e-25 102 30 3 233 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q04803 2.49e-25 103 35 4 221 3 pfeR Transcriptional activator protein PfeR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2YZ24 3.66e-25 101 27 2 218 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GE73 3.74e-25 101 29 3 193 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q04942 9.1e-25 100 34 2 217 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7A039 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 9.39e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QJK3 9.89e-25 100 29 2 186 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 9.89e-25 100 29 2 186 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
P50350 1.03e-24 100 30 3 232 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q4L8L9 1.14e-24 100 28 2 218 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
P31079 2.42e-24 99 31 4 226 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O32192 3.1e-24 99 30 3 223 1 cssR Transcriptional regulatory protein CssR Bacillus subtilis (strain 168)
Q8CQ17 8.02e-24 97 29 4 224 1 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR28 8.02e-24 97 29 4 224 3 saeR Response regulator SaeR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8DN02 9.61e-24 97 31 3 215 1 rr06 Response regulator RR06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNF6 9.61e-24 97 31 3 215 1 rr06 Response regulator RR06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
O78428 1.04e-23 98 29 5 228 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q9TLQ4 1.58e-23 97 29 5 234 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
A0A4P7TS68 2.37e-23 97 29 3 226 1 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri serotype 5a (strain M90T)
P0AA21 2.37e-23 97 29 3 226 3 ompR DNA-binding dual transcriptional regulator OmpR Shigella flexneri
P0AA19 2.37e-23 97 29 3 226 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NGY1 2.37e-23 97 29 3 226 3 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhimurium (strain SL1344)
P0AA20 2.37e-23 97 29 3 226 1 ompR DNA-binding dual transcriptional regulator OmpR Salmonella typhi
P0AA16 2.37e-23 97 29 3 226 1 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli (strain K12)
P0AA17 2.37e-23 97 29 3 226 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AA18 2.37e-23 97 29 3 226 3 ompR DNA-binding dual transcriptional regulator OmpR Escherichia coli O157:H7
O31432 2.58e-23 96 31 6 218 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q6GJ11 3.42e-23 96 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
A8Z181 4.1e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 4.1e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 4.1e-23 95 30 3 223 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 4.1e-23 95 30 3 223 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 4.1e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q7A1L2 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 5.56e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P54443 6.18e-23 95 33 7 231 3 yrkP Uncharacterized transcriptional regulatory protein YrkP Bacillus subtilis (strain 168)
Q49VK3 6.44e-23 95 31 6 226 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WGN1 6.58e-23 95 33 6 208 1 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGN0 6.58e-23 95 33 6 208 3 kdpE Transcriptional regulatory protein KdpE Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2YSS2 6.93e-23 95 30 3 223 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P51358 8.58e-23 95 31 8 231 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
P28257 9.26e-23 95 30 4 228 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q932F1 1.11e-22 94 30 3 223 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q1XDC9 1.22e-22 95 31 8 231 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
Q8CQ37 1.62e-22 94 30 4 223 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 1.62e-22 94 30 4 223 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34951 2.02e-22 94 28 3 228 3 bceR Sensory transduction protein BceR Bacillus subtilis (strain 168)
Q9K621 3.56e-22 93 26 3 226 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P21866 6.7e-22 92 33 8 224 1 kdpE KDP operon transcriptional regulatory protein KdpE Escherichia coli (strain K12)
Q2FWH6 1.06e-21 92 29 6 226 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3GGB5 2.03e-21 91 33 5 227 2 cpxR Transcriptional regulatory protein CpxR Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE90 6.74e-21 90 32 4 227 3 cpxR Transcriptional regulatory protein CpxR Shigella flexneri
P0AE88 6.74e-21 90 32 4 227 1 cpxR Transcriptional regulatory protein CpxR Escherichia coli (strain K12)
P0AE89 6.74e-21 90 32 4 227 3 cpxR Transcriptional regulatory protein CpxR Escherichia coli O157:H7
Q44929 1.42e-20 89 29 8 238 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P42421 8.91e-20 87 29 3 222 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q4L481 1.75e-19 86 27 3 223 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
P58357 2.79e-19 85 29 4 221 3 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli O157:H7
O25918 3.52e-19 85 27 4 214 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
Q9HUI2 1.47e-18 84 30 6 232 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44895 1.64e-18 84 30 6 228 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q07597 2.86e-18 83 25 4 223 3 nisR Nisin biosynthesis regulatory protein NisR Lactococcus lactis subsp. lactis
P38684 4.23e-18 82 29 4 220 1 torR TorCAD operon transcriptional regulatory protein TorR Escherichia coli (strain K12)
P0A9Q4 6.33e-17 79 28 5 226 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 6.33e-17 79 28 5 226 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 6.33e-17 79 28 5 226 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 6.33e-17 79 28 5 226 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P40138 1.96e-16 80 32 4 170 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
P33112 4.35e-16 77 31 3 174 3 spaR Transcriptional regulatory protein SpaR Bacillus subtilis
P44918 2.6e-15 75 26 4 227 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O24973 8.1e-15 73 29 3 221 1 arsR Transcriptional regulatory protein ArsR Helicobacter pylori (strain ATCC 700392 / 26695)
P13359 1.77e-14 73 28 6 224 3 virG Regulatory protein VirG Rhizobium rhizogenes
P0AFB8 1.01e-13 72 35 1 133 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 1.01e-13 72 35 1 133 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P41789 3.17e-13 71 34 1 133 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23221 6.73e-13 68 30 0 130 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q06065 9.99e-13 70 29 3 159 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P44845 1.16e-12 67 32 9 207 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P62722 1.55e-12 68 30 6 224 3 virG Regulatory protein VirG Agrobacterium tumefaciens (strain 15955)
P48359 1.61e-12 67 30 1 120 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
Q9KQD5 1.89e-12 65 33 2 121 1 VC_2065 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H3AMJ9 1.89e-12 65 33 2 121 1 cheY-3 Chemotaxis protein CheY-3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P03029 2.7e-12 68 38 0 106 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q51455 4.93e-12 63 30 2 124 3 cheY Chemotaxis protein CheY Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I4N3 1.68e-11 66 33 1 137 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8D0P1 1.85e-11 62 32 2 121 3 cheY Chemotaxis protein CheY Yersinia pestis
Q44444 3.87e-11 64 31 6 169 3 virG Regulatory protein VirG Rhizobium radiobacter
Q93P00 8.24e-11 60 31 2 121 3 cheY Chemotaxis protein CheY Yersinia enterocolitica
P07545 1.05e-10 63 29 5 223 3 virG Regulatory protein VirG Agrobacterium fabrum (strain C58 / ATCC 33970)
P0AE69 2.71e-10 59 31 2 121 3 cheY Chemotaxis protein CheY Shigella flexneri
P0AE67 2.71e-10 59 31 2 121 1 cheY Chemotaxis protein CheY Escherichia coli (strain K12)
P0AE68 2.71e-10 59 31 2 121 3 cheY Chemotaxis protein CheY Escherichia coli O157:H7
P52108 3.17e-10 61 26 5 230 1 rstA Transcriptional regulatory protein RstA Escherichia coli (strain K12)
Q8FGP6 3.46e-10 59 31 2 121 3 cheY Chemotaxis protein CheY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FUS8 3.49e-10 61 26 5 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella suis biovar 1 (strain 1330)
Q8YDL7 3.49e-10 61 26 5 209 1 ftcR Flagellar transcriptional regulator FtcR Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q576I4 3.49e-10 61 26 5 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus biovar 1 (strain 9-941)
Q2YJF8 3.49e-10 61 26 5 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella abortus (strain 2308)
P28787 6.98e-10 61 33 0 114 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
Q9F8D7 2.03e-09 60 35 4 109 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
A5VW00 2.15e-09 58 26 5 209 3 ftcR Flagellar transcriptional regulator FtcR Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P71403 2.8e-09 56 27 3 122 1 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain ATCC 700392 / 26695)
P38889 3.29e-09 59 25 0 158 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q3LWR6 3.37e-09 58 23 4 202 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 3.37e-09 58 23 4 202 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 3.37e-09 58 23 4 202 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P13632 3.5e-09 59 32 0 102 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
P39486 4.27e-09 58 30 5 172 3 dctR Probable C4-dicarboxylate response regulator DctR Priestia megaterium
Q54SP4 5.05e-09 59 29 3 144 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q9ZM64 7.38e-09 55 26 3 122 3 cheY1 Chemotaxis protein CheY1 Helicobacter pylori (strain J99 / ATCC 700824)
Q9FAD7 9.63e-09 55 33 3 111 3 cheY Chemotaxis protein CheY Enterobacter cloacae
P0A2D5 1.03e-08 55 28 2 121 1 cheY Chemotaxis protein CheY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D6 1.03e-08 55 28 2 121 3 cheY Chemotaxis protein CheY Salmonella typhi
P0AEV3 1.76e-08 57 32 0 101 3 rssB Regulator of RpoS Shigella flexneri
P0AEV1 1.76e-08 57 32 0 101 1 rssB Regulator of RpoS Escherichia coli (strain K12)
P0AEV2 1.76e-08 57 32 0 101 3 rssB Regulator of RpoS Escherichia coli O157:H7
Q2KCH7 2.21e-08 54 31 6 124 3 cheY Probable chemotaxis protein CheY Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O05251 2.31e-08 56 28 2 121 3 malR Transcriptional regulatory protein MalR Bacillus subtilis (strain 168)
Q9ZWS7 2.8e-08 55 33 2 93 1 ARR7 Two-component response regulator ARR7 Arabidopsis thaliana
Q9K998 4.67e-08 55 32 2 114 3 dctR Probable C4-dicarboxylate response regulator DctR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1RJS1 5.11e-08 56 33 1 103 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q4UL27 5.19e-08 55 32 1 103 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZCY9 5.54e-08 55 28 2 153 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q05943 5.74e-08 55 29 4 154 3 glnR Transcriptional regulatory protein GlnR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P10577 6.92e-08 55 30 1 126 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q67W50 7.81e-08 55 31 2 121 3 RR25 Two-component response regulator ORR25 Oryza sativa subsp. japonica
A1W0A5 7.89e-08 52 26 4 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P0C635 7.89e-08 52 26 4 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMH1 7.89e-08 52 26 4 128 3 cheY Chemotaxis protein CheY homolog Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B8GZM2 8.43e-08 55 36 1 74 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 8.43e-08 55 36 1 74 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q00934 8.84e-08 55 26 0 145 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q92HC2 9.96e-08 55 31 1 103 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1XDE4 1.26e-07 53 24 4 195 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P14375 1.47e-07 54 31 0 111 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P96602 1.77e-07 53 28 2 133 3 dctR Probable C4-dicarboxylate response regulator DctR Bacillus subtilis (strain 168)
Q8X613 1.86e-07 54 31 0 111 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
O31517 1.89e-07 54 24 4 177 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
O82868 2.47e-07 52 29 0 110 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
P0C5S5 2.6e-07 53 26 0 114 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 2.6e-07 53 26 0 114 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 2.65e-07 53 26 0 114 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9WY30 2.75e-07 53 25 2 120 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P58363 3.06e-07 53 30 1 117 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P0AEC4 3.11e-07 53 30 1 117 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 3.11e-07 53 30 1 117 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
O49397 3.66e-07 53 31 2 119 1 ARR10 Two-component response regulator ARR10 Arabidopsis thaliana
P96686 3.72e-07 52 28 4 122 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
Q68WH4 3.81e-07 53 30 1 103 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7CQM5 3.94e-07 52 26 7 208 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q88RJ6 4.83e-07 53 30 1 127 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9APD9 5.18e-07 53 31 0 101 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P23747 5.36e-07 53 31 1 126 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8KIY1 5.93e-07 53 30 3 123 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P0C0F6 6.69e-07 52 42 1 75 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q7MM78 7.58e-07 52 29 1 87 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 7.58e-07 52 29 1 87 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
E0X9C7 1.08e-06 52 30 2 120 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P72781 1.08e-06 51 37 1 74 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P62598 1.11e-06 52 32 3 125 2 ARR12 Two-component response regulator ARR12 Arabidopsis thaliana
P0C0F7 1.11e-06 52 42 1 75 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q9KT84 1.13e-06 52 31 1 87 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O14283 1.36e-06 52 30 0 102 1 prr1 Transcription factor prr1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O29221 1.37e-06 51 29 5 124 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5W4E3 1.46e-06 52 30 2 120 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88AQ2 1.5e-06 51 29 1 127 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5A4X5 1.54e-06 51 28 0 104 3 SKN7 Transcription factor SKN7 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A599 1.56e-06 52 30 4 113 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P31802 1.87e-06 50 31 7 164 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
Q9KSB1 2.06e-06 51 29 1 89 1 VC_1348 Probable cyclic di-GMP phosphodiesterase VC_1348 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7G8V2 2.76e-06 49 31 2 89 1 ARR15 Two-component response regulator ARR15 Arabidopsis thaliana
Q5SML5 2.81e-06 50 30 2 123 2 RR22 Two-component response regulator ORR22 Oryza sativa subsp. japonica
Q54Q69 2.85e-06 51 25 3 129 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
B8B3I4 2.87e-06 50 30 2 123 3 RR22 Two-component response regulator ORR22 Oryza sativa subsp. indica
Q04848 2.95e-06 50 28 2 139 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9KL96 3.13e-06 50 33 2 90 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1M7A0 3.46e-06 49 28 1 117 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9FXD6 3.69e-06 50 29 3 124 1 ARR11 Two-component response regulator ARR11 Arabidopsis thaliana
P10046 3.87e-06 50 28 1 118 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q87GU5 3.91e-06 50 29 1 103 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8H7S7 4.03e-06 50 32 1 81 2 RR21 Two-component response regulator ORR21 Oryza sativa subsp. japonica
A2XE31 4.03e-06 50 32 1 81 3 RR21 Two-component response regulator ORR21 Oryza sativa subsp. indica
Q940D0 4.67e-06 50 32 1 89 1 ARR1 Two-component response regulator ARR1 Arabidopsis thaliana
Q9SB04 4.9e-06 48 38 1 63 1 ARR5 Two-component response regulator ARR5 Arabidopsis thaliana
Q8L9Y3 5.06e-06 50 28 1 121 1 ARR14 Two-component response regulator ARR14 Arabidopsis thaliana
T2KMF4 5.11e-06 50 29 2 93 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P45671 5.7e-06 50 29 2 118 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P30855 5.83e-06 50 30 0 92 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q9HV27 5.96e-06 49 38 1 70 1 PA4781 Cyclic di-GMP phosphodiesterase PA4781 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P26487 6.11e-06 48 25 0 120 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P48027 6.68e-06 50 32 2 82 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
P43501 7.53e-06 47 36 1 60 3 pilH Protein PilH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O82798 7.59e-06 48 38 1 65 1 ARR4 Two-component response regulator ARR4 Arabidopsis thaliana
Q9ZWS6 7.68e-06 48 33 1 72 1 ARR6 Two-component response regulator ARR6 Arabidopsis thaliana
P06628 8.05e-06 47 28 0 107 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q5N6V8 8.7e-06 49 25 5 170 3 RR26 Two-component response regulator ORR26 Oryza sativa subsp. japonica
Q8Z333 9.01e-06 49 30 0 101 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P25852 9.26e-06 49 30 0 101 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HU19 9.52e-06 49 29 0 102 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZWS9 1.02e-05 48 33 2 75 1 ARR3 Two-component response regulator ARR3 Arabidopsis thaliana
Q53228 1.06e-05 47 29 0 112 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q56312 1.07e-05 46 22 1 115 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q75KW7 1.12e-05 47 30 4 110 3 RR41 Two-component response regulator ORR41 Oryza sativa subsp. japonica
Q9RC52 1.42e-05 48 29 3 125 3 citT Transcriptional regulatory protein CitT Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6H805 1.53e-05 48 37 1 75 2 RR24 Two-component response regulator ORR24 Oryza sativa subsp. japonica
A2X1N2 1.59e-05 48 37 1 75 3 RR24 Two-component response regulator ORR24 Oryza sativa subsp. indica
O80366 1.63e-05 47 23 4 132 1 ARR9 Two-component response regulator ARR9 Arabidopsis thaliana
O80365 1.67e-05 47 28 1 83 1 ARR8 Two-component response regulator ARR8 Arabidopsis thaliana
F4JZT3 1.82e-05 46 23 2 113 2 ARR24 Two-component response regulator 24 Arabidopsis thaliana
Q869S5 1.87e-05 48 28 2 118 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P24072 2.32e-05 45 26 3 106 1 cheY Chemotaxis protein CheY Bacillus subtilis (strain 168)
O32197 2.5e-05 47 31 4 120 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P58402 2.55e-05 48 29 0 92 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q2RAP3 2.7e-05 47 30 3 78 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. japonica
Q4GZK2 2.7e-05 47 30 3 78 2 RR9 Two-component response regulator ORR9 Oryza sativa subsp. indica
Q6K8X6 2.77e-05 48 35 1 76 2 RR23 Two-component response regulator ORR23 Oryza sativa subsp. japonica
Q2QXY3 2.78e-05 47 32 3 75 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. japonica
B8BLZ4 2.78e-05 47 32 3 75 2 RR10 Two-component response regulator ORR10 Oryza sativa subsp. indica
B8AEH1 2.8e-05 48 35 1 76 3 RR23 Two-component response regulator ORR23 Oryza sativa subsp. indica
Q4L8V4 2.85e-05 47 23 4 146 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
P0DMC6 3.08e-05 48 28 0 118 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P46384 3.3e-05 45 24 1 116 1 pilG Protein PilG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58662 3.41e-05 47 30 0 105 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 3.6e-05 47 30 0 105 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P51343 3.77e-05 46 27 1 118 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P09432 4.31e-05 47 26 2 160 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0DMC5 4.33e-05 47 30 0 105 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
O07528 4.61e-05 46 29 3 107 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P24908 4.9e-05 46 30 2 109 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3IRR4 5.41e-05 47 30 3 99 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8KR08 6.1e-05 46 21 4 202 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P10576 6.77e-05 46 28 0 106 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q7CQM8 6.85e-05 45 28 4 138 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GK93 7.69e-05 46 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MRSA252)
Q8NYJ9 7.84e-05 45 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MW2)
Q6GCQ3 7.84e-05 45 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain MSSA476)
Q5HJF7 7.84e-05 45 28 3 129 2 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain COL)
Q2G1E1 7.84e-05 45 28 3 129 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK47 7.84e-05 45 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain USA300)
Q2YV56 7.91e-05 45 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YIF7 8.67e-05 44 24 0 115 1 cpdR Response regulator receiver protein CpdR Brucella abortus (strain 2308)
P52941 9.01e-05 45 31 4 129 3 spo0A Stage 0 sporulation protein A homolog Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9ZWJ9 9.17e-05 46 33 1 75 1 ARR2 Two-component response regulator ARR2 Arabidopsis thaliana
Q9KLK7 0.000102 46 26 2 123 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EQQ3 0.000105 45 28 1 83 3 lytT Sensory transduction protein LytT Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P26319 0.000107 45 32 0 70 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P54302 0.000131 46 27 1 103 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P62646 0.000166 45 28 4 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q942A1 0.000167 45 32 2 78 2 RR4 Two-component response regulator ORR4 Oryza sativa subsp. japonica
Q4GZK7 0.000167 45 32 2 78 2 RR4 Two-component response regulator ORR4 Oryza sativa subsp. indica
Q7A7X9 0.000192 44 28 3 129 1 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain N315)
Q99X00 0.000192 44 28 3 129 3 hptR Transcriptional regulatory protein HptR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0AFU5 0.0002 45 31 0 100 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 0.0002 45 31 0 100 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q9P896 0.000207 45 28 2 104 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10WZ6 0.000219 45 31 5 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
Q3SVA1 0.000228 45 34 7 119 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
O25153 0.000234 45 29 4 109 1 cheAY Sensor histidine kinase CheAY Helicobacter pylori (strain ATCC 700392 / 26695)
Q9M9B9 0.000243 45 35 1 74 2 ARR19 Putative two-component response regulator ARR19 Arabidopsis thaliana
P0A4H5 0.00025 42 34 0 58 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 0.00025 42 34 0 58 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O83639 0.000266 44 38 1 60 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
P9WGM3 0.000267 44 30 5 123 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 0.000267 44 30 5 123 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6K9T0 0.000274 43 27 3 97 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. japonica
Q4GZK8 0.000274 43 27 3 97 2 RR3 Two-component response regulator ORR3 Oryza sativa subsp. indica
P52938 0.000302 44 25 9 196 3 spo0A Stage 0 sporulation protein A homolog Clostridioides difficile
P18769 0.000312 45 29 3 104 1 frzE Gliding motility regulatory protein Myxococcus xanthus
G7WMP8 0.000393 43 29 5 124 1 filR2 Probable methanogenesis regulatory protein FilR2 Methanothrix harundinacea (strain 6Ac)
Q4UU85 0.000405 44 33 1 83 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
A2XYV5 0.000434 43 32 2 74 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. indica
P42508 0.000436 43 29 2 101 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
Q7XQA6 0.000464 43 32 2 74 2 RR6 Two-component response regulator ORR6 Oryza sativa subsp. japonica
P0AF31 0.000541 43 25 7 203 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 0.000541 43 25 7 203 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 0.000541 43 25 7 203 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 0.000541 43 25 7 203 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
Q888V8 0.000544 43 36 3 79 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2ILG8 0.000653 43 31 6 113 3 cheB6 Protein-glutamate methylesterase/protein-glutamine glutaminase 6 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q7MD16 0.000671 43 24 1 113 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 0.000671 43 24 1 113 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q86AT9 0.000675 43 25 2 110 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q167K9 0.000761 43 30 4 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
G0SB31 0.001 43 29 3 107 1 SKN7 Transcription factor SKN7 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_12385
Feature type CDS
Gene qseB
Product quorum sensing response regulator transcription factor QseB
Location 132788 - 133459 (strand: -1)
Length 672 (nucleotides) / 223 (amino acids)

Contig

Accession ZDB_221
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2684
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00486 Transcriptional regulatory protein, C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0745 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07666 two-component system, OmpR family, response regulator QseB Two-component system
Quorum sensing
-

Protein Sequence

MRILLIEDDRLIGDGLKIGLSRLGFTPDWFTDGQTGREALYAAPYDAVILDLSLPGMDGLDILKQWRSEGRDEPVLILTARDALEQRVSGLQQGADDYLCKPFALAEVAARLQALIRRRYGQLSEKLVLGDVEMDPVAMTVTRNGVPVSLKGKELALLALFLRNPQKVLSRAMIEEKLYNWDEDVSSNAVEVHIHHLRRKLGRGFIKTIHGVGYVAGKNDEDV

Flanking regions ( +/- flanking 50bp)

GAGATATCTGAGTTAAAACTAGTATAGCGCTATTTATACGGATAAGAATTATGCGGATATTATTAATTGAAGATGACCGGTTGATTGGCGACGGGCTGAAAATCGGCCTGAGCAGGCTCGGCTTTACCCCTGACTGGTTTACCGATGGGCAAACCGGCCGGGAGGCGCTCTATGCCGCTCCTTATGATGCCGTGATCCTCGATCTCTCCCTGCCCGGCATGGACGGACTGGATATCCTGAAACAGTGGCGGTCAGAGGGGCGCGACGAACCGGTACTGATCCTGACCGCCCGTGATGCCCTTGAGCAGCGCGTCAGCGGCTTGCAACAGGGCGCAGATGATTATCTGTGCAAACCGTTTGCCCTGGCAGAAGTCGCGGCACGGTTACAGGCACTGATCCGCCGCCGCTACGGTCAGCTCTCTGAAAAACTGGTGCTCGGCGACGTGGAGATGGATCCGGTGGCGATGACCGTCACCCGCAACGGCGTACCGGTATCACTGAAAGGTAAAGAGCTGGCACTGCTGGCACTGTTTCTGCGCAATCCGCAGAAAGTGCTGTCCCGCGCGATGATTGAAGAAAAATTGTATAACTGGGATGAAGATGTCTCCAGTAATGCCGTTGAGGTGCATATTCACCATCTGCGCCGCAAACTGGGGCGCGGATTTATCAAAACTATTCACGGTGTCGGTTATGTCGCGGGAAAAAATGATGAAGACGTATAGTCTGCGCCTGCGGCTGGGCGGATTATTGCTGCTGCTCACCCTGCTGACCT