Homologs in group_1094

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06220 FBDBKF_06220 100.0 Morganella morganii S1 thiQ thiamine ABC transporter ATP-binding protein ThiQ
NLDBIP_09645 NLDBIP_09645 100.0 Morganella morganii S4 thiQ thiamine ABC transporter ATP-binding protein ThiQ
LHKJJB_08110 LHKJJB_08110 100.0 Morganella morganii S3 thiQ thiamine ABC transporter ATP-binding protein ThiQ
HKOGLL_07660 HKOGLL_07660 100.0 Morganella morganii S5 thiQ thiamine ABC transporter ATP-binding protein ThiQ
F4V73_RS15695 F4V73_RS15695 81.9 Morganella psychrotolerans thiQ thiamine ABC transporter ATP-binding protein ThiQ
PMI_RS11495 PMI_RS11495 65.9 Proteus mirabilis HI4320 thiQ thiamine ABC transporter ATP-binding protein ThiQ

Distribution of the homologs in the orthogroup group_1094

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1094

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8V0 1.48e-112 325 67 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66EN1 2.49e-106 309 64 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6D0F3 1.07e-104 305 64 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CMQ3 2.21e-104 304 64 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 2.21e-104 304 64 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 2.21e-104 304 64 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q2NVW9 2.55e-103 301 63 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Sodalis glossinidius (strain morsitans)
Q5PDF8 4.34e-99 291 61 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z9I6 4.74e-99 290 61 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q57TF5 1.88e-98 289 60 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q8ZRV2 2.03e-98 289 60 0 231 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q326G9 1.62e-97 286 60 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q8FL82 4.09e-97 285 59 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32K28 1.52e-96 284 59 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q0T8D1 1.62e-96 284 59 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q0TLS2 2.33e-96 283 58 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5U5 3.57e-96 283 59 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q1RGD0 9.87e-96 282 58 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q83MG3 2.12e-95 281 58 0 231 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q8XA06 5.62e-95 280 58 0 230 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
P31548 2.46e-94 278 58 0 230 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
P44986 1.7e-81 245 55 0 209 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLQ1 2.03e-80 243 55 0 209 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q65SC9 4.47e-78 236 55 0 209 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7MPC5 4.23e-76 232 53 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 4.23e-76 232 53 0 217 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q0I354 6.02e-75 229 54 0 199 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q9KP42 1.45e-74 228 53 0 208 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q11D92 3.52e-74 228 49 1 226 3 thiQ Thiamine import ATP-binding protein ThiQ Chelativorans sp. (strain BNC1)
Q87SV4 3.54e-74 227 50 0 219 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E882 1.14e-73 226 50 0 223 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9CNP9 4e-72 222 50 0 209 3 thiQ Thiamine import ATP-binding protein ThiQ Pasteurella multocida (strain Pm70)
Q6LV32 3.02e-70 218 48 3 237 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q98FA5 3.44e-70 218 47 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7VP69 3.77e-67 209 51 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8FYU9 5.82e-66 207 46 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 5.82e-66 207 46 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q28VL7 7.39e-65 203 44 0 219 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q57BC2 2.83e-64 202 46 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 2.83e-64 202 46 0 224 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q8UBY6 1.46e-60 193 44 0 214 3 thiQ Thiamine import ATP-binding protein ThiQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1GCR8 6.66e-58 186 44 0 223 3 thiQ Thiamine import ATP-binding protein ThiQ Ruegeria sp. (strain TM1040)
Q92L31 3.48e-56 182 44 0 198 3 thiQ Thiamine import ATP-binding protein ThiQ Rhizobium meliloti (strain 1021)
Q3IY12 7.94e-51 168 44 0 223 3 thiQ Thiamine import ATP-binding protein ThiQ Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8DIA0 1.75e-46 160 42 2 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P14788 2.56e-45 157 41 0 205 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P9WQM1 8.19e-45 156 43 0 194 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 8.19e-45 156 43 0 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 8.19e-45 156 43 0 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8Z0H0 1.14e-44 155 42 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P74548 2.24e-44 155 43 0 192 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7NIW1 7.44e-44 153 41 0 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0I3Y9 8.41e-44 154 41 1 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q65UE1 9.66e-44 154 40 1 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6MCV4 1.39e-43 153 37 1 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8UA73 2.39e-43 152 39 1 199 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q82TL6 2.69e-43 152 39 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1B8V9 2.84e-43 153 40 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 2.84e-43 153 40 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q0AGF4 5.26e-43 151 40 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q9X196 5.45e-43 151 41 3 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q73XU8 6.72e-43 151 41 0 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q7N986 9.36e-43 151 42 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q81GU1 1.34e-42 150 40 2 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8EBC3 1.38e-42 150 41 2 194 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q609Q1 1.66e-42 150 40 2 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O31339 2.64e-42 149 40 2 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3MAR5 4.77e-42 149 41 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5E586 4.84e-42 149 40 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KUI0 5.21e-42 149 42 2 191 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P63354 6.72e-42 148 38 3 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 6.72e-42 148 38 3 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P31134 9.02e-42 149 40 0 198 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q8YM92 9.79e-42 149 41 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6NBT1 1.67e-41 147 40 1 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8PNN4 1.89e-41 147 40 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q7NWX3 3.52e-41 147 42 1 198 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P45171 3.86e-41 147 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2YAD6 3.91e-41 146 42 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q9KS33 3.93e-41 147 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9K876 4.3e-41 146 39 2 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1TXH7 4.62e-41 147 39 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q82WT5 4.99e-41 146 41 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q4QK57 5.59e-41 146 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
A1TAI4 6.01e-41 146 39 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q63TY1 7.07e-41 145 39 1 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8PC11 7.83e-41 145 40 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O85818 8.01e-41 146 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q9A7X1 8.15e-41 145 41 1 191 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8XZP8 9.28e-41 145 41 2 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7NX01 9.53e-41 145 38 2 209 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q92VJ2 9.71e-41 145 37 3 226 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q62K82 9.83e-41 145 39 1 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q87PH3 1.13e-40 145 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2SJY7 1.15e-40 145 40 4 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q89UD2 1.41e-40 144 40 1 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9I6L0 1.59e-40 144 38 2 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8RGC8 2.1e-40 145 37 1 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8E8K8 3.19e-40 144 39 4 218 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q93DX8 3.56e-40 141 38 1 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q5WBL0 4.65e-40 140 39 3 195 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q92XW1 5.71e-40 143 36 3 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q7NQN5 6.28e-40 143 37 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7MKU3 6.67e-40 144 40 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 6.67e-40 144 40 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q110U3 7.29e-40 144 39 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q8UH62 8.02e-40 142 42 2 192 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81GC1 8.53e-40 142 40 3 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Z4V6 9.27e-40 143 39 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P40860 1.07e-39 143 39 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9G4F5 1.31e-39 142 37 1 203 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9JZW0 1.42e-39 142 38 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q88AS5 1.53e-39 141 39 2 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q98HF7 1.8e-39 142 42 0 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9CP06 1.83e-39 142 38 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9JUX4 1.85e-39 142 38 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6D201 2.48e-39 141 38 1 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6F9A8 2.83e-39 141 40 1 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7N6Z2 3.75e-39 141 40 2 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q14Q07 4.37e-39 141 37 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q1GIE5 5.44e-39 141 40 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q87DT9 5.58e-39 140 39 2 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7W9U5 6.19e-39 140 39 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9PDN2 6.68e-39 140 39 2 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q5WKG4 7.26e-39 137 43 3 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q3YW77 7.56e-39 140 40 3 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q6HLQ9 7.95e-39 140 40 3 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6D4E2 7.95e-39 141 39 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31VH5 8.32e-39 140 40 3 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q0TA26 8.37e-39 140 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P10907 8.58e-39 140 40 3 195 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q5YZY9 9.05e-39 139 38 0 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
A3DDF6 9.07e-39 140 36 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q63E84 9.94e-39 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 9.94e-39 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 9.94e-39 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q7WGW1 1.04e-38 140 39 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q578K3 1.04e-38 140 38 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.04e-38 140 38 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q9HY19 1.14e-38 140 40 0 192 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02R79 1.15e-38 140 40 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q81TH8 1.22e-38 139 39 4 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
A1URR2 1.26e-38 139 38 0 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P56344 1.41e-38 136 36 0 199 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q6LR20 1.43e-38 140 39 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q8FFB3 1.54e-38 140 39 2 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P16676 1.78e-38 139 39 2 199 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8XBJ8 1.92e-38 139 39 2 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q7VNG4 1.97e-38 140 36 3 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8X6U5 2.02e-38 139 40 3 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q88CL2 2.05e-38 139 38 3 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q664X5 2.57e-38 139 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 2.57e-38 139 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 2.57e-38 139 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 2.57e-38 139 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q8D0W8 2.59e-38 139 40 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q7VZE5 2.64e-38 139 39 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q57IS3 2.69e-38 139 39 2 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q0SXQ1 2.73e-38 139 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
Q8ZLF4 3.08e-38 139 39 2 192 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7UBD0 3.13e-38 139 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q8FB37 3.13e-38 139 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YUV0 3.16e-38 139 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 3.16e-38 139 39 2 199 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 3.16e-38 139 39 2 199 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 3.16e-38 139 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q8Z7H7 3.26e-38 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q5PMK1 3.58e-38 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q64SQ6 3.6e-38 140 41 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 3.64e-38 140 41 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8Z245 3.73e-38 139 39 2 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
P69877 3.85e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 3.85e-38 139 39 0 194 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 3.85e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 3.85e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 3.85e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q32EY4 4.15e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
P40790 4.15e-38 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 4.15e-38 139 38 3 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q1RD28 4.66e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 4.66e-38 139 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P77795 4.79e-38 138 39 3 210 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q1R5H8 5.81e-38 138 40 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 5.81e-38 138 40 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q6FFZ1 6.01e-38 136 40 1 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0TC10 6.13e-38 138 40 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8A883 6.16e-38 140 41 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8FCQ2 6.74e-38 138 40 3 194 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3Z2Z3 7.48e-38 138 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 7.48e-38 138 39 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q7UC29 7.73e-38 138 38 2 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8D653 8.04e-38 137 39 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q4K681 8.23e-38 138 40 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9TKX3 8.31e-38 137 38 0 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8FVV5 8.71e-38 137 38 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q668K6 9.18e-38 138 39 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q0K9I2 1.13e-37 136 37 2 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
D4GP38 1.16e-37 138 36 1 193 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q18AM3 1.16e-37 137 35 1 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
P54933 1.24e-37 137 39 2 200 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q160M2 1.36e-37 137 41 0 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0T5R2 1.44e-37 137 38 0 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q65T42 1.45e-37 137 38 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5PJL1 1.5e-37 137 39 2 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q92DL6 1.95e-37 137 38 2 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q47T99 2.42e-37 137 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q92UV5 2.77e-37 137 38 1 201 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q7MFC4 3.24e-37 136 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 3.24e-37 136 39 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
A0AGP9 3.45e-37 136 38 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
O32151 3.63e-37 136 36 4 214 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q8Z1U0 4.23e-37 136 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q21GS5 4.33e-37 136 40 4 203 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8Y8T6 4.34e-37 136 38 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P19566 4.9e-37 136 38 2 199 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 4.9e-37 136 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q24XJ2 5e-37 135 38 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q92WJ0 5.82e-37 135 37 3 214 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q9MUN1 6.11e-37 135 39 3 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q1WVI7 6.39e-37 135 36 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q722B1 6.69e-37 135 38 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8YCG3 6.75e-37 135 38 3 215 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8U6M1 9.76e-37 135 38 0 197 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6G5J0 1.14e-36 134 37 0 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P10346 1.21e-36 132 34 5 229 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
A0LUE6 1.38e-36 135 41 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8FVT0 1.46e-36 134 37 2 191 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 1.66e-36 134 37 2 191 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.66e-36 134 37 2 191 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
A1JIE0 1.93e-36 134 39 2 191 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2K8C8 2.02e-36 134 38 0 197 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q98K23 2.04e-36 134 41 2 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5PKZ8 2.07e-36 134 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8X8K4 2.34e-36 134 36 3 213 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q8FHR3 2.74e-36 134 36 3 213 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77481 2.8e-36 134 36 3 213 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q0TI47 2.89e-36 134 36 3 213 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P94360 2.95e-36 134 36 1 207 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q46ZM0 3.12e-36 134 38 2 193 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6LK87 3.25e-36 134 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q9I6T2 3.46e-36 134 41 3 189 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6CZ34 3.62e-36 133 38 2 191 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1QE80 3.74e-36 134 39 2 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6F0V4 3.98e-36 133 41 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q57SD6 4.01e-36 134 37 1 199 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q4QP85 4.19e-36 133 37 1 205 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q66FU4 4.24e-36 133 33 5 262 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9Z3R9 4.25e-36 133 37 2 196 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q97UY8 5.44e-36 133 37 3 199 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5PFQ7 5.86e-36 133 36 1 199 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1CNC6 6.01e-36 133 33 5 262 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 6.01e-36 133 33 5 262 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 6.01e-36 133 33 5 262 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q72FW5 6.19e-36 133 36 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8Z8W8 6.31e-36 133 36 1 199 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
P96063 6.58e-36 133 36 1 199 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8F6Z1 8.25e-36 132 35 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 8.25e-36 132 35 1 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1RC47 9.39e-36 132 35 3 213 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q5X627 1.02e-35 132 37 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q8RI39 1.21e-35 132 37 2 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5LX21 1.27e-35 132 35 3 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1MQ44 1.3e-35 132 38 3 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
P44513 1.43e-35 132 37 1 205 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SBZ1 1.45e-35 132 39 5 216 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q5ZWE4 1.64e-35 132 36 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q665B6 1.66e-35 129 35 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q30V33 1.67e-35 132 36 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7A169 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 2.35e-35 131 38 2 189 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 2.35e-35 131 38 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q28QL7 2.37e-35 131 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q0K998 2.59e-35 131 39 3 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0SRL2 2.83e-35 131 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q3IX40 2.92e-35 131 38 0 188 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q0S0Z3 3.03e-35 130 38 5 216 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q1CDR0 3.22e-35 129 35 4 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 3.22e-35 129 35 4 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 3.22e-35 129 35 4 218 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q3KBH4 3.38e-35 131 40 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q38WL5 3.45e-35 130 37 5 232 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q97KS6 3.7e-35 130 35 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q87GB5 3.72e-35 131 38 2 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5WXF0 3.8e-35 131 36 0 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q2SSS4 4.3e-35 130 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q74K65 4.46e-35 130 33 1 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q3M5J9 4.61e-35 128 40 2 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P9WQI3 5.43e-35 131 37 3 210 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 5.43e-35 131 37 3 210 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3KCC5 6.7e-35 130 35 4 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q6G194 6.72e-35 130 36 0 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q6MU19 7.05e-35 130 39 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q0P9X7 7.77e-35 127 36 4 200 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1M589 7.87e-35 130 35 0 200 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0RYP7 8.15e-35 129 39 5 216 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
A1VZQ5 8.56e-35 127 36 3 200 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q1MCN6 9.25e-35 130 36 0 189 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1LLP5 9.3e-35 130 37 2 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8ELR4 9.93e-35 130 36 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8FV85 9.96e-35 130 40 2 200 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 9.96e-35 130 40 2 200 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 9.96e-35 130 40 2 200 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 9.96e-35 130 40 2 200 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q1LNM0 1.29e-34 128 35 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5FL41 1.34e-34 129 34 1 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q2K4V4 1.38e-34 129 36 0 189 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8FW07 1.49e-34 129 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 1.49e-34 129 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q2YKR8 1.58e-34 129 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q7NRX5 1.68e-34 129 37 3 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q81C68 1.69e-34 126 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A3PRY1 1.82e-34 129 37 0 188 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q2K6L3 1.93e-34 129 36 2 195 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8XZX8 1.93e-34 129 36 2 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5JEB0 1.99e-34 128 39 0 189 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8YCB1 2.17e-34 129 37 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q98G43 2.17e-34 129 39 3 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1GB17 2.35e-34 129 33 1 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q6LKD4 2.36e-34 129 36 5 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q60AI1 2.44e-34 129 39 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1M8R6 2.49e-34 128 36 0 191 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9KL04 2.63e-34 129 36 0 195 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2K1C8 2.67e-34 128 34 0 192 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q46ZU5 2.67e-34 127 36 4 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q92LU2 2.75e-34 128 36 4 208 3 modC Molybdenum import ATP-binding protein ModC Rhizobium meliloti (strain 1021)
Q736E0 2.77e-34 126 36 2 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5L222 2.87e-34 128 35 1 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q2L0H5 2.93e-34 128 39 2 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q042G7 2.98e-34 128 35 0 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q92WD6 2.99e-34 128 36 0 189 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q65QT6 3.47e-34 129 36 2 196 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q81P94 3.5e-34 125 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
A0PY57 3.7e-34 128 34 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q5DZC6 3.84e-34 128 35 0 195 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q57293 3.89e-34 128 35 0 192 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q63A38 3.94e-34 125 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q4KB64 4.11e-34 128 35 4 218 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1AS06 4.16e-34 128 36 0 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5HQ70 4.2e-34 128 36 3 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6HHI7 4.43e-34 125 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8XIZ5 4.89e-34 127 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 4.89e-34 127 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A0RFA4 4.98e-34 125 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis (strain Al Hakam)
P55453 4.98e-34 127 36 0 192 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q830W6 5.33e-34 128 33 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q88ZJ6 5.44e-34 128 36 2 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8RQL7 5.73e-34 125 35 5 217 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8UB29 6.17e-34 127 36 0 189 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1GID1 7.03e-34 127 38 0 184 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q8CPN0 7.39e-34 127 38 2 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8UBB7 7.41e-34 127 37 0 189 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7VKP7 9.44e-34 127 35 4 204 3 modC Molybdenum import ATP-binding protein ModC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q21XJ9 9.72e-34 125 38 2 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0RAT5 9.88e-34 129 39 0 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P0AAF9 1.02e-33 124 33 5 230 3 artP Arginine transport ATP-binding protein ArtP Shigella flexneri
P0AAF6 1.02e-33 124 33 5 230 1 artP Arginine transport ATP-binding protein ArtP Escherichia coli (strain K12)
P0AAF7 1.02e-33 124 33 5 230 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF8 1.02e-33 124 33 5 230 3 artP Arginine transport ATP-binding protein ArtP Escherichia coli O157:H7
Q9YGA6 1.07e-33 127 37 3 203 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9I2N4 1.38e-33 127 37 4 191 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8NSN2 1.59e-33 126 36 2 216 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8U648 1.72e-33 124 40 3 195 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q13ZK7 2.01e-33 126 38 4 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
A1B9Q7 2.13e-33 126 37 4 204 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q04BG2 2.14e-33 126 32 1 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q5LT05 2.55e-33 126 37 0 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q00752 3.15e-33 126 33 2 232 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q08381 3.18e-33 125 34 2 207 3 modC Molybdenum import ATP-binding protein ModC Rhodobacter capsulatus
Q8UII7 3.31e-33 125 35 0 184 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1BRZ8 3.7e-33 125 35 4 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 3.7e-33 125 35 4 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q03PF2 3.74e-33 125 34 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q98G42 3.8e-33 125 35 0 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0BFQ0 3.9e-33 124 34 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BWL4 3.98e-33 124 34 3 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 3.98e-33 124 34 3 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q5FA19 4e-33 125 36 2 213 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q89WG0 4.61e-33 125 35 0 199 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37732 4.66e-33 125 36 3 192 3 modC1 Molybdenum import ATP-binding protein ModC 1 Azotobacter vinelandii
Q608V9 5.14e-33 125 38 2 184 3 modC Molybdenum import ATP-binding protein ModC Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q164Y5 5.92e-33 125 35 0 200 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
P97027 6.16e-33 122 40 5 184 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q39KB9 6.18e-33 125 35 4 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O83658 6.41e-33 125 38 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q0BIZ6 6.58e-33 125 35 4 203 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9V2C0 6.61e-33 124 32 4 234 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q8U8D6 6.69e-33 123 38 2 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q65M64 7.07e-33 122 37 4 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2W1R8 7.56e-33 125 32 4 217 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q63Q62 8.05e-33 124 37 4 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q6D2F6 8.12e-33 124 38 5 206 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8DUF7 8.31e-33 125 37 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9L0Q1 8.99e-33 125 33 4 213 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0I2Z4 9.04e-33 124 34 0 192 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q2SU77 9.22e-33 124 37 4 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q98DT6 9.43e-33 122 36 4 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3JMW7 9.61e-33 124 37 4 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q62GB4 1e-32 124 37 4 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
P10091 1.03e-32 124 36 2 192 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q85A69 1.04e-32 125 34 2 192 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q660M8 1.04e-32 124 35 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
O51587 1.18e-32 124 35 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q63TW1 1.26e-32 123 34 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q0SML1 1.26e-32 124 35 3 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q9KRT4 1.27e-32 124 34 0 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6NDQ0 1.34e-32 124 32 2 243 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q62K56 1.36e-32 124 34 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q3JSR6 1.56e-32 123 34 3 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
O57896 1.71e-32 123 34 3 222 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q03ZQ0 1.73e-32 124 37 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q3IM24 1.85e-32 121 34 3 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
P55662 1.91e-32 121 32 4 236 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8PP41 2.01e-32 121 37 3 201 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q9A502 2.11e-32 123 34 2 215 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q65S66 2.12e-32 123 35 0 187 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q07UI9 2.16e-32 124 35 2 198 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q03AH0 2.39e-32 123 33 1 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P18813 2.47e-32 122 36 3 199 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
Q39GW5 2.52e-32 122 34 3 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q4ZSS5 2.52e-32 123 35 3 210 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. syringae (strain B728a)
A1SWH9 2.83e-32 123 33 0 201 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8D954 3.35e-32 123 33 0 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q7N8B9 3.54e-32 123 32 1 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7MLB8 3.57e-32 123 33 0 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q8XZQ4 3.72e-32 121 36 3 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q38VW6 3.82e-32 123 34 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8U4K3 4.69e-32 122 33 3 216 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P55604 6.29e-32 122 32 1 209 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7VYN2 6.59e-32 122 38 2 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WID6 6.73e-32 122 38 2 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P44531 7.57e-32 121 36 3 194 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7W6G5 7.63e-32 122 38 2 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q57213 9.62e-32 118 35 4 189 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O30144 9.64e-32 119 35 3 221 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8G5P8 9.96e-32 122 32 2 226 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
P37009 1.01e-31 121 34 0 197 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
P21410 1.19e-31 121 36 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q6CYU2 1.51e-31 119 35 5 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5M397 1.62e-31 122 35 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q9KLQ5 1.66e-31 121 33 3 211 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q56927 1.67e-31 121 34 6 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q9CM80 1.67e-31 121 34 0 192 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q66D71 1.72e-31 121 33 3 208 3 modC Molybdenum import ATP-binding protein ModC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q881C1 1.77e-31 121 33 2 208 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5LYN4 1.78e-31 121 35 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q1CFP9 1.81e-31 121 33 3 208 3 modC Molybdenum import ATP-binding protein ModC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGX6 1.81e-31 121 33 3 208 3 modC Molybdenum import ATP-binding protein ModC Yersinia pestis
Q1C951 1.81e-31 121 33 3 208 3 modC Molybdenum import ATP-binding protein ModC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8DZJ0 1.86e-31 121 35 3 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.86e-31 121 35 3 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.86e-31 121 35 3 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q03JH1 1.96e-31 121 35 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q1B677 2.01e-31 120 33 2 225 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q04G50 2.78e-31 120 33 3 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q7AH43 2.8e-31 120 33 2 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q4L5B3 2.81e-31 120 35 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q2RWI9 3.14e-31 120 32 5 209 3 modC Molybdenum import ATP-binding protein ModC Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q98KI3 3.14e-31 120 32 3 204 3 modC Molybdenum import ATP-binding protein ModC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5XCA4 3.35e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q7N6R3 3.45e-31 120 33 4 219 3 modC Molybdenum import ATP-binding protein ModC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1QTX6 3.94e-31 120 34 1 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P0CZ35 4e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 4e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 4e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8VNL9 4.05e-31 118 31 4 227 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q47CB7 4.13e-31 120 34 3 211 3 modC Molybdenum import ATP-binding protein ModC Dechloromonas aromatica (strain RCB)
Q4KC87 4.63e-31 120 36 3 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2SJB5 4.7e-31 120 33 3 209 3 modC Molybdenum import ATP-binding protein ModC Hahella chejuensis (strain KCTC 2396)
Q01937 4.8e-31 120 34 2 200 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q7CN92 4.92e-31 120 35 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 4.92e-31 120 35 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
D4GP39 5.26e-31 120 33 1 190 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q7CS28 5.55e-31 120 34 3 186 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1J6Q6 5.81e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 5.81e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 5.81e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 5.81e-31 120 36 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q13CI6 6.11e-31 120 35 1 198 3 modC Molybdenum import ATP-binding protein ModC Rhodopseudomonas palustris (strain BisB5)
O86751 6.2e-31 119 35 0 197 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q49WM4 6.95e-31 119 35 0 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6D734 7.77e-31 119 32 3 214 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P39459 7.77e-31 117 37 4 200 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q3SJC6 7.95e-31 119 39 3 182 3 modC Molybdenum import ATP-binding protein ModC Thiobacillus denitrificans (strain ATCC 25259)
Q8UCD5 9.35e-31 119 32 5 219 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q88G95 9.74e-31 119 38 3 184 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2K2X0 9.76e-31 119 33 3 203 3 modC Molybdenum import ATP-binding protein ModC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1MFL8 9.83e-31 117 37 3 198 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q16BJ3 9.88e-31 117 34 6 203 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8PHQ3 1.03e-30 117 37 4 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
E0SCY1 1.13e-30 120 37 3 199 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q4W575 1.17e-30 119 34 2 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.17e-30 119 34 2 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2JGF5 1.18e-30 117 36 3 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q13TV1 1.22e-30 119 35 3 190 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_09265
Feature type CDS
Gene thiQ
Product thiamine ABC transporter ATP-binding protein ThiQ
Location 74155 - 74853 (strand: 1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession ZDB_218
Length 215957 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1094
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3840 Coenzyme transport and metabolism (H) H ABC-type thiamine transport system, ATPase component ThiQ

Protein Sequence

MIYFDHILYRYQQQTMNFHFSVAAGEKIAILGPSGAGKSTLLSLIAGFQFAESGTILLNNEDHTRTPPASRPVSMLFQENNLFAHLTAEQNIALGFHPGMKLNAAQKVQLEQIAEQVSLTPLLKRLPSQLSGGQRQRVALARCLVRSQPVLLLDEPFSALDPALRNEMLALLETICDSRQLTLMMVSHNTDDAVRIAPRAMVVDNGTIAFDGSTAALVSGEVPQAQILGIRP

Flanking regions ( +/- flanking 50bp)

CTCTGTTTCGGGCTGTTTACCGTTCTGGAACGTCTGCCGGGGAAACGCCCATGATTTATTTTGATCATATTCTTTACCGCTATCAGCAACAGACCATGAATTTTCATTTTTCCGTTGCCGCCGGAGAAAAAATTGCCATTCTCGGCCCGAGCGGCGCGGGTAAAAGTACCCTGCTGTCACTGATTGCCGGGTTTCAGTTTGCCGAAAGCGGCACTATTCTGCTGAATAATGAAGATCACACCCGCACACCGCCCGCTTCACGCCCGGTATCCATGCTGTTTCAGGAAAATAACCTGTTTGCTCACCTGACGGCTGAACAGAATATCGCTCTCGGTTTTCATCCCGGGATGAAACTGAATGCGGCGCAAAAAGTGCAGCTGGAACAGATCGCTGAACAGGTTTCGCTGACACCACTGCTGAAACGGCTGCCATCACAGCTTTCCGGCGGTCAGCGCCAGCGGGTCGCACTGGCGCGCTGTCTGGTGCGTTCTCAGCCGGTTTTGCTGCTGGATGAACCCTTCTCCGCACTGGATCCGGCACTGCGCAATGAAATGCTGGCACTGCTGGAAACCATCTGTGATTCACGGCAGCTGACACTGATGATGGTTTCCCACAATACCGATGACGCAGTCCGAATCGCGCCCCGCGCGATGGTGGTGGATAACGGTACCATTGCCTTTGACGGCAGTACCGCCGCCCTGGTCAGCGGTGAGGTTCCCCAGGCTCAGATCCTCGGTATCCGTCCGTAAACCCGCATCTTAAATACTGTATATATCCACACCACTCTGCTATAGTTATT