Homologs in group_1658

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11055 FBDBKF_11055 75.7 Morganella morganii S1 galE UDP-glucose 4-epimerase GalE
EHELCC_05170 EHELCC_05170 75.7 Morganella morganii S2 galE UDP-glucose 4-epimerase GalE
NLDBIP_05490 NLDBIP_05490 75.7 Morganella morganii S4 galE UDP-glucose 4-epimerase GalE
LHKJJB_02370 LHKJJB_02370 75.7 Morganella morganii S3 galE UDP-glucose 4-epimerase GalE
HKOGLL_15750 HKOGLL_15750 75.7 Morganella morganii S5 galE UDP-glucose 4-epimerase GalE
F4V73_RS08190 F4V73_RS08190 74.9 Morganella psychrotolerans galE UDP-glucose 4-epimerase GalE

Distribution of the homologs in the orthogroup group_1658

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1658

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56093 6.91e-160 453 62 0 336 3 galE UDP-glucose 4-epimerase Salmonella typhi
P22715 1.73e-159 452 62 0 336 3 galE UDP-glucose 4-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09147 2.82e-158 449 61 0 336 1 galE UDP-glucose 4-epimerase Escherichia coli (strain K12)
Q9F7D4 2.88e-158 449 61 0 336 3 galE UDP-glucose 4-epimerase Yersinia pestis
P55180 2.17e-157 447 59 1 336 3 galE UDP-glucose 4-epimerase Bacillus subtilis (strain 168)
Q9CNY5 1.5e-152 434 61 0 336 3 galE UDP-glucose 4-epimerase Pasteurella multocida (strain Pm70)
P35673 5.31e-152 433 61 0 335 3 galE UDP-glucose 4-epimerase Erwinia amylovora
P24325 1.63e-150 429 61 0 336 3 galE UDP-glucose 4-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57301 1.8e-149 427 59 1 336 3 galE UDP-glucose 4-epimerase Yersinia enterocolitica
Q8R059 9.12e-149 425 57 1 341 1 Gale UDP-glucose 4-epimerase Mus musculus
Q3T105 1.16e-148 425 57 1 341 2 GALE UDP-glucose 4-epimerase Bos taurus
Q5R8D0 1.27e-147 422 56 1 341 2 GALE UDP-glucose 4-epimerase Pongo abelii
Q14376 4.73e-147 421 56 1 341 1 GALE UDP-glucose 4-epimerase Homo sapiens
P56985 5.77e-147 420 59 0 335 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P56997 8.65e-147 420 59 0 334 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P56986 4.98e-146 418 59 0 335 3 galE UDP-glucose 4-epimerase Neisseria meningitidis serogroup C
Q59678 1.94e-143 411 59 0 336 3 galE UDP-glucose 4-epimerase Mannheimia haemolytica
Q553X7 2.22e-143 411 59 2 335 1 galE UDP-glucose 4-epimerase Dictyostelium discoideum
Q05026 5.04e-142 408 57 0 336 3 galE UDP-glucose 4-epimerase Neisseria gonorrhoeae
E8MF10 2.36e-141 406 59 1 334 1 lnpD UDP-glucose 4-epimerase Bifidobacterium longum subsp. longum (strain ATCC 15707 / DSM 20219 / JCM 1217 / NCTC 11818 / E194b)
O65781 1.07e-139 402 57 3 338 2 None UDP-glucose 4-epimerase GEPI48 Cyamopsis tetragonoloba
Q9SN58 4.24e-139 401 57 3 338 1 UGE5 UDP-glucose 4-epimerase 5 Arabidopsis thaliana
Q9T0A7 4.77e-139 400 57 3 335 1 UGE2 UDP-glucose 4-epimerase 2 Arabidopsis thaliana
P18645 1.34e-138 399 55 3 341 2 Gale UDP-glucose 4-epimerase Rattus norvegicus
Q9W0P5 9.12e-138 397 54 2 342 1 Gale UDP-glucose 4-epimerase Drosophila melanogaster
Q6ZDJ7 2.23e-137 399 57 3 339 2 UGE-2 UDP-glucose 4-epimerase 2 Oryza sativa subsp. japonica
Q8LNZ3 2.66e-135 391 56 3 340 2 UGE-1 UDP-glucose 4-epimerase 1 Oryza sativa subsp. japonica
Q6K2E1 1.11e-134 390 55 3 338 2 UGE-4 UDP-glucose 4-epimerase 4 Oryza sativa subsp. japonica
Q9Y7X5 5.1e-130 378 52 3 339 1 uge1 UDP-glucose 4-epimerase uge1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q42605 1.33e-125 367 53 3 340 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Arabidopsis thaliana
Q8LDN8 1.61e-125 366 53 3 342 1 UGE3 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 3 Arabidopsis thaliana
B0M3E8 4.31e-125 365 52 3 341 1 UGE1 Bifunctional UDP-glucose 4-epimerase and UDP-xylose 4-epimerase 1 Pisum sativum
Q9C7W7 7.66e-125 365 52 3 338 1 UGE4 UDP-glucose 4-epimerase 4 Arabidopsis thaliana
Q43070 2.84e-124 363 51 3 341 2 GALE UDP-glucose 4-epimerase Pisum sativum
O65780 1.29e-123 362 52 4 342 2 None UDP-glucose 4-epimerase GEPI42 Cyamopsis tetragonoloba
P04397 2.74e-123 372 52 5 343 1 GAL10 Bifunctional protein GAL10 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HDU3 4.07e-122 370 52 4 342 3 gal10 Bifunctional protein gal10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q564Q1 2.25e-121 356 49 3 347 1 gale-1 UDP-glucose 4-epimerase Caenorhabditis elegans
Q652A8 2.39e-121 357 51 3 340 2 UGE-3 UDP-glucose 4-epimerase 3 Oryza sativa subsp. japonica
P40801 3.84e-115 351 51 3 341 2 GAL10 Bifunctional protein GAL10 Pachysolen tannophilus
P09609 5.63e-114 348 50 3 338 2 GAL10 Bifunctional protein GAL10 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9KDV3 2.08e-98 297 47 6 339 3 galE UDP-glucose 4-epimerase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O84903 1.87e-89 274 43 6 339 3 galE UDP-glucose 4-epimerase Lacticaseibacillus casei
Q7WTB1 1.64e-84 261 41 6 339 2 galE UDP-glucose 4-epimerase Lactobacillus helveticus
P33119 4.97e-82 255 43 10 336 3 galE UDP-glucose 4-epimerase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P96995 3.84e-80 250 41 7 340 3 galE UDP-glucose 4-epimerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P13226 8.1e-79 246 42 7 334 3 galE UDP-glucose 4-epimerase Streptomyces lividans
P21977 3.55e-78 245 41 8 341 3 galE UDP-glucose 4-epimerase Streptococcus thermophilus
Q8H0B2 7.88e-78 246 39 7 346 2 UEL-3 Probable UDP-arabinose 4-epimerase 3 Oryza sativa subsp. japonica
Q8H0B6 8.63e-78 246 40 9 345 2 UEL-2 Probable UDP-arabinose 4-epimerase 2 Oryza sativa subsp. japonica
Q9SA77 1.01e-77 247 40 8 344 1 MUR4 UDP-arabinose 4-epimerase 1 Arabidopsis thaliana
Q59745 2.46e-76 240 40 6 335 3 exoB UDP-glucose 4-epimerase Rhizobium leguminosarum bv. trifolii
Q45291 6.29e-76 239 41 9 332 3 galE UDP-glucose 4-epimerase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8H930 3.88e-75 240 39 7 344 2 UEL-1 Probable UDP-arabinose 4-epimerase 1 Oryza sativa subsp. japonica
P26503 6.87e-75 236 40 5 335 3 exoB UDP-glucose 4-epimerase Rhizobium meliloti (strain 1021)
Q9FI17 1.21e-74 239 39 8 343 3 At5g44480 Putative UDP-arabinose 4-epimerase 4 Arabidopsis thaliana
Q9SUN3 8.63e-74 236 39 7 343 2 At4g20460 Probable UDP-arabinose 4-epimerase 3 Arabidopsis thaliana
O64749 2.42e-72 233 39 8 342 2 At2g34850 Putative UDP-arabinose 4-epimerase 2 Arabidopsis thaliana
Q59083 9.66e-71 226 40 8 330 3 exoB UDP-glucose 4-epimerase Azospirillum brasilense
P45602 2.6e-55 180 63 0 138 3 galE UDP-glucose 4-epimerase (Fragment) Klebsiella pneumoniae
P47364 2.85e-45 160 32 11 333 3 galE UDP-glucose 4-epimerase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75517 8.97e-43 154 32 9 330 3 galE UDP-glucose 4-epimerase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P56600 5.08e-41 143 49 2 146 3 GAL10 Bifunctional protein GAL10 (Fragment) Candida maltosa
F8C4X8 9.94e-39 142 32 9 333 1 TOPB45_0660 UDP-glucuronate 4-epimerase Thermodesulfobacterium geofontis (strain OPF15)
Q57664 5.71e-36 135 32 10 331 3 MJ0211 Putative UDP-glucose 4-epimerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q04973 7.5e-23 100 26 11 340 3 vipB Vi polysaccharide biosynthesis protein VipB/TviC Salmonella typhi
Q7BJX9 1.42e-21 97 29 9 275 1 wbgU UDP-N-acetylglucosamine 4-epimerase Plesiomonas shigelloides
Q58455 1e-20 94 23 7 341 3 MJ1055 Uncharacterized protein MJ1055 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O22141 2.41e-20 94 25 10 342 1 GAE4 UDP-glucuronate 4-epimerase 4 Arabidopsis thaliana
P39858 4.89e-20 92 21 7 349 3 capI Protein CapI Staphylococcus aureus
Q8VDR7 1.16e-19 92 30 11 274 2 Tgds dTDP-D-glucose 4,6-dehydratase Mus musculus
O95455 1.41e-19 91 29 10 274 1 TGDS dTDP-D-glucose 4,6-dehydratase Homo sapiens
A6QLW2 2.36e-19 90 29 10 274 2 TGDS dTDP-D-glucose 4,6-dehydratase Bos taurus
O81312 1.2e-18 89 24 10 349 2 GAE3 UDP-glucuronate 4-epimerase 3 Arabidopsis thaliana
A0R5C5 1.37e-18 88 29 9 317 1 MSMEG_6142 UDP-glucose 4-epimerase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q04871 3.73e-18 87 24 7 324 3 None Uncharacterized 37.6 kDa protein in cld 5'region Escherichia coli O111:H-
O06485 7.98e-18 86 23 11 336 3 yfnG Putative sugar dehydratase/epimerase YfnG Bacillus subtilis (strain 168)
Q9LPC1 1.15e-17 86 24 10 342 2 GAE2 UDP-glucuronate 4-epimerase 2 Arabidopsis thaliana
Q9LIS3 2.04e-17 86 25 9 328 1 GAE6 UDP-glucuronate 4-epimerase 6 Arabidopsis thaliana
O54067 5.07e-17 84 21 8 351 3 lspL Probable UDP-glucuronate 4-epimerase Rhizobium meliloti (strain 1021)
Q5UR12 7.31e-17 83 25 11 298 1 MIMI_R141 Putative dTDP-D-glucose 4,6-dehydratase Acanthamoeba polyphaga mimivirus
Q9STI6 1.83e-16 83 24 11 342 2 GAE5 UDP-glucuronate 4-epimerase 5 Arabidopsis thaliana
Q54WS6 2.08e-16 83 25 11 276 3 tgds dTDP-D-glucose 4,6-dehydratase Dictyostelium discoideum
Q9LPG6 2.08e-16 83 25 13 347 1 RHM2 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM2 Arabidopsis thaliana
D4GU72 2.25e-16 82 27 13 324 3 agl12 Low-salt glycan biosynthesis protein Agl12 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9ZAE8 1.05e-15 80 28 12 289 3 acbB dTDP-glucose 4,6-dehydratase Actinoplanes sp. (strain ATCC 31044 / CBS 674.73 / SE50/110)
Q9M0B6 1.12e-15 80 23 11 346 1 GAE1 UDP-glucuronate 4-epimerase 1 Arabidopsis thaliana
B0RVL0 2.04e-15 79 25 14 351 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain B100)
P37759 4.23e-15 79 26 16 356 3 rfbB dTDP-glucose 4,6-dehydratase 1 Escherichia coli (strain K12)
O34886 4.79e-15 78 23 13 328 3 ytcB Uncharacterized UDP-glucose epimerase YtcB Bacillus subtilis (strain 168)
B9J8R3 6.59e-15 77 22 9 331 1 lpsL UDP-glucuronate 4-epimerase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
P0C7J0 7.92e-15 77 25 14 351 3 rfbB dTDP-glucose 4,6-dehydratase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P14169 2.15e-14 76 26 9 282 1 rfbE CDP-paratose 2-epimerase Salmonella typhi
P37777 2.61e-14 76 24 14 363 3 rfbB dTDP-glucose 4,6-dehydratase Shigella flexneri
P9WN67 2.89e-14 75 27 10 316 1 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN66 2.89e-14 75 27 10 316 3 galE1 UDP-glucose 4-epimerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
C0QZ84 3.69e-14 75 27 15 289 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q8VZC0 9.87e-14 75 23 11 318 1 UXS1 UDP-glucuronic acid decarboxylase 1 Arabidopsis thaliana
Q2SYH7 1.24e-13 74 23 9 367 1 wbiB dTDP-L-rhamnose 4-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9LH76 1.88e-13 74 25 14 348 2 RHM3 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM3 Arabidopsis thaliana
Q9JQX8 6.87e-13 72 27 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P55293 9.61e-13 71 24 14 363 3 rfbB dTDP-glucose 4,6-dehydratase Escherichia coli
Q6E7F2 1.02e-12 71 27 12 287 1 fcf1 dTDP-4-dehydro-6-deoxyglucose reductase Escherichia coli
P29782 1.3e-12 71 28 13 286 1 strE dTDP-glucose 4,6-dehydratase Streptomyces griseus
Q47GJ3 1.43e-12 70 26 11 289 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Dechloromonas aromatica (strain RCB)
A1KT78 1.55e-12 70 27 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9SYM5 1.59e-12 72 24 13 342 1 RHM1 Trifunctional UDP-glucose 4,6-dehydratase/UDP-4-keto-6-deoxy-D-glucose 3,5-epimerase/UDP-4-keto-L-rhamnose-reductase RHM1 Arabidopsis thaliana
P39630 2.06e-12 70 24 12 334 1 rfbB dTDP-glucose 4,6-dehydratase Bacillus subtilis (strain 168)
Q9K002 2.11e-12 70 27 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P27830 2.47e-12 70 24 13 311 1 rffG dTDP-glucose 4,6-dehydratase 2 Escherichia coli (strain K12)
A9M3Q7 2.57e-12 70 27 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria meningitidis serogroup C (strain 053442)
Q6T1X6 3.38e-12 69 23 11 318 1 rmd GDP-6-deoxy-D-mannose reductase Aneurinibacillus thermoaerophilus
Q9S642 3.39e-12 70 26 15 357 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q331Q7 8.34e-12 68 26 11 298 1 gerKI dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces sp.
Q51061 1.8e-11 67 27 15 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae
P37761 2.32e-11 67 26 17 357 3 rfbB dTDP-glucose 4,6-dehydratase Neisseria gonorrhoeae
Q5SFA6 2.85e-11 67 26 12 301 1 chmD dTDP-4-dehydro-6-deoxy-D-allose reductase Streptomyces bikiniensis
Q9LZI2 4.78e-11 67 23 12 318 1 UXS2 UDP-glucuronic acid decarboxylase 2 Arabidopsis thaliana
P26391 6.99e-11 66 24 17 362 1 rfbB dTDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55462 7.92e-11 65 24 10 356 3 NGR_a03580 Probable dTDP-glucose 4,6-dehydratase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9ZV36 1.02e-10 65 24 14 319 2 UXS6 UDP-glucuronic acid decarboxylase 6 Arabidopsis thaliana
Q9RR28 1.13e-10 65 28 12 249 3 oleE dTDP-glucose 4,6-dehydratase Streptomyces antibioticus
Q0BH85 1.38e-10 65 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q9FIE8 1.53e-10 65 24 13 319 1 UXS3 UDP-glucuronic acid decarboxylase 3 Arabidopsis thaliana
B1YV41 1.57e-10 65 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia ambifaria (strain MC40-6)
Q8S8T4 2.19e-10 65 22 12 318 2 UXS4 UDP-glucuronic acid decarboxylase 4 Arabidopsis thaliana
Q3SK74 2.93e-10 64 27 16 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Thiobacillus denitrificans (strain ATCC 25259)
B2U894 2.96e-10 64 26 12 288 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Ralstonia pickettii (strain 12J)
A9ADU8 3.42e-10 63 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia multivorans (strain ATCC 17616 / 249)
Q5F9J0 3.59e-10 63 26 14 284 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9SN95 3.82e-10 63 24 13 319 2 UXS5 UDP-glucuronic acid decarboxylase 5 Arabidopsis thaliana
Q7NTL6 4.79e-10 63 28 13 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2SY18 5.17e-10 63 27 12 267 1 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P45048 5.67e-10 63 26 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1LQG2 5.86e-10 63 27 14 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A5UIN9 6.16e-10 63 26 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain PittGG)
Q4QLI0 6.57e-10 62 26 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus influenzae (strain 86-028NP)
A4JCI2 9.06e-10 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia vietnamiensis (strain G4 / LMG 22486)
P55294 9.45e-10 62 25 13 310 3 rfbB1 dTDP-glucose 4,6-dehydratase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q6DF08 9.65e-10 63 23 12 284 2 uxs1 UDP-glucuronic acid decarboxylase 1 Xenopus tropicalis
Q1BY20 1.07e-09 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain AU 1054)
B1JXS7 1.07e-09 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia orbicola (strain MC0-3)
A0K5M9 1.07e-09 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain HI2424)
Q5PQX0 1.31e-09 62 21 12 323 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Rattus norvegicus
Q91XL3 1.63e-09 62 21 12 323 1 Uxs1 UDP-glucuronic acid decarboxylase 1 Mus musculus
Q39IF3 1.63e-09 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8X7P7 1.67e-09 62 24 10 284 1 gnu N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase Escherichia coli O157:H7
Q5R885 1.72e-09 62 21 12 323 2 UXS1 UDP-glucuronic acid decarboxylase 1 Pongo abelii
Q8NBZ7 1.72e-09 62 21 12 323 1 UXS1 UDP-glucuronic acid decarboxylase 1 Homo sapiens
B4EB34 1.72e-09 62 26 12 267 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q6E7F4 1.89e-09 62 25 13 359 1 rmlB dTDP-glucose 4,6-dehydratase Escherichia coli
Q0A4T8 4.13e-09 60 25 14 338 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q6GMI9 4.58e-09 60 21 11 323 1 uxs1 UDP-glucuronic acid decarboxylase 1 Danio rerio
B2JF12 6.27e-09 60 25 11 266 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q31FG4 7.9e-09 59 26 17 342 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9CL97 1.02e-08 59 26 14 290 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pasteurella multocida (strain Pm70)
A0QSK6 1.03e-08 59 29 14 244 1 rmlB dTDP-glucose 4,6-dehydratase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A6VLD2 1.23e-08 58 25 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P9WN65 1.31e-08 59 28 13 246 1 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN64 1.31e-08 59 28 13 246 3 rmlB dTDP-glucose 4,6-dehydratase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9L9E8 1.32e-08 59 26 12 304 3 novT dTDP-glucose 4,6-dehydratase Streptomyces niveus
Q9HTB6 1.35e-08 58 24 11 275 1 rmd GDP-6-deoxy-D-mannose reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0DMK5 1.71e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain K96243)
A3NC24 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 668)
Q3JPY8 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1710b)
A3NXW3 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1106a)
A1V6L4 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain SAVP1)
Q62M34 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain ATCC 23344)
A2S4R1 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10229)
A3MHP7 1.73e-08 58 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia mallei (strain NCTC 10247)
Q9HDU4 2.04e-08 58 23 13 352 3 SPBPB2B2.11 Uncharacterized protein PB2B2.11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P55579 2.53e-08 58 24 12 283 3 NGR_a02350 Uncharacterized protein y4nG Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A6V291 3.3e-08 57 26 12 276 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain PA7)
B3R3C0 3.63e-08 57 25 12 288 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A7MSM1 4.01e-08 57 27 14 301 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio campbellii (strain ATCC BAA-1116)
Q9HYQ8 4.18e-08 57 25 11 274 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
I1WGR6 4.58e-08 57 25 13 285 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Burkholderia pseudomallei (strain 1026b)
Q02QH1 6.65e-08 57 25 11 274 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pseudomonas aeruginosa (strain UCBPP-PA14)
P95780 7.87e-08 57 23 13 347 1 rmlB dTDP-glucose 4,6-dehydratase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A0A1B4XBH2 8.16e-08 57 26 10 286 3 sdnI GDP-mannose 4,6-dehydratase sdnI Sordaria araneosa
Q9R1J0 8.62e-08 57 26 10 259 1 Nsdhl Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Mus musculus
Q87T56 8.95e-08 56 28 15 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P26397 1.29e-07 56 29 5 163 1 rfbG CDP-glucose 4,6-dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44914 1.42e-07 56 24 16 315 3 rffG dTDP-glucose 4,6-dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9SGE0 1.76e-07 55 23 16 317 2 AXS2 UDP-D-apiose/UDP-D-xylose synthase 2 Arabidopsis thaliana
Q8DE09 1.82e-07 55 27 14 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain CMCP6)
Q7MPN6 2.01e-07 55 27 14 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio vulnificus (strain YJ016)
Q0KDH0 2.02e-07 55 25 12 288 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B8F727 2.88e-07 55 26 16 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Glaesserella parasuis serovar 5 (strain SH0165)
B2T625 4.16e-07 54 26 13 268 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13VD0 4.23e-07 54 26 13 268 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Paraburkholderia xenovorans (strain LB400)
B5FFS9 6.22e-07 53 26 14 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain MJ11)
C3LQK1 6.42e-07 53 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain M66-2)
Q06963 6.42e-07 53 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3Z4 6.42e-07 53 27 16 299 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9ZUY6 7.54e-07 53 22 16 316 1 AXS1 UDP-D-apiose/UDP-D-xylose synthase 1 Arabidopsis thaliana
Q58461 8.75e-07 53 29 7 188 3 MJ1061 Uncharacterized membrane protein MJ1061 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5E8J9 9.44e-07 53 26 14 303 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Aliivibrio fischeri (strain ATCC 700601 / ES114)
P35675 9.96e-07 51 33 3 114 3 None Uncharacterized protein in galE 3'region (Fragment) Erwinia amylovora
A1TYR6 1.1e-06 53 26 13 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
L7WRR9 1.15e-06 53 26 4 145 1 notP' Short chain dehydrogenases/reductase notP' Aspergillus versicolor
C0Q1V2 1.3e-06 52 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi C (strain RKS4594)
Q57IC3 1.3e-06 52 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella choleraesuis (strain SC-B67)
Q12CM2 1.4e-06 53 27 16 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B0BSD7 1.73e-06 52 26 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N308 1.73e-06 52 26 15 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A9MKQ6 1.82e-06 52 26 15 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5PPL3 2.04e-06 52 23 10 264 2 Nsdhl Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Rattus norvegicus
Q3ZBE9 2.14e-06 52 25 11 261 2 NSDHL Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating Bos taurus
B3GYT6 2.19e-06 52 25 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B2VL47 2.29e-06 52 25 10 279 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1SRT6 2.63e-06 52 26 16 306 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7VKK8 2.88e-06 52 25 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C5BB97 3.16e-06 51 26 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Edwardsiella ictaluri (strain 93-146)
Q3J7X9 3.35e-06 51 24 10 277 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6TFL4 4.76e-06 51 24 12 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q329N6 5.22e-06 51 24 11 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella dysenteriae serotype 1 (strain Sd197)
A1VGB0 5.24e-06 51 24 16 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain DP4)
B5XTI2 5.41e-06 51 25 13 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae (strain 342)
Q72ET7 5.99e-06 50 25 16 291 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q9XCA1 6.37e-06 50 24 12 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Klebsiella pneumoniae
O49213 6.86e-06 50 20 9 291 1 GER1 GDP-L-fucose synthase 1 Arabidopsis thaliana
B1JQW4 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66GC7 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSC8 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis (strain Pestoides F)
Q1CD11 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R683 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJN4 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis
B2JYP2 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C276 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCU3 6.97e-06 50 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GLC8 7e-06 50 25 13 292 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Serratia proteamaculans (strain 568)
A8ARK8 7.29e-06 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P73212 7.79e-06 50 24 9 248 3 dfrA Putative dihydroflavonol 4-reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9IJJ7 8.26e-06 50 25 14 294 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0UWU3 8.39e-06 50 24 14 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 2336)
Q0I569 8.39e-06 50 24 14 298 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Histophilus somni (strain 129Pt)
A4W527 8.78e-06 50 25 13 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Enterobacter sp. (strain 638)
B5RGG8 8.98e-06 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5E3 8.98e-06 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella enteritidis PT4 (strain P125109)
B5FLI8 8.98e-06 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella dublin (strain CT_02021853)
C6DIA9 9.48e-06 50 26 16 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7MY46 9.55e-06 50 26 15 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4SXC1 1.16e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella newport (strain SL254)
B1LK58 1.19e-05 50 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain SMS-3-5 / SECEC)
P67912 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67913 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella typhi
B4TZW1 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella schwarzengrund (strain CVM19633)
B5BHZ3 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain AKU_12601)
A9MVL2 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PC05 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9A3 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella heidelberg (strain SL476)
B5EXC5 1.22e-05 50 25 15 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Salmonella agona (strain SL483)
Q8K0C9 1.26e-05 50 22 14 346 1 Gmds GDP-mannose 4,6 dehydratase Mus musculus
B1IZH2 1.3e-05 50 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A683 1.3e-05 50 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O9:H4 (strain HS)
A1JHX6 1.35e-05 49 25 14 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MQ91 1.44e-05 49 24 14 295 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Cronobacter sakazakii (strain ATCC BAA-894)
B4F132 1.49e-05 49 25 13 279 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Proteus mirabilis (strain HI4320)
Q3YVY3 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella sonnei (strain Ss046)
Q83PP2 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri
Q0SYE8 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella flexneri serotype 5b (strain 8401)
Q31V04 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 4 (strain Sb227)
B2U5D7 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R4X2 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli (strain UTI89 / UPEC)
B7NES6 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FCA0 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBI8 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHF5 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O1:K1 / APEC
B7N1S3 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O81 (strain ED1a)
B7NPC7 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MFI2 1.66e-05 49 24 14 297 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8K3X3 2.19e-05 49 22 14 346 2 GMDS GDP-mannose 4,6 dehydratase Cricetulus griseus
O43050 2.31e-05 49 21 12 298 3 erg26 Sterol-4-alpha-carboxylate 3-dehydrogenase erg26, decarboxylating Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LMU0 2.82e-05 48 18 9 342 1 GER2 Putative GDP-L-fucose synthase 2 Arabidopsis thaliana
A0A0U3AP28 3.12e-05 48 24 17 331 1 HS5.17 CDP-6-D-glucitol synthase Campylobacter jejuni
A6NKP2 3.21e-05 48 25 12 295 3 SDR42E2 Putative short-chain dehydrogenase/reductase family 42E member 2 Homo sapiens
Q6DAT7 3.91e-05 48 25 15 286 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C4K8I6 0.000107 47 24 14 274 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P0AC91 0.000162 46 23 12 350 3 gmd GDP-mannose 4,6-dehydratase Shigella flexneri
P0AC88 0.000162 46 23 12 350 1 gmd GDP-mannose 4,6-dehydratase Escherichia coli (strain K12)
P0AC89 0.000162 46 23 12 350 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AC90 0.000162 46 23 12 350 3 gmd GDP-mannose 4,6-dehydratase Escherichia coli O157:H7
A8FRR2 0.000165 47 25 8 192 3 arnA Bifunctional polymyxin resistance protein ArnA Shewanella sediminis (strain HAW-EB3)
Q56598 0.0002 46 21 12 349 3 gmd GDP-mannose 4,6-dehydratase Vibrio cholerae
O85713 0.000202 46 22 14 356 3 gmd GDP-mannose 4,6-dehydratase Rhizobium fredii (strain HH103)
O48917 0.00021 46 28 2 132 1 SQD1 UDP-sulfoquinovose synthase, chloroplastic Arabidopsis thaliana
Q0P9D4 0.00021 46 25 5 198 1 pglF UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q6GZS4 0.000225 46 25 6 187 3 FV3-052L Uncharacterized protein 052L Frog virus 3 (isolate Goorha)
Q9D665 0.000277 46 23 10 308 1 Sdr42e1 Short-chain dehydrogenase/reductase family 42E member 1 Mus musculus
Q3A8K5 0.000332 45 25 14 282 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2NQV7 0.000384 45 23 16 350 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Sodalis glossinidius (strain morsitans)
Q8WUS8 0.000401 45 22 10 308 1 SDR42E1 Short-chain dehydrogenase/reductase family 42E member 1 Homo sapiens
Q56872 0.00043 45 22 12 349 3 gmd GDP-mannose 4,6-dehydratase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q98I52 0.000485 45 23 10 307 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q67ZE1 0.000504 45 26 11 260 1 3BETAHSD/D2 3beta-hydroxysteroid-dehydrogenase/decarboxylase isoform 2 Arabidopsis thaliana
Q61694 0.000515 45 29 6 164 1 Hsd3b5 NADPH-dependent 3-keto-steroid reductase Hsd3b5 Mus musculus
Q5QKR8 0.000532 45 25 6 187 3 pseB UDP-N-acetylglucosamine 4,6-dehydratase (inverting) Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P27364 0.000538 45 31 8 166 1 Hsd3b5 NADPH-dependent 3-keto-steroid reductase Hsd3b5 Rattus norvegicus
Q61767 0.000543 45 28 6 164 1 Hsd3b4 NADPH-dependent 3-keto-steroid reductase Hsd3b4 Mus musculus
A1KBH4 0.000549 45 26 13 283 3 hldD ADP-L-glycero-D-manno-heptose-6-epimerase Azoarcus sp. (strain BH72)
A8GRN9 0.000714 44 28 6 161 3 capD UDP-glucose 4-epimerase Rickettsia rickettsii (strain Sheila Smith)
Q0P8I7 0.001 44 23 11 272 1 Cj1427c GDP-D-glycero-alpha-D-manno-heptose dehydrogenase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09615
Feature type CDS
Gene galE
Product UDP-glucose 4-epimerase GalE
Location 2100501 - 2101517 (strand: -1)
Length 1017 (nucleotides) / 338 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1658
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF16363 GDP-mannose 4,6 dehydratase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1087 Cell wall/membrane/envelope biogenesis (M) M UDP-glucose 4-epimerase

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG013287 UDP-glucose 4-epimerase VF0044 Immune modulation

Protein Sequence

MEILVTGGMGYIGSHTCVQMLEAGMTPIILDNLSNANEEVLNRIEALTGKRPLFYQGDIRDEKRLATIFTQHSIQSVIHFAGLKAVGESVEKPIEYYDNNVNGTLVLVRCMRDAGVKSIIFSSSATVYGDPQTVPITEESPVGGTTNPYGTSKYMVERILSDLYIADESWSISLLRYFNPVGAHPSGTMGEDPKGIPNNLTPYISQVAIGRREKVAVFGDDYPTKDGTGVRDYIHVMDLADGHIAALNALGEKAGLHIYNLGTGNGTSVIEMIEAFRKASGKAIPYEIQPRRPGDIAQCWSSPAKAEKDLHWKAIRSIDDMAADAWRWQSQNPNGYLK

Flanking regions ( +/- flanking 50bp)

AACAAAACCGCTTGACGCTTTTCATTTGAAATAAATCAAAAGAGGTGAATGTGGAAATTTTAGTTACGGGTGGAATGGGATATATCGGTAGTCATACATGCGTGCAAATGTTAGAAGCAGGCATGACGCCTATTATTTTGGATAACCTCAGTAATGCAAATGAAGAGGTACTTAACCGAATTGAAGCATTAACAGGAAAACGCCCACTGTTTTATCAGGGGGATATTCGTGACGAAAAACGACTGGCCACAATTTTTACTCAGCACTCTATTCAATCAGTGATCCATTTCGCTGGATTAAAAGCGGTAGGTGAATCTGTTGAAAAGCCCATCGAATACTATGACAACAATGTTAACGGTACTTTGGTATTAGTTCGTTGTATGCGTGATGCGGGCGTAAAAAGTATTATTTTCAGCTCATCAGCCACGGTTTATGGTGATCCTCAAACTGTGCCTATTACTGAAGAGTCACCTGTTGGTGGCACTACCAATCCTTATGGCACCAGTAAATATATGGTCGAGCGTATTTTGTCTGATCTCTATATTGCAGATGAGAGTTGGTCTATCAGTTTACTGCGCTACTTCAATCCAGTAGGTGCTCATCCATCTGGCACTATGGGGGAAGATCCTAAGGGTATTCCTAATAATTTAACGCCTTATATCTCGCAAGTTGCGATAGGTCGTCGTGAAAAAGTCGCGGTATTTGGTGATGATTACCCAACAAAAGACGGTACTGGTGTACGTGACTATATCCATGTTATGGATTTAGCTGATGGTCATATTGCCGCCTTAAATGCGTTAGGAGAAAAAGCAGGGTTACATATCTATAACCTAGGCACAGGGAATGGCACCAGTGTGATTGAAATGATTGAAGCATTTCGTAAAGCCAGTGGTAAAGCAATCCCTTATGAAATTCAGCCACGTCGCCCGGGAGATATCGCACAATGTTGGTCAAGTCCTGCCAAAGCAGAAAAAGACTTACACTGGAAAGCCATTCGCTCTATTGATGATATGGCAGCCGATGCTTGGCGTTGGCAATCACAAAATCCTAACGGTTATCTGAAATAGATCATAAAAACGCTATCAGATAATCTTTAATAAATAAGAGAGAAGATTAT