Homologs in group_1658

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11055 FBDBKF_11055 100.0 Morganella morganii S1 galE UDP-glucose 4-epimerase GalE
NLDBIP_05490 NLDBIP_05490 100.0 Morganella morganii S4 galE UDP-glucose 4-epimerase GalE
LHKJJB_02370 LHKJJB_02370 100.0 Morganella morganii S3 galE UDP-glucose 4-epimerase GalE
HKOGLL_15750 HKOGLL_15750 100.0 Morganella morganii S5 galE UDP-glucose 4-epimerase GalE
F4V73_RS08190 F4V73_RS08190 88.8 Morganella psychrotolerans galE UDP-glucose 4-epimerase GalE
PMI_RS09615 PMI_RS09615 75.7 Proteus mirabilis HI4320 galE UDP-glucose 4-epimerase GalE

Distribution of the homologs in the orthogroup group_1658

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1658

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9F7D4 1.03e-164 465 63 0 338 3 galE UDP-glucose 4-epimerase Yersinia pestis
Q56093 7.85e-159 450 61 0 338 3 galE UDP-glucose 4-epimerase Salmonella typhi
P22715 7.15e-158 448 61 0 338 3 galE UDP-glucose 4-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09147 3.77e-157 446 60 0 338 1 galE UDP-glucose 4-epimerase Escherichia coli (strain K12)
P55180 3.7e-155 441 60 1 336 3 galE UDP-glucose 4-epimerase Bacillus subtilis (strain 168)
Q57301 1.15e-154 440 60 1 336 3 galE UDP-glucose 4-epimerase Yersinia enterocolitica
P24325 2.32e-154 439 60 0 338 3 galE UDP-glucose 4-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNY5 1.29e-153 437 60 0 338 3 galE UDP-glucose 4-epimerase Pasteurella multocida (strain Pm70)
P56986 6.8e-147 420 58 0 337 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup C
P56997 1.67e-146 419 58 0 336 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P56985 1.15e-144 414 57 0 337 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P35673 2.88e-142 408 58 0 335 3 galE UDP-glucose 4-epimerase Erwinia amylovora
E8MF10 4.54e-142 408 59 1 336 1 lnpD UDP-glucose 4-epimerase Bifidobacterium longum subsp. longum (strain ATCC 15707 / DSM 20219 / JCM 1217 / NCTC 11818 / E194b)
Q553X7 1.41e-141 407 56 2 337 1 galE UDP-glucose 4-epimerase Dictyostelium discoideum
Q05026 6.73e-141 405 55 0 338 3 galE UDP-glucose 4-epimerase Neisseria gonorrhoeae
Q3T105 6.67e-139 400 53 1 341 2 GALE UDP-glucose 4-epimerase Bos taurus
Q8R059 1.23e-138 399 53 1 341 1 Gale UDP-glucose 4-epimerase Mus musculus
Q5R8D0 5.15e-138 398 53 1 342 2 GALE UDP-glucose 4-epimerase Pongo abelii
Q59678 9.63e-138 397 56 0 336 3 galE UDP-glucose 4-epimerase Mannheimia haemolytica
Q14376 3.3e-137 396 53 1 342 1 GALE UDP-glucose 4-epimerase Homo sapiens
Q9W0P5 7.67e-137 395 54 2 344 1 Gale UDP-glucose 4-epimerase Drosophila melanogaster
O65781 5.45e-133 385 53 3 339 2 None UDP-glucose 4-epimerase GEPI48 Cyamopsis tetragonoloba
Q9T0A7 5.88e-133 385 54 3 335 1 UGE2 UDP-glucose 4-epimerase 2 Arabidopsis thaliana
Q9SN58 2.69e-132 384 53 3 338 1 UGE5 UDP-glucose 4-epimerase 5 Arabidopsis thaliana
Q6ZDJ7 3.54e-132 385 55 3 340 2 UGE-2 UDP-glucose 4-epimerase 2 Oryza sativa subsp. japonica
Q6K2E1 1.28e-130 380 53 3 339 2 UGE-4 UDP-glucose 4-epimerase 4 Oryza sativa subsp. japonica
Q8LNZ3 6.84e-130 377 53 3 340 2 UGE-1 UDP-glucose 4-epimerase 1 Oryza sativa subsp. japonica
P18645 2e-129 376 52 3 341 2 Gale UDP-glucose 4-epimerase Rattus norvegicus
B0M3E8 1.45e-127 372 51 3 342 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Pisum sativum
Q42605 5.85e-127 370 51 3 342 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Arabidopsis thaliana
Q43070 1.27e-126 369 50 3 342 2 GALE UDP-glucose 4-epimerase Pisum sativum
O65780 1.33e-125 367 51 3 340 2 None UDP-glucose 4-epimerase GEPI42 Cyamopsis tetragonoloba
Q9Y7X5 2.71e-124 363 51 3 339 1 uge1 UDP-glucose 4-epimerase uge1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8LDN8 3.07e-124 363 51 3 340 1 UGE3 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 3 Arabidopsis thaliana
Q652A8 4.28e-122 358 51 3 341 2 UGE-3 UDP-glucose 4-epimerase 3 Oryza sativa subsp. japonica
Q9C7W7 4.48e-122 357 51 3 339 1 UGE4 UDP-glucose 4-epimerase 4 Arabidopsis thaliana
Q564Q1 7.57e-122 357 51 4 349 1 gale-1 UDP-glucose 4-epimerase Caenorhabditis elegans
P04397 6.53e-120 364 51 5 343 1 GAL10 Bifunctional protein GAL10 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HDU3 6.62e-120 364 50 4 342 3 gal10 Bifunctional protein gal10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P09609 3.9e-110 338 49 3 338 2 GAL10 Bifunctional protein GAL10 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P40801 1.55e-107 332 49 4 341 2 GAL10 Bifunctional protein GAL10 Pachysolen tannophilus
Q9KDV3 1.06e-94 287 44 5 338 3 galE UDP-glucose 4-epimerase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O84903 7.4e-88 270 42 5 339 3 galE UDP-glucose 4-epimerase Lacticaseibacillus casei
Q7WTB1 1.55e-81 254 41 5 339 2 galE UDP-glucose 4-epimerase Lactobacillus helveticus
P33119 5.01e-77 242 42 8 332 3 galE UDP-glucose 4-epimerase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q59745 5.48e-77 242 40 5 332 3 exoB UDP-glucose 4-epimerase Rhizobium leguminosarum bv. trifolii
P21977 8.63e-77 241 40 8 343 3 galE UDP-glucose 4-epimerase Streptococcus thermophilus
P13226 9.68e-77 241 42 8 337 3 galE UDP-glucose 4-epimerase Streptomyces lividans
Q9FI17 9.69e-76 242 40 7 342 3 At5g44480 Putative UDP-arabinose 4-epimerase 4 Arabidopsis thaliana
Q59083 2.41e-75 238 40 6 331 3 exoB UDP-glucose 4-epimerase Azospirillum brasilense
Q8H0B2 6.47e-75 239 40 7 344 2 UEL-3 Probable UDP-arabinose 4-epimerase 3 Oryza sativa subsp. japonica
P96995 1.34e-74 236 41 8 343 3 galE UDP-glucose 4-epimerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9SUN3 1.7e-74 238 40 8 345 2 At4g20460 Probable UDP-arabinose 4-epimerase 3 Arabidopsis thaliana
P26503 2.03e-74 235 41 5 335 3 exoB UDP-glucose 4-epimerase Rhizobium meliloti (strain 1021)
Q8H0B6 7.53e-74 236 40 9 345 2 UEL-2 Probable UDP-arabinose 4-epimerase 2 Oryza sativa subsp. japonica
O64749 6.1e-72 232 40 7 342 2 At2g34850 Putative UDP-arabinose 4-epimerase 2 Arabidopsis thaliana
Q9SA77 7.56e-72 231 39 8 344 1 MUR4 UDP-arabinose 4-epimerase 1 Arabidopsis thaliana
Q8H930 2.54e-71 230 40 8 345 2 UEL-1 Probable UDP-arabinose 4-epimerase 1 Oryza sativa subsp. japonica
Q45291 6.82e-69 221 38 9 330 3 galE UDP-glucose 4-epimerase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P45602 2.71e-53 174 60 0 138 3 galE UDP-glucose 4-epimerase (Fragment) Klebsiella pneumoniae
P47364 3.99e-46 162 35 13 334 3 galE UDP-glucose 4-epimerase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75517 2.87e-45 160 33 9 330 3 galE UDP-glucose 4-epimerase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P56600 1.21e-40 142 57 2 129 3 GAL10 Bifunctional protein GAL10 (Fragment) Candida maltosa
F8C4X8 7.6e-33 127 29 9 335 1 TOPB45_0660 UDP-glucuronate 4-epimerase Thermodesulfobacterium geofontis (strain OPF15)
Q57664 1.79e-30 120 30 13 335 3 MJ0211 Putative UDP-glucose 4-epimerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P39858 2.21e-22 99 23 6 345 3 capI Protein CapI Staphylococcus aureus
Q04973 2.4e-22 99 28 7 273 3 vipB Vi polysaccharide biosynthesis protein VipB/TviC Salmonella typhi
Q9LPG6 3.11e-21 98 26 16 354 1 RHM2 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM2 Arabidopsis thaliana
Q7BJX9 3.69e-21 95 29 9 274 1 wbgU UDP-N-acetylglucosamine 4-epimerase Plesiomonas shigelloides
Q54WS6 1.52e-20 95 27 10 286 3 tgds dTDP-D-glucose 4,6-dehydratase Dictyostelium discoideum
A6QLW2 4.06e-20 93 28 7 271 2 TGDS dTDP-D-glucose 4,6-dehydratase Bos taurus
O95455 1.23e-19 91 28 7 271 1 TGDS dTDP-D-glucose 4,6-dehydratase Homo sapiens
Q58455 1.34e-19 91 22 7 337 3 MJ1055 Uncharacterized protein MJ1055 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B9J8R3 2.35e-19 90 22 7 351 1 lpsL UDP-glucuronate 4-epimerase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q9LH76 2.57e-19 92 27 17 355 2 RHM3 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 Arabidopsis thaliana
Q9ZAE8 2.79e-19 90 30 15 308 3 acbB dTDP-glucose 4,6-dehydratase Actinoplanes sp. (strain ATCC 31044 / CBS 674.73 / SE50/110)
Q9SYM5 4.95e-19 91 28 18 355 1 RHM1 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM1 Arabidopsis thaliana
O81312 1.53e-18 89 25 10 345 2 GAE3 UDP-glucuronate 4-epimerase 3 Arabidopsis thaliana
Q8VDR7 1.94e-18 88 28 9 277 2 Tgds dTDP-D-glucose 4,6-dehydratase Mus musculus
P37759 8.57e-18 86 26 15 357 3 rfbB dTDP-glucose 4,6-dehydratase 1 Escherichia coli (strain K12)
O22141 1.39e-17 86 24 10 345 1 GAE4 UDP-glucuronate 4-epimerase 4 Arabidopsis thaliana
O06485 2.17e-17 85 22 9 331 3 yfnG Putative sugar dehydratase/epimerase YfnG Bacillus subtilis (strain 168)
P37777 2.74e-17 85 25 12 365 3 rfbB dTDP-glucose 4,6-dehydratase Shigella flexneri
Q9LPC1 2.74e-17 85 27 10 295 2 GAE2 UDP-glucuronate 4-epimerase 2 Arabidopsis thaliana
Q04871 5.79e-17 84 23 7 347 3 None Uncharacterized 37.6 kDa protein in cld 5'region Escherichia coli O111:H-
B0RVL0 9.35e-17 83 26 9 320 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain B100)
O54067 1.38e-16 82 23 9 354 3 lspL Probable UDP-glucuronate 4-epimerase Rhizobium meliloti (strain 1021)
P27830 2.52e-16 82 24 11 354 1 rffG dTDP-glucose 4,6-dehydratase 2 Escherichia coli (strain K12)
D4GU72 2.81e-16 81 28 11 284 3 agl12 Low-salt glycan biosynthesis protein Agl12 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9STI6 3.48e-16 82 26 10 290 2 GAE5 UDP-glucuronate 4-epimerase 5 Arabidopsis thaliana
P55293 4.55e-16 81 26 15 357 3 rfbB dTDP-glucose 4,6-dehydratase Escherichia coli
Q9LIS3 6.69e-16 81 26 11 331 1 GAE6 UDP-glucuronate 4-epimerase 6 Arabidopsis thaliana
P14169 7.05e-16 80 26 10 286 1 rfbE CDP-paratose 2-epimerase Salmonella typhi
Q9S642 8.2e-16 80 26 14 356 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P0C7J0 9.36e-16 80 25 11 354 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q47GJ3 2.36e-14 76 27 11 280 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Dechloromonas aromatica (strain RCB)
P37761 2.63e-14 76 26 16 356 3 rfbB dTDP-glucose 4,6-dehydratase Neisseria gonorrhoeae
Q2SYH7 4.59e-14 75 23 10 349 1 wbiB dTDP-L-rhamnose 4-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P26391 4.75e-14 75 24 13 367 1 rfbB dTDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5UR12 8.32e-14 74 26 12 289 1 MIMI_R141 Putative dTDP-D-glucose 4,6-dehydratase Acanthamoeba polyphaga mimivirus
Q6E7F4 1e-13 74 27 15 365 1 rmlB dTDP-glucose 4,6-dehydratase Escherichia coli
P55294 1.01e-13 74 25 12 356 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9RR28 1.14e-13 74 27 18 366 3 oleE dTDP-glucose 4,6-dehydratase Streptomyces antibioticus
Q9L9E8 1.3e-13 74 28 13 294 3 novT dTDP-glucose 4,6-dehydratase Streptomyces niveus
P9WN67 2.47e-13 73 28 9 314 1 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN66 2.47e-13 73 28 9 314 3 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O34886 3.81e-13 72 22 13 328 3 ytcB Uncharacterized UDP-glucose epimerase YtcB Bacillus subtilis (strain 168)
P29782 5.3e-13 72 28 11 284 1 strE dTDP-glucose 4,6-dehydratase Streptomyces griseus
A0R5C5 5.95e-13 72 27 10 316 1 MSMEG_6142 UDP-glucose 4-epimerase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P55462 7.99e-13 72 23 10 356 3 NGR_a03580 Probable dTDP-glucose 4,6-dehydratase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q31FG4 9.4e-13 71 27 17 347 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8X7P7 9.97e-13 71 26 10 284 1 gnu N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase Escherichia coli O157:H7
C0QZ84 1.12e-12 71 28 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A0QSK6 1.8e-12 70 30 11 242 1 rmlB dTDP-glucose 4,6-dehydratase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P39630 2.04e-12 70 24 11 333 1 rfbB dTDP-glucose 4,6-dehydratase Bacillus subtilis (strain 168)
Q9M0B6 2.11e-12 71 29 4 188 1 GAE1 UDP-glucuronate 4-epimerase 1 Arabidopsis thaliana
Q8VZC0 2.64e-12 70 25 15 320 1 UXS1 UDP-glucuronic acid decarboxylase 1 Arabidopsis thaliana
A1KT78 2.64e-12 70 28 12 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JQX8 3.1e-12 70 27 12 296 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9K002 4.1e-12 69 28 13 293 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M3Q7 4.62e-12 69 28 13 293 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C (strain 053442)
Q9HTB6 1.51e-11 67 28 7 211 1 rmd GDP-6-deoxy-D-mannose reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6DF08 1.61e-11 68 26 12 284 2 uxs1 UDP-glucuronic acid decarboxylase 1 Xenopus tropicalis
Q5PQX0 3.4e-11 67 26 12 284 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Rattus norvegicus
Q5R885 3.62e-11 67 26 12 284 2 UXS1 UDP-glucuronic acid decarboxylase 1 Pongo abelii
Q8NBZ7 3.93e-11 67 26 12 284 1 UXS1 UDP-glucuronic acid decarboxylase 1 Homo sapiens
Q91XL3 4.04e-11 67 26 12 284 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Mus musculus
Q51061 4.18e-11 66 27 12 281 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae
Q9LZI2 4.53e-11 67 26 13 280 1 UXS2 UDP-glucuronic acid decarboxylase 2 Arabidopsis thaliana
A9ADU8 9.05e-11 65 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia multivorans (strain ATCC 17616 / 249)
P9WN65 1.34e-10 65 29 14 257 1 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN64 1.34e-10 65 29 14 257 3 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P44914 1.91e-10 64 26 16 353 3 rffG dTDP-glucose 4,6-dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6GMI9 2.69e-10 64 25 11 275 1 uxs1 UDP-glucuronic acid decarboxylase 1 Danio rerio
Q0BH85 3.12e-10 63 27 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YV41 3.42e-10 63 27 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain MC40-6)
A4JCI2 3.55e-10 63 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q9ZV36 3.62e-10 63 26 12 318 2 UXS6 UDP-glucuronic acid decarboxylase 6 Arabidopsis thaliana
Q5F9J0 3.9e-10 63 28 14 280 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B2U894 3.94e-10 63 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Ralstonia pickettii (strain 12J)
Q8S8T4 6.03e-10 63 26 13 280 2 UXS4 UDP-glucuronic acid decarboxylase 4 Arabidopsis thaliana
Q1BY20 6.05e-10 63 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain AU 1054)
B1JXS7 6.05e-10 63 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain MC0-3)
A0K5M9 6.05e-10 63 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain HI2424)
Q39IF3 1.1e-09 62 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7NTL6 1.12e-09 62 25 13 293 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A5UIN9 1.33e-09 62 28 15 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain PittGG)
B3R3C0 1.35e-09 62 29 15 313 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q2SY18 1.4e-09 62 25 12 270 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q4QLI0 1.47e-09 62 28 15 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain 86-028NP)
Q1LQG2 1.85e-09 61 27 13 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P45048 1.9e-09 61 28 15 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P35675 1.93e-09 59 30 6 166 3 None Uncharacterized protein in galE 3'region (Fragment) Erwinia amylovora
P95780 1.96e-09 61 24 14 350 1 rmlB dTDP-glucose 4,6-dehydratase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q0KDH0 2.36e-09 61 29 14 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B3GYT6 2.44e-09 61 29 16 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B4EB34 3.3e-09 60 25 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q9SN95 3.88e-09 60 25 12 318 2 UXS5 UDP-glucuronic acid decarboxylase 5 Arabidopsis thaliana
B8F727 4.05e-09 60 28 17 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Glaesserella parasuis serovar 5 (strain SH0165)
Q9FIE8 4.27e-09 60 25 12 318 1 UXS3 UDP-glucuronic acid decarboxylase 3 Arabidopsis thaliana
Q02QH1 6.8e-09 60 28 12 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain UCBPP-PA14)
B5XTI2 7.79e-09 59 27 15 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae (strain 342)
A3NC24 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 668)
Q3JPY8 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1710b)
A3NXW3 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1106a)
A1V6L4 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain SAVP1)
Q62M34 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain ATCC 23344)
A2S4R1 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10229)
A3MHP7 9.2e-09 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10247)
P0DMK5 1.11e-08 59 26 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain K96243)
B0BSD7 1.12e-08 59 29 17 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N308 1.12e-08 59 29 17 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6TFL4 1.24e-08 58 27 14 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
I1WGR6 1.62e-08 58 27 13 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1026b)
Q9HYQ8 1.68e-08 58 27 12 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9MKQ6 1.71e-08 58 27 13 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9XCA1 1.73e-08 58 27 14 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae
B1LK58 1.75e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain SMS-3-5 / SECEC)
B1IZH2 1.99e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A683 1.99e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O9:H4 (strain HS)
Q9CL97 2.32e-08 58 27 14 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pasteurella multocida (strain Pm70)
Q3YVY3 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella sonnei (strain Ss046)
Q83PP2 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri
Q0SYE8 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri serotype 5b (strain 8401)
Q31V04 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 4 (strain Sb227)
B2U5D7 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R4X2 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain UTI89 / UPEC)
B7NES6 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FCA0 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBI8 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHF5 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O1:K1 / APEC
B7N1S3 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O81 (strain ED1a)
B7NPC7 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MFI2 2.45e-08 58 26 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LVH8 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I3J9 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain SE11)
P67910 2.57e-08 58 27 12 273 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12)
B1X953 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12 / DH10B)
C4ZXL1 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M4A5 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O8 (strain IAI1)
B5YWC0 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P67911 2.57e-08 58 27 12 273 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O157:H7
B7L745 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain 55989 / EAEC)
B7ULH4 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTH2 2.57e-08 58 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O139:H28 (strain E24377A / ETEC)
B2VL47 2.76e-08 58 27 13 278 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6V291 2.77e-08 58 28 12 276 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain PA7)
P55579 3.2e-08 58 24 11 282 3 NGR_a02350 Uncharacterized protein y4nG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q329N6 4.02e-08 57 27 12 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella dysenteriae serotype 1 (strain Sd197)
A1KBH4 4.77e-08 57 28 13 279 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Azoarcus sp. (strain BH72)
Q3A8K5 4.86e-08 57 29 16 286 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C4K8I6 5.02e-08 57 26 18 314 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q3J7X9 5.18e-08 57 25 11 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q9JRN7 5.2e-08 57 23 12 326 1 tld GDP-6-deoxy-D-talose 4-dehydrogenase Aggregatibacter actinomycetemcomitans
A0A1B4XBH2 5.96e-08 57 26 10 287 3 sdnI GDP-mannose 4,6-dehydratase sdnI Sordaria araneosa
A1VGB0 6.45e-08 57 25 16 291 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain DP4)
B2JF12 6.47e-08 57 25 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q65WA7 7.07e-08 56 26 13 289 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VLD2 7.47e-08 56 27 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A4W527 8.01e-08 56 27 16 286 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Enterobacter sp. (strain 638)
Q331Q7 8.9e-08 56 25 12 290 1 gerKI dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces sp.
Q5SFA6 8.9e-08 56 26 12 295 1 chmD dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces bikiniensis
Q7VKK8 1.13e-07 56 27 14 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q13VD0 1.17e-07 56 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia xenovorans (strain LB400)
B2T625 1.18e-07 56 26 12 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q98I52 1.23e-07 56 27 11 266 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C5BB97 1.23e-07 56 25 15 341 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Edwardsiella ictaluri (strain 93-146)
B5RGG8 1.43e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5E3 1.43e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella enteritidis PT4 (strain P125109)
B5FLI8 1.43e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella dublin (strain CT_02021853)
B4SXC1 1.78e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella newport (strain SL254)
P67912 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67913 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhi
B4TZW1 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella schwarzengrund (strain CVM19633)
B5BHZ3 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain AKU_12601)
A9MVL2 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PC05 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9A3 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella heidelberg (strain SL476)
B5EXC5 1.8e-07 55 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella agona (strain SL483)
Q72ET7 2.24e-07 55 25 16 291 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9SGE0 2.61e-07 55 21 11 311 2 AXS2 UDP-D-apiose/UDP-D-xylose synthase 2 Arabidopsis thaliana
Q12CM2 2.64e-07 55 26 13 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B4F132 2.71e-07 55 30 14 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Proteus mirabilis (strain HI4320)
G3XMB9 3.35e-07 55 26 7 209 2 azaE Ketoreductase azaE Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A6NKP2 3.76e-07 55 23 10 300 3 SDR42E2 Putative short-chain dehydrogenase/reductase family 42E member 2 Homo sapiens
A8ARK8 4.59e-07 54 27 12 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9ZUY6 4.81e-07 54 20 11 311 1 AXS1 UDP-D-apiose/UDP-D-xylose synthase 1 Arabidopsis thaliana
C0Q1V2 6.02e-07 53 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi C (strain RKS4594)
Q57IC3 6.02e-07 53 27 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella choleraesuis (strain SC-B67)
B1JQW4 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66GC7 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSC8 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis (strain Pestoides F)
Q1CD11 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R683 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJN4 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis
B2JYP2 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C276 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCU3 6.14e-07 53 26 13 273 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q67WR2 6.49e-07 53 21 12 347 2 Os06g0652400 Probable GDP-L-fucose synthase 1 Oryza sativa subsp. japonica
Q7MY46 6.6e-07 53 27 15 278 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B0UWU3 6.63e-07 53 26 16 340 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 2336)
Q0I569 6.63e-07 53 26 16 340 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 129Pt)
A7MQ91 7.77e-07 53 26 15 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cronobacter sakazakii (strain ATCC BAA-894)
Q0A4T8 8.64e-07 53 27 13 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A0A0U3AP28 1.17e-06 53 24 10 266 1 HS5.17 CDP-6-D-glucitol synthase Campylobacter jejuni
O49213 1.22e-06 53 21 9 287 1 GER1 GDP-L-fucose synthase 1 Arabidopsis thaliana
Q21Y60 2e-06 52 26 12 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1SRT6 2.08e-06 52 25 15 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A9IJJ7 2.12e-06 52 26 12 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q46Y59 2.99e-06 52 26 13 279 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1JHX6 5.41e-06 51 25 15 293 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A3QJB2 5.81e-06 50 25 14 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q87T56 5.99e-06 50 26 17 306 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3SK74 6.35e-06 50 27 15 279 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Thiobacillus denitrificans (strain ATCC 25259)
C6DIA9 7.03e-06 50 26 14 288 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MSM1 9e-06 50 26 16 304 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio campbellii (strain ATCC BAA-1116)
Q8S9Z2 1.46e-05 50 20 12 312 2 Os01g0969100 UDP-D-apiose/UDP-D-xylose synthase Oryza sativa subsp. japonica
O48917 1.62e-05 50 24 14 321 1 SQD1 UDP-sulfoquinovose synthase, chloroplastic Arabidopsis thaliana
P26397 2.3e-05 49 26 3 160 1 rfbG CDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5E8J9 2.49e-05 48 26 16 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4SHC0 2.52e-05 48 28 14 270 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aeromonas salmonicida (strain A449)
P44094 2.75e-05 48 26 6 163 1 denD D-erythronate dehydrogenase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C3LQK1 3.37e-05 48 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain M66-2)
Q06963 3.37e-05 48 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3Z4 3.37e-05 48 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MPN6 6.31e-05 47 25 16 304 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain YJ016)
Q8DE09 6.66e-05 47 26 16 304 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain CMCP6)
A1VR25 0.000103 47 25 13 271 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas naphthalenivorans (strain CJ2)
Q0P9D4 0.000105 47 28 7 186 1 pglF UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
L7WRR9 0.000149 46 24 4 145 1 notP' Short chain dehydrogenases/reductase notP' Aspergillus versicolor
Q2NQV7 0.000155 46 27 13 272 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Sodalis glossinidius (strain morsitans)
Q6DAT7 0.00017 46 25 14 288 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0P8I7 0.000209 46 24 9 262 1 Cj1427c GDP-D-glycero-alpha-D-manno-heptose dehydrogenase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B5FFS9 0.000313 45 26 16 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain MJ11)
Q5A1B0 0.000588 45 22 8 263 1 ERG26 Sterol-4-alpha-carboxylate 3-dehydrogenase ERG26, decarboxylating Candida albicans (strain SC5314 / ATCC MYA-2876)
B1XVP6 0.00075 44 27 13 287 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polynucleobacter necessarius subsp. necessarius (strain STIR1)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_05170
Feature type CDS
Gene galE
Product UDP-glucose 4-epimerase GalE
Location 23987 - 25003 (strand: -1)
Length 1017 (nucleotides) / 338 (amino acids)

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1658
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01370 NAD dependent epimerase/dehydratase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1087 Cell wall/membrane/envelope biogenesis (M) M UDP-glucose 4-epimerase

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG013288 UDP-glucose 4-epimerase VF0044 Immune modulation

Protein Sequence

MEILVTGGMGYIGSHTCVQLMNAGMTPVIVDNLCNANAKVLARITAITGKEPVFYQGDIRDEAFLDSVFAKHRIDAVIHFAGLKAVGESVEKPVEYYDNNINGTLVLLRSMKRAQVKRIIFSSSATVYGDPASVPITEESAIGNTTNPYGTSKYMVERILNDVLIADNGWSVSLLRYFNPVGAHPTGTMGEDPKGIPNNLTPYITQVAIGRREKVSIYGNDYPTPDGTGVRDYIHVMDLADGHVAALKTVAQSSGLHIYNLGTGKGTSVLEMIAAFSKAAGKPIPYAVCDRRPGDIAECWSSPDKAARDMQWRAVRTVDDMAQDAWRWQQQNPEGYAD

Flanking regions ( +/- flanking 50bp)

CGTTATACTTTGGTTTTCTCTGAATACATTACAAAGCCTGAGAGGTATATGTGGAAATTCTTGTCACCGGCGGTATGGGCTATATCGGCAGCCATACCTGCGTACAGCTGATGAATGCAGGCATGACACCGGTTATTGTGGATAATCTGTGTAACGCCAATGCCAAAGTTCTGGCGCGGATCACTGCAATTACCGGAAAAGAACCTGTGTTTTATCAGGGGGATATCCGTGATGAAGCCTTTCTTGACAGCGTATTTGCCAAACACCGTATTGATGCGGTGATTCACTTTGCGGGCCTGAAAGCCGTGGGTGAATCCGTGGAAAAACCGGTTGAATATTATGATAACAATATCAACGGCACGCTGGTTCTGCTGCGCAGCATGAAGCGGGCACAGGTCAAACGGATTATTTTCAGCTCTTCCGCCACTGTGTACGGCGATCCGGCCAGTGTGCCGATTACCGAAGAATCCGCTATCGGCAATACCACAAACCCTTACGGCACCAGCAAATACATGGTTGAGCGCATTCTGAATGATGTGCTGATCGCGGATAATGGCTGGTCTGTGTCACTGCTGCGTTATTTCAACCCGGTCGGGGCGCATCCGACAGGCACGATGGGTGAGGATCCTAAAGGTATCCCGAATAACCTGACGCCATATATCACTCAGGTTGCTATCGGCCGCCGTGAAAAAGTCAGTATCTATGGAAACGATTACCCTACACCTGACGGTACCGGGGTGCGTGATTACATCCATGTGATGGATCTGGCGGACGGCCATGTTGCGGCACTGAAAACCGTGGCACAGTCCTCCGGGCTGCATATCTATAACCTGGGCACCGGCAAAGGCACCAGTGTGCTGGAAATGATTGCTGCGTTCAGTAAAGCTGCCGGTAAACCGATCCCGTATGCTGTCTGTGACCGCCGTCCGGGGGATATCGCTGAGTGCTGGTCCAGCCCGGATAAAGCGGCCCGCGATATGCAGTGGCGTGCCGTCCGTACTGTTGATGATATGGCGCAGGATGCCTGGCGCTGGCAGCAGCAGAACCCGGAAGGTTACGCAGACTGACGAAATACGAAAACCGGTAACGCCTGAGGACAATCATCGCTAACCCGTTT