Homologs in group_2009

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15090 FBDBKF_15090 100.0 Morganella morganii S1 lysR LysR family transcriptional regulator
NLDBIP_11500 NLDBIP_11500 100.0 Morganella morganii S4 lysR LysR family transcriptional regulator
LHKJJB_11360 LHKJJB_11360 100.0 Morganella morganii S3 lysR LysR family transcriptional regulator
HKOGLL_09970 HKOGLL_09970 100.0 Morganella morganii S5 lysR LysR family transcriptional regulator
F4V73_RS12360 F4V73_RS12360 89.1 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS01655 PMI_RS01655 63.5 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2009

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2009

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P03030 3.22e-138 395 63 1 304 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
Q00678 3.84e-39 142 30 1 272 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P35112 2.83e-38 140 30 1 272 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
P72294 4.43e-28 113 26 5 298 3 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium meliloti
P0A4T3 3.86e-26 107 27 3 295 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 3.86e-26 107 27 3 295 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
P37499 2.29e-23 100 27 5 254 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
A0T0G2 5.35e-22 97 25 3 248 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P0DV33 1.33e-21 95 32 1 158 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
P73123 3.8e-20 92 28 4 249 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8X4M5 1.5e-18 87 26 0 229 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P27111 1.05e-17 84 25 0 229 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P48271 1.92e-17 84 26 4 250 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P25544 2.81e-17 83 25 3 245 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q3MCB5 5.03e-17 83 26 4 249 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5N5I5 1.65e-16 82 23 3 247 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 1.65e-16 82 23 3 247 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8YQ82 1.91e-16 82 26 3 249 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B4E8V9 2.35e-16 81 27 3 236 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
O19892 3.22e-16 80 26 4 255 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
Q6B936 7.11e-16 79 24 3 249 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
Q1XDT2 7.51e-16 79 24 3 249 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P51205 8.95e-16 79 24 3 249 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
Q47141 9.73e-16 79 25 3 261 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P20667 1.45e-15 78 30 7 242 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
Q85G62 2.69e-15 78 25 4 251 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
A0T0V5 3.64e-15 77 23 4 249 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
O78432 9.52e-15 76 24 3 249 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
Q55459 1.93e-14 75 20 5 309 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q4G384 2.29e-14 75 23 4 249 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P49518 6.37e-14 74 23 5 252 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
B4E8S9 6.82e-14 74 25 2 235 1 ssuR HTH-type transcriptional regulator SsuR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q47005 1.09e-13 73 25 3 240 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
O32255 1.19e-13 73 23 8 287 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
A2CI69 3.09e-13 72 26 4 240 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q47083 6.54e-13 71 27 4 238 1 cbl HTH-type transcriptional regulator cbl Escherichia coli (strain K12)
P45105 1.27e-12 70 24 6 261 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52696 1.49e-12 70 21 1 238 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P39647 1.94e-12 69 22 5 301 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P39592 4.57e-12 68 21 4 294 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P42722 5.68e-12 68 22 1 240 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P25545 6.66e-12 68 23 5 246 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
P77171 1.27e-11 67 26 5 228 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P0ACR4 1.3e-11 67 25 3 242 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.3e-11 67 25 3 242 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.3e-11 67 25 3 242 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P52661 4.03e-11 66 26 5 242 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
O35038 6.61e-11 65 24 3 237 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P0A2Q4 6.94e-11 65 29 4 191 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 6.94e-11 65 29 4 191 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P45600 7.73e-11 65 24 6 261 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P0A9F3 7.73e-11 65 23 3 239 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 7.73e-11 65 23 3 239 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 7.73e-11 65 23 3 239 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
Q57748 8.76e-11 65 22 3 241 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P44821 1.15e-10 64 24 5 247 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08598 2.56e-10 63 28 4 238 3 cbl HTH-type transcriptional regulator cbl Klebsiella aerogenes
O34701 6.7e-10 62 22 5 245 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P06614 7.31e-10 62 24 5 252 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04778 9.53e-10 62 25 6 245 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P0A9G1 1.24e-09 61 29 5 201 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 1.24e-09 61 29 5 201 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 1.24e-09 61 29 5 201 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
Q08597 2.25e-09 60 22 3 240 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P77559 3.71e-09 60 24 6 249 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P94403 6.26e-09 59 22 5 258 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
O34685 6.9e-09 59 23 4 248 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P0ACR8 1.13e-08 58 23 4 272 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 1.13e-08 58 23 4 272 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P52693 1.26e-08 58 24 4 253 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P20668 1.83e-08 58 23 9 280 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P94501 2.23e-08 57 23 10 301 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P05827 3.63e-08 57 25 9 299 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P14145 4.94e-08 56 24 12 289 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P0A9F6 5.23e-08 57 25 8 263 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 5.23e-08 57 25 8 263 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 5.23e-08 57 25 8 263 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P71318 5.25e-08 57 19 4 302 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P94387 5.64e-08 57 24 5 254 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q9HWH8 5.66e-08 56 27 4 180 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23841 6.17e-08 56 22 2 261 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
P07774 7.35e-08 56 22 4 252 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O07906 7.84e-08 56 24 5 244 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P42427 1.47e-07 54 25 0 122 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O68014 2.11e-07 55 22 6 249 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P71025 3.08e-07 54 22 11 298 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
A7Z5E4 6.26e-07 53 23 5 246 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P0A2Q2 6.98e-07 53 24 9 292 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 6.98e-07 53 24 9 292 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
Q06610 1.09e-06 52 21 1 247 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
P52669 1.22e-06 52 24 6 254 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q9X725 1.77e-06 52 19 3 300 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P52691 1.82e-06 52 25 6 247 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9X5P2 3.09e-06 51 24 0 177 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P77744 4.78e-06 50 30 2 123 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P0A4T7 6.99e-06 50 26 6 153 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 6.99e-06 50 26 6 153 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
P39127 7.96e-06 50 24 4 153 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
Q8KA72 8.26e-06 50 26 7 187 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9EXL7 1.07e-05 49 22 3 213 3 nagR HTH-type transcriptional activator NagR Ralstonia sp.
P0ACQ4 1.11e-05 49 19 3 302 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 1.11e-05 49 19 3 302 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 1.11e-05 49 19 3 302 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
O33812 1.15e-05 49 26 3 141 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
Q8VWE6 1.22e-05 49 23 6 237 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P36771 1.48e-05 49 23 6 235 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
P96194 2.16e-05 47 35 0 80 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P58332 2.21e-05 48 21 6 253 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
P44418 3.34e-05 48 22 8 308 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P30979 4.1e-05 48 22 8 254 3 ybeF Uncharacterized HTH-type transcriptional regulator YbeF Escherichia coli (strain K12)
P10183 6e-05 47 22 5 252 3 nahR HTH-type transcriptional activator NahR Pseudomonas putida
O34827 7.07e-05 47 20 5 242 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P55576 8.25e-05 47 24 3 188 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P56885 0.000116 46 21 6 253 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
O33945 0.000149 46 21 0 180 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P52685 0.000549 44 25 2 127 3 mauR Mau operon transcriptional activator Paracoccus denitrificans
P10151 0.000808 44 33 0 66 1 leuO HTH-type transcriptional regulator LeuO Escherichia coli (strain K12)
P44876 0.001 43 22 5 197 3 HI_0775 Uncharacterized HTH-type transcriptional regulator HI_0775 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_11155
Feature type CDS
Gene lysR
Product LysR family transcriptional regulator
Location 57513 - 58427 (strand: 1)
Length 915 (nucleotides) / 304 (amino acids)

Contig

Accession ZDB_220
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2009
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MEHYSWRHIDIFHAVMTTKSLTDAAQLLHTSQPTVSRELARFEKILGFRVFDRIKGRLHPTEQGLRLFEEVERSYYGLERISRAAESIRQFQHAQLAITCLPAFAQSLLPAVCRTFHAQYPDVNFEIAPQESPLLEEWLSAQRYDLGITEHQLTPPGTLQETLLTLSEVCVLPESHPLCSKSVLTPADFAQQNFISLSVADSYRQKIDALFSEKQIPRRMIMETHSAASVCAMVREGLGVSVVNPLTAMDCSGICVRPFSEDIPFTVSLIRPLHRPHSVLTDIFITHLRQHMQAVLRQLKRVTG

Flanking regions ( +/- flanking 50bp)

ATATCTGATTTGCTAAGATCTATTCATTACTGATATGGACTTGATGAATAATGGAACACTACTCCTGGCGTCACATTGATATTTTCCACGCGGTTATGACAACAAAAAGTCTGACGGATGCCGCGCAACTGCTGCATACCTCACAGCCGACGGTCAGCCGGGAGCTTGCCCGTTTCGAAAAAATCCTCGGGTTCCGTGTTTTCGACCGCATCAAAGGCCGCCTGCACCCGACAGAACAGGGGCTGCGGTTATTTGAGGAAGTGGAGCGATCGTATTACGGGCTTGAGCGCATCAGCCGGGCAGCGGAGAGCATCCGCCAGTTTCAGCATGCCCAGCTGGCAATCACCTGTCTGCCCGCCTTTGCTCAGTCATTACTGCCCGCAGTCTGCCGCACATTTCATGCACAGTATCCGGATGTGAATTTTGAAATCGCCCCGCAGGAATCACCGCTTCTTGAAGAGTGGCTCTCCGCCCAGCGTTATGACCTCGGAATCACCGAACATCAACTGACGCCGCCCGGCACTCTGCAGGAAACTCTGCTCACGCTCAGTGAAGTCTGTGTGCTGCCGGAATCACATCCGCTGTGCAGCAAATCAGTACTGACCCCTGCTGATTTTGCGCAGCAGAATTTTATCAGCTTATCCGTTGCAGACAGTTACCGGCAAAAAATCGATGCATTGTTCAGTGAAAAACAGATCCCGCGCCGGATGATAATGGAAACACACAGTGCGGCCTCGGTATGTGCCATGGTCAGGGAGGGGCTGGGAGTGTCTGTCGTTAACCCGCTGACTGCCATGGATTGCAGCGGAATTTGTGTCCGCCCGTTCAGTGAGGATATTCCGTTCACCGTGAGCCTGATCCGCCCGCTGCACAGACCGCATTCTGTACTGACAGATATTTTTATCACCCATCTCCGCCAGCATATGCAGGCCGTTCTGCGGCAGTTAAAGCGGGTTACCGGTTAGTTTTTTCATCCAGCAGATACGGCAGCCAGTCCGGCGAATGCGCAAACCAC