Homologs in group_604

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01890 FBDBKF_01890 100.0 Morganella morganii S1 ychF redox-regulated ATPase YchF
NLDBIP_01100 NLDBIP_01100 100.0 Morganella morganii S4 ychF redox-regulated ATPase YchF
LHKJJB_00935 LHKJJB_00935 100.0 Morganella morganii S3 ychF redox-regulated ATPase YchF
HKOGLL_00975 HKOGLL_00975 100.0 Morganella morganii S5 ychF redox-regulated ATPase YchF
F4V73_RS04235 F4V73_RS04235 95.9 Morganella psychrotolerans ychF redox-regulated ATPase YchF
PMI_RS05230 PMI_RS05230 88.2 Proteus mirabilis HI4320 ychF redox-regulated ATPase YchF

Distribution of the homologs in the orthogroup group_604

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_604

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABU4 0.0 677 90 0 363 3 ychF Ribosome-binding ATPase YchF Shigella flexneri
P0ABU2 0.0 677 90 0 363 1 ychF Ribosome-binding ATPase YchF Escherichia coli (strain K12)
P0ABU3 0.0 677 90 0 363 3 ychF Ribosome-binding ATPase YchF Escherichia coli O157:H7
Q9CP90 0.0 629 82 0 363 3 ychF Ribosome-binding ATPase YchF Pasteurella multocida (strain Pm70)
P44681 0.0 624 82 0 363 1 ychF Ribosome-binding ATPase YchF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VMI2 0.0 610 79 0 363 3 ychF Ribosome-binding ATPase YchF Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8K9V2 4.15e-154 440 56 1 363 3 ychF Ribosome-binding ATPase YchF Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57288 7.19e-153 437 57 1 363 3 ychF Ribosome-binding ATPase YchF Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P37518 7.28e-148 425 55 1 366 2 ychF Ribosome-binding ATPase YchF Bacillus subtilis (strain 168)
P47270 1.3e-117 348 49 5 364 3 ychF Ribosome-binding ATPase YchF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q89AR6 2.87e-117 347 47 4 368 3 ychF Ribosome-binding ATPase YchF Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7ZWM6 1.03e-104 316 44 5 369 2 ola1 Obg-like ATPase 1 Xenopus laevis
Q66JG0 1.25e-104 316 43 5 369 2 ola1 Obg-like ATPase 1 Xenopus tropicalis
Q5ZM25 1.7e-104 315 44 6 369 2 OLA1 Obg-like ATPase 1 Gallus gallus
Q5R821 8.2e-104 314 44 6 369 2 OLA1 Obg-like ATPase 1 Pongo abelii
Q2HJ33 4.23e-103 312 44 6 369 2 OLA1 Obg-like ATPase 1 Bos taurus
Q9NTK5 5.6e-103 311 44 6 369 1 OLA1 Obg-like ATPase 1 Homo sapiens
P75088 1.76e-102 309 45 4 350 3 ychF Ribosome-binding ATPase YchF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9CZ30 2.35e-102 310 43 6 369 1 Ola1 Obg-like ATPase 1 Mus musculus
Q7ZU42 2.53e-102 310 43 5 369 2 ola1 Obg-like ATPase 1 Danio rerio
A0JPJ7 2.55e-101 307 43 6 369 2 Ola1 Obg-like ATPase 1 Rattus norvegicus
Q8SWU7 3.68e-100 305 42 5 366 1 CG1354 Obg-like ATPase 1 Drosophila melanogaster
Q9SA73 3.56e-99 302 43 4 365 1 YchF1 Obg-like ATPase 1 Arabidopsis thaliana
P91917 3.1e-97 297 41 4 365 1 ola-1 Obg-like ATPase 1 Caenorhabditis elegans
Q6Z1J6 1.79e-93 287 41 4 365 1 YCHF1 Obg-like ATPase 1 Oryza sativa subsp. japonica
B8BBN7 9.88e-93 285 41 4 365 3 OsI_28170 Obg-like ATPase 1 Oryza sativa subsp. indica
P38219 2.84e-85 266 40 6 368 1 OLA1 Obg-like ATPase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O13998 1.53e-82 259 39 7 368 1 SPAC27E2.03c Obg-like ATPase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14078 4.12e-75 241 38 6 363 3 SPAC2E11.13c Obg-like ATPase homolog Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38746 2.13e-59 200 34 9 381 1 YLF2 Obg-like ATPase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C1F9K2 3.56e-18 87 40 3 130 3 obg GTPase Obg Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B9DNE7 4.38e-18 88 40 3 128 3 obg GTPase Obg Staphylococcus carnosus (strain TM300)
Q58728 6.2e-18 87 35 4 157 3 MJ1332 Uncharacterized GTP-binding protein MJ1332 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1IVS5 6.25e-18 87 38 3 131 3 obg GTPase Obg Koribacter versatilis (strain Ellin345)
B1YJR9 6.35e-18 88 34 4 169 3 obg GTPase Obg Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B2A6B7 2.48e-17 86 38 3 129 3 obg GTPase Obg Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q18B27 2.81e-17 85 36 3 138 3 obg GTPase Obg Clostridioides difficile (strain 630)
B9L101 3.82e-17 85 39 3 129 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B0S3Z4 4.82e-17 85 33 3 153 3 obg GTPase Obg Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8RBA5 4.9e-17 85 38 3 132 3 obg GTPase Obg Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8EPQ0 7.2e-17 84 37 3 138 3 obg GTPase Obg Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6GG60 8.68e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain MRSA252)
Q7A0Q3 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 9.1e-17 84 38 3 129 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 9.1e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q74JN7 9.18e-17 84 39 5 146 3 obg GTPase Obg Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B7GIR2 9.27e-17 84 37 3 138 3 obg GTPase Obg Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5HFB9 9.36e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q2YT86 9.62e-17 84 38 3 129 3 obg GTPase Obg Staphylococcus aureus (strain bovine RF122 / ET3-1)
A0Q1T4 1.08e-16 84 38 3 138 3 obg GTPase Obg Clostridium novyi (strain NT)
B0K414 1.18e-16 84 37 3 130 3 obg GTPase Obg Thermoanaerobacter sp. (strain X514)
B0KAB8 1.18e-16 84 37 3 130 3 obg GTPase Obg Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q043W1 1.37e-16 84 41 4 129 3 obg GTPase Obg Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5WHS8 1.42e-16 84 37 3 138 3 obg GTPase Obg Shouchella clausii (strain KSM-K16)
A9KMF5 1.44e-16 84 41 3 129 3 obg GTPase Obg Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A3DBS5 1.64e-16 84 39 4 138 3 obg GTPase Obg Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q10XA1 1.65e-16 83 40 3 129 3 obg GTPase Obg Trichodesmium erythraeum (strain IMS101)
A2C050 1.73e-16 82 38 3 130 3 obg GTPase Obg Prochlorococcus marinus (strain NATL1A)
Q65GM7 1.88e-16 83 36 3 138 3 obg GTPase Obg Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q46HF4 2.18e-16 82 38 3 130 3 obg GTPase Obg Prochlorococcus marinus (strain NATL2A)
A7Z781 2.2e-16 83 36 3 138 3 obg GTPase Obg Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8CXZ0 2.33e-16 83 36 3 128 3 obg GTPase Obg Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9KDK0 2.77e-16 83 37 3 138 3 obg GTPase Obg Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B9MRB8 3.21e-16 82 39 3 128 3 obg GTPase Obg Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B8I179 3.27e-16 82 39 3 128 3 obg GTPase Obg Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A4XJS8 3.4e-16 82 39 3 128 3 obg GTPase Obg Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A1SMB4 3.68e-16 83 39 3 128 3 obg GTPase Obg Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q8CNZ7 4.03e-16 82 38 3 128 3 obg GTPase Obg Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNQ7 4.03e-16 82 38 3 128 3 obg GTPase Obg Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1GAM3 4.79e-16 82 40 4 129 3 obg GTPase Obg Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q04B11 4.84e-16 82 40 4 129 3 obg GTPase Obg Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
B7HE73 5.23e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain B4264)
Q6HD85 5.53e-16 82 38 3 138 3 obg GTPase Obg Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634A3 5.53e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain ZK / E33L)
Q817U6 5.53e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
C1ETN7 5.53e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain 03BB102)
A0RJ47 5.53e-16 82 38 3 138 3 obg GTPase Obg Bacillus thuringiensis (strain Al Hakam)
B7HQJ8 5.64e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain AH187)
B7JQ26 5.69e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain AH820)
Q81LF0 5.69e-16 82 38 3 138 3 obg GTPase Obg Bacillus anthracis
B9IZ16 5.9e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain Q1)
A8YV14 6e-16 82 37 4 138 3 obg GTPase Obg Lactobacillus helveticus (strain DPC 4571)
Q72ZY5 6.72e-16 82 38 3 138 3 obg GTPase Obg Bacillus cereus (strain ATCC 10987 / NRS 248)
B0TBW1 6.8e-16 82 39 3 130 3 obg GTPase Obg Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q022G3 6.86e-16 81 38 3 129 3 obg GTPase Obg Solibacter usitatus (strain Ellin6076)
P20964 6.91e-16 82 36 3 138 1 obg GTPase Obg Bacillus subtilis (strain 168)
A8FFS8 7.51e-16 81 36 3 138 3 obg GTPase Obg Bacillus pumilus (strain SAFR-032)
Q1MQQ1 8.3e-16 81 38 4 142 3 obg GTPase Obg Lawsonia intracellularis (strain PHE/MN1-00)
A8MHK8 9.92e-16 81 34 3 138 3 obg GTPase Obg Alkaliphilus oremlandii (strain OhILAs)
Q5FKH5 1.03e-15 81 37 4 138 3 obg GTPase Obg Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A9VIR5 1.07e-15 81 37 3 138 3 obg GTPase Obg Bacillus mycoides (strain KBAB4)
B0RDG3 1.08e-15 81 31 4 190 3 obg GTPase Obg Clavibacter sepedonicus
C0QUB5 1.08e-15 80 37 3 128 3 obg GTPase Obg Persephonella marina (strain DSM 14350 / EX-H1)
Q03QP2 1.09e-15 81 35 3 138 3 obg GTPase Obg Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6MGS5 1.12e-15 80 39 3 132 3 obg GTPase Obg Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B7IIV2 1.18e-15 81 37 3 138 3 obg GTPase Obg Bacillus cereus (strain G9842)
A0AIY6 1.43e-15 80 38 3 138 3 obg GTPase Obg Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92BH7 1.44e-15 80 38 3 138 3 obg GTPase Obg Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A4IRC7 1.45e-15 80 36 3 138 3 obg GTPase Obg Geobacillus thermodenitrificans (strain NG80-2)
Q2JJ90 1.48e-15 80 36 2 129 3 obg GTPase Obg Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8Y6Z3 1.55e-15 80 38 3 138 3 obg GTPase Obg Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZD3 1.55e-15 80 38 3 138 3 obg GTPase Obg Listeria monocytogenes serotype 4b (strain F2365)
B8DHL1 1.57e-15 80 38 3 138 3 obg GTPase Obg Listeria monocytogenes serotype 4a (strain HCC23)
Q49Y82 1.67e-15 80 34 4 148 3 obg GTPase Obg Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q38WT4 1.73e-15 80 36 3 138 3 obg GTPase Obg Latilactobacillus sakei subsp. sakei (strain 23K)
B1HVB2 1.74e-15 80 36 3 138 3 obg GTPase Obg Lysinibacillus sphaericus (strain C3-41)
Q834V4 1.75e-15 80 37 3 138 3 obg GTPase Obg Enterococcus faecalis (strain ATCC 700802 / V583)
A9BK05 1.77e-15 80 37 4 132 3 obg GTPase Obg Petrotoga mobilis (strain DSM 10674 / SJ95)
A2BUJ6 1.77e-15 79 37 3 129 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9515)
A5UZ80 1.78e-15 80 32 4 170 3 obg GTPase Obg Roseiflexus sp. (strain RS-1)
Q6AK07 1.8e-15 80 34 2 138 3 obg GTPase Obg Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A5CR32 1.94e-15 80 31 4 190 3 obg GTPase Obg Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q0SR54 1.95e-15 80 39 4 137 3 obg GTPase Obg Clostridium perfringens (strain SM101 / Type A)
Q8XIJ2 1.95e-15 80 39 4 137 3 obg GTPase Obg Clostridium perfringens (strain 13 / Type A)
Q0TNI5 1.95e-15 80 39 4 137 3 obg GTPase Obg Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q7VDW9 2.08e-15 79 36 2 129 3 obg GTPase Obg Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A6TQJ6 2.13e-15 80 36 4 130 3 obg GTPase Obg Alkaliphilus metalliredigens (strain QYMF)
B1I5V8 2.3e-15 80 37 3 134 3 obg GTPase Obg Desulforudis audaxviator (strain MP104C)
Q4L6Y9 2.85e-15 80 37 3 128 3 obg GTPase Obg Staphylococcus haemolyticus (strain JCSC1435)
Q5KWP5 2.87e-15 80 36 3 138 3 obg GTPase Obg Geobacillus kaustophilus (strain HTA426)
B9E021 2.96e-15 80 36 3 138 3 obg GTPase Obg Clostridium kluyveri (strain NBRC 12016)
A6LQR9 3.36e-15 79 38 4 138 3 obg GTPase Obg Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A9AXD9 3.39e-15 80 36 3 138 3 obg GTPase Obg Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
O67849 3.42e-15 79 36 2 130 3 obg GTPase Obg Aquifex aeolicus (strain VF5)
Q2JS78 3.42e-15 79 28 5 236 3 obg GTPase Obg Synechococcus sp. (strain JA-3-3Ab)
B2TK70 3.53e-15 79 37 4 138 3 obg GTPase Obg Clostridium botulinum (strain Eklund 17B / Type B)
Q04EZ8 4.07e-15 79 30 3 181 3 obg GTPase Obg Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A5D410 4.1e-15 79 37 3 130 3 obg GTPase Obg Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P42942 4.61e-15 79 38 7 145 1 YGR210C Uncharacterized GTP-binding protein YGR210C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B2IYX1 5.23e-15 78 35 2 139 3 obg GTPase Obg Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7V368 5.33e-15 78 37 3 129 3 obg GTPase Obg Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
C0MBS1 5.53e-15 79 36 3 138 3 obg GTPase Obg Streptococcus equi subsp. equi (strain 4047)
C0MDB4 5.69e-15 79 36 3 138 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain H70)
C1A1L5 5.91e-15 79 34 4 151 3 obg GTPase Obg Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q31IT4 6.06e-15 78 37 4 129 3 obg GTPase Obg Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2V0A8 6.08e-15 79 37 4 138 3 obg GTPase Obg Clostridium botulinum (strain Alaska E43 / Type E3)
Q0SH51 6.29e-15 79 37 3 129 3 obg GTPase Obg Rhodococcus jostii (strain RHA1)
A4J7I9 7.41e-15 79 38 3 132 3 obg GTPase Obg Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q3AM97 8.16e-15 77 35 2 129 3 obg GTPase Obg Synechococcus sp. (strain CC9605)
O94362 8.26e-15 78 41 4 111 3 SPBC428.15 Uncharacterized GTP-binding protein C428.15 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6LJZ0 8.28e-15 78 37 4 140 3 obg GTPase Obg Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B7IGK8 8.44e-15 78 38 4 130 3 obg GTPase Obg Thermosipho africanus (strain TCF52B)
Q1WT46 8.53e-15 78 35 3 138 3 obg GTPase Obg Ligilactobacillus salivarius (strain UCC118)
B8HU67 8.7e-15 78 37 3 129 3 obg GTPase Obg Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q0BZ39 9.61e-15 78 34 3 140 3 obg GTPase Obg Hyphomonas neptunium (strain ATCC 15444)
A5EVP4 1.01e-14 77 33 3 137 3 obg GTPase Obg Dichelobacter nodosus (strain VCS1703A)
B0CDA2 1.05e-14 77 36 2 130 3 obg GTPase Obg Acaryochloris marina (strain MBIC 11017)
C0ZAL7 1.05e-14 78 35 3 138 3 obg GTPase Obg Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q31CW3 1.06e-14 77 37 3 129 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9312)
A9NBL5 1.11e-14 77 37 3 127 3 obg GTPase Obg Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J9K2 1.17e-14 77 37 3 127 3 obg GTPase Obg Coxiella burnetii (strain CbuK_Q154)
A7HJZ8 1.22e-14 78 34 4 138 3 obg GTPase Obg Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q5Z041 1.23e-14 78 35 3 129 3 obg GTPase Obg Nocardia farcinica (strain IFM 10152)
Q83ED8 1.24e-14 77 37 3 127 3 obg GTPase Obg Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KEJ7 1.24e-14 77 37 3 127 3 obg GTPase Obg Coxiella burnetii (strain Dugway 5J108-111)
B6J1S8 1.24e-14 77 37 3 127 3 obg GTPase Obg Coxiella burnetii (strain CbuG_Q212)
Q97JL4 1.31e-14 78 36 3 138 3 obg GTPase Obg Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A8G2M6 1.33e-14 77 37 3 129 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9215)
A1AW67 1.37e-14 77 33 4 157 3 obg GTPase Obg Ruthia magnifica subsp. Calyptogena magnifica
Q6A9H8 1.48e-14 78 37 3 127 3 obg GTPase Obg Cutibacterium acnes (strain DSM 16379 / KPA171202)
B3WE52 1.5e-14 77 36 4 138 3 obg GTPase Obg Lacticaseibacillus casei (strain BL23)
Q039J3 1.51e-14 77 36 4 138 3 obg GTPase Obg Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q6KHM2 1.58e-14 77 31 5 191 3 obg GTPase Obg Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
B8GA36 1.62e-14 77 33 5 167 3 obg GTPase Obg Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q3MCS7 1.85e-14 77 35 2 139 3 obg GTPase Obg Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B4U3Q7 1.97e-14 77 36 3 138 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q747Q2 2.02e-14 77 33 3 130 3 obg GTPase Obg Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B1LA53 2.18e-14 77 37 3 130 3 obg GTPase Obg Thermotoga sp. (strain RQ2)
Q9WXV3 2.2e-14 77 38 4 130 3 obg GTPase Obg Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8YQT0 2.25e-14 76 30 7 225 3 obg GTPase Obg Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A7NRU6 2.38e-14 77 31 4 170 3 obg GTPase Obg Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q48SX8 2.39e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M28 (strain MGAS6180)
B2GBD0 2.39e-14 77 36 2 138 3 obg GTPase Obg Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8P0I6 2.45e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DB53 2.5e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB52 2.5e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A5IKX2 2.51e-14 77 37 3 130 3 obg GTPase Obg Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q5XBM1 2.55e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8G4U0 2.56e-14 77 34 2 130 3 obg GTPase Obg Bifidobacterium longum (strain NCC 2705)
B7GNK1 2.61e-14 77 34 2 130 3 obg GTPase Obg Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B5XLZ0 2.64e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JLA1 2.67e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBB7 2.67e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JGD5 2.74e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7NZS1 2.84e-14 77 35 3 134 3 obg GTPase Obg Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B0JI21 2.98e-14 76 36 2 130 3 obg GTPase Obg Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q99Z94 3e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M1
Q1J652 3.12e-14 77 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M4 (strain MGAS10750)
B2G6R9 3.33e-14 77 36 3 138 3 obg GTPase Obg Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ99 3.33e-14 77 36 3 138 3 obg GTPase Obg Limosilactobacillus reuteri (strain DSM 20016)
A2RE30 3.64e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pyogenes serotype M5 (strain Manfredo)
B1XN32 3.65e-14 76 35 2 129 3 obg GTPase Obg Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q6AFY1 3.88e-14 77 29 8 236 3 obg GTPase Obg Leifsonia xyli subsp. xyli (strain CTCB07)
Q8DUU2 3.98e-14 76 36 3 138 3 obg GTPase Obg Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A5I666 4.1e-14 76 34 3 138 3 obg GTPase Obg Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXU6 4.1e-14 76 34 3 138 3 obg GTPase Obg Clostridium botulinum (strain ATCC 19397 / Type A)
A7GHK2 4.14e-14 76 34 3 138 3 obg GTPase Obg Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1KZR3 4.22e-14 76 36 4 128 3 obg GTPase Obg Clostridium botulinum (strain Loch Maree / Type A3)
A1KWG2 4.39e-14 76 37 4 134 3 obg GTPase Obg Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A7HIF8 4.41e-14 75 34 3 138 3 obg GTPase Obg Anaeromyxobacter sp. (strain Fw109-5)
A1VF56 4.54e-14 76 35 3 138 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain DP4)
Q72DK0 4.54e-14 76 35 3 138 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B4RQP4 4.56e-14 76 37 4 134 3 obg GTPase Obg Neisseria gonorrhoeae (strain NCCP11945)
Q5F5D9 4.56e-14 76 37 4 134 1 obg GTPase Obg Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B8ZPS8 4.58e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IBL9 4.58e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae (strain Hungary19A-6)
A1IPH6 4.6e-14 76 37 4 134 3 obg GTPase Obg Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8DPV8 4.61e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KK7 4.61e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1ILY5 4.67e-14 76 34 3 138 3 obg GTPase Obg Clostridium botulinum (strain Okra / Type B1)
B2IQ29 4.69e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae (strain CGSP14)
Q88VG4 4.74e-14 76 34 3 159 3 obg GTPase Obg Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q97QW8 4.79e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E4J4 4.79e-14 76 36 3 138 3 obg GTPase Obg Streptococcus pneumoniae serotype 19F (strain G54)
A2BP15 4.81e-14 75 35 2 128 3 obg GTPase Obg Prochlorococcus marinus (strain AS9601)
Q9JXE5 4.91e-14 76 37 4 134 3 obg GTPase Obg Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B7KIC1 5.02e-14 75 36 2 129 3 obg GTPase Obg Gloeothece citriformis (strain PCC 7424)
Q47AD0 5.03e-14 75 32 2 138 3 obg GTPase Obg Dechloromonas aromatica (strain RCB)
Q8PBH0 5.2e-14 75 34 2 147 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RY32 5.2e-14 75 34 2 147 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain B100)
Q4US36 5.2e-14 75 34 2 147 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain 8004)
Q3ZW89 5.26e-14 76 31 2 138 3 obg GTPase Obg Dehalococcoides mccartyi (strain CBDB1)
A5FP49 5.26e-14 76 31 2 138 3 obg GTPase Obg Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q15PF0 5.29e-14 76 35 3 127 3 obg GTPase Obg Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q39QR4 5.32e-14 75 33 3 130 3 obg GTPase Obg Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A8AWM9 5.34e-14 76 36 3 138 3 obg GTPase Obg Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A4F9L3 5.35e-14 76 32 4 163 3 obg GTPase Obg Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A3PAT7 5.43e-14 75 34 2 129 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9301)
B9DSH7 5.47e-14 76 36 3 138 3 obg GTPase Obg Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B9LC30 5.54e-14 76 32 5 167 3 obg GTPase Obg Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WK62 5.54e-14 76 32 5 167 3 obg GTPase Obg Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A4VUC8 5.71e-14 76 36 3 138 3 obg GTPase Obg Streptococcus suis (strain 05ZYH33)
A3CM33 5.9e-14 76 36 3 138 3 obg GTPase Obg Streptococcus sanguinis (strain SK36)
Q03JJ8 5.92e-14 76 36 3 138 3 obg GTPase Obg Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3C8 5.92e-14 76 36 3 138 3 obg GTPase Obg Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYR4 5.92e-14 76 36 3 138 3 obg GTPase Obg Streptococcus thermophilus (strain CNRZ 1066)
A4W0M2 6.2e-14 76 36 3 138 3 obg GTPase Obg Streptococcus suis (strain 98HAH33)
Q3ZAJ2 6.26e-14 75 32 2 138 3 obg GTPase Obg Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A1W4B0 6.28e-14 75 34 4 141 3 obg GTPase Obg Acidovorax sp. (strain JS42)
A0ZZZ0 6.3e-14 76 35 3 129 3 obg GTPase Obg Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
B1XT35 6.88e-14 75 34 2 131 3 obg GTPase Obg Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A9BDI4 7.19e-14 75 36 2 127 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9211)
B1H0I4 7.45e-14 75 35 3 128 3 obg GTPase Obg Endomicrobium trichonymphae
B4UIU2 8.06e-14 75 35 3 129 3 obg GTPase Obg Anaeromyxobacter sp. (strain K)
B8JBP2 8.14e-14 75 35 3 129 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B2UCV3 8.29e-14 75 33 3 139 3 obg GTPase Obg Ralstonia pickettii (strain 12J)
B1Y280 8.55e-14 75 34 4 141 3 obg GTPase Obg Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
F4HSD4 8.61e-14 75 27 8 248 2 ATOBGM Probable GTP-binding protein OBGM, mitochondrial Arabidopsis thaliana
Q2IH84 9.1e-14 75 35 3 129 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-C)
B3DPS4 9.31e-14 75 33 2 130 3 obg GTPase Obg Bifidobacterium longum (strain DJO10A)
Q6NFV7 9.88e-14 75 35 4 129 3 obg GTPase Obg Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q82V20 1.03e-13 74 39 4 113 3 obg GTPase Obg Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q67SC6 1.1e-13 75 35 3 128 3 obg GTPase Obg Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P9WMT0 1.14e-13 75 35 3 128 3 obg GTPase Obg Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A1TTD3 1.15e-13 74 33 3 139 3 obg GTPase Obg Paracidovorax citrulli (strain AAC00-1)
P9WMT1 1.17e-13 75 35 3 128 1 obg GTPase Obg Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U5D6 1.17e-13 75 35 3 128 3 obg GTPase Obg Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KLD6 1.17e-13 75 35 3 128 3 obg GTPase Obg Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TYK5 1.17e-13 75 35 3 128 3 obg GTPase Obg Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B5YJ65 1.2e-13 74 31 3 168 3 obg GTPase Obg Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q0AAD6 1.24e-13 74 34 2 129 3 obg GTPase Obg Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B7JVH9 1.24e-13 74 36 2 129 3 obg GTPase Obg Rippkaea orientalis (strain PCC 8801 / RF-1)
A9BP68 1.26e-13 74 37 4 134 3 obg GTPase Obg Delftia acidovorans (strain DSM 14801 / SPH-1)
A0QDH0 1.35e-13 75 34 3 129 3 obg GTPase Obg Mycobacterium avium (strain 104)
A4G8R4 1.37e-13 74 35 2 131 3 obg GTPase Obg Herminiimonas arsenicoxydans
Q73XP5 1.38e-13 75 34 3 129 3 obg GTPase Obg Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q892N8 1.41e-13 75 35 4 138 3 obg GTPase Obg Clostridium tetani (strain Massachusetts / E88)
Q2VZU2 1.46e-13 74 30 5 203 3 obg GTPase Obg Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A6T2D5 1.48e-13 74 35 2 131 3 obg GTPase Obg Janthinobacterium sp. (strain Marseille)
B8DVU1 1.48e-13 75 34 2 128 3 obg GTPase Obg Bifidobacterium animalis subsp. lactis (strain AD011)
Q5P7Z4 1.52e-13 74 34 3 134 3 obg GTPase Obg Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A8L1V6 1.56e-13 75 36 4 136 3 obg GTPase Obg Parafrankia sp. (strain EAN1pec)
Q0AHG5 1.63e-13 74 34 3 132 3 obg GTPase Obg Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7MW55 1.64e-13 74 42 2 107 3 obg GTPase Obg Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIY7 1.64e-13 74 42 2 107 3 obg GTPase Obg Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B1X0M2 1.68e-13 74 35 2 129 3 obg GTPase Obg Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8FN81 1.72e-13 75 32 4 151 3 obg GTPase Obg Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8DYL0 1.74e-13 74 35 3 138 3 obg GTPase Obg Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E465 1.74e-13 74 35 3 138 3 obg GTPase Obg Streptococcus agalactiae serotype III (strain NEM316)
Q3K046 1.74e-13 74 35 3 138 3 obg GTPase Obg Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A9M061 1.79e-13 74 35 3 132 3 obg GTPase Obg Neisseria meningitidis serogroup C (strain 053442)
Q6MTG9 2.01e-13 74 29 5 199 3 obg GTPase Obg Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
P0C1E6 2.02e-13 74 34 3 129 3 obg GTPase Obg Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QG78 2.15e-13 74 34 3 129 3 obg GTPase Obg Corynebacterium glutamicum (strain R)
Q8FYM2 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella suis biovar 1 (strain 1330)
A9WWW9 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VSI5 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YJ80 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M882 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57B45 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella abortus biovar 1 (strain 9-941)
Q2YLM2 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella abortus (strain 2308)
B2S806 2.21e-13 73 39 3 108 3 obg GTPase Obg Brucella abortus (strain S19)
A1KAD0 2.29e-13 74 32 2 132 3 obg GTPase Obg Azoarcus sp. (strain BH72)
A4SVA3 2.32e-13 73 33 2 131 3 obg GTPase Obg Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q2SRV9 2.37e-13 74 29 5 199 3 obg GTPase Obg Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q1GZ53 2.42e-13 73 34 4 134 3 obg GTPase Obg Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8DGG4 2.46e-13 73 36 1 109 3 obg GTPase Obg Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A6WXS0 2.66e-13 73 39 3 108 3 obg GTPase Obg Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5N4J6 2.75e-13 73 34 2 129 3 obg GTPase Obg Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PN0 2.75e-13 73 34 2 129 3 obg GTPase Obg Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8XVL0 2.78e-13 73 38 2 101 3 obg GTPase Obg Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B9MDZ7 2.97e-13 73 33 3 139 3 obg GTPase Obg Acidovorax ebreus (strain TPSY)
B9JUH9 3.16e-13 73 38 2 106 3 obg GTPase Obg Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8EWL0 3.37e-13 73 31 2 158 3 obg GTPase Obg Malacoplasma penetrans (strain HF-2)
B0T310 3.47e-13 73 39 2 108 3 obg GTPase Obg Caulobacter sp. (strain K31)
B9K736 3.5e-13 73 37 3 130 3 obg GTPase Obg Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q5H2E5 3.54e-13 73 34 2 132 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STC0 3.54e-13 73 34 2 132 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P5B4 3.54e-13 73 34 2 132 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A8F478 3.64e-13 73 36 4 128 3 obg GTPase Obg Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q9CF94 3.69e-13 73 34 3 138 3 obg GTPase Obg Lactococcus lactis subsp. lactis (strain IL1403)
A0LSX1 3.86e-13 73 35 3 140 3 obg GTPase Obg Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
P72931 3.88e-13 73 38 1 111 3 obg GTPase Obg Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3A1D8 4.04e-13 73 34 3 137 3 obg GTPase Obg Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q72HR4 4.28e-13 73 32 3 132 3 obg GTPase Obg Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q2RV04 4.36e-13 73 38 3 108 3 obg GTPase Obg Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B8H9P2 4.53e-13 73 33 3 128 3 obg GTPase Obg Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q5SHE9 4.57e-13 73 32 3 132 1 obg GTPase Obg Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B1VGL9 4.59e-13 73 33 2 128 3 obg GTPase Obg Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
Q02XY2 4.76e-13 73 34 3 138 3 obg GTPase Obg Lactococcus lactis subsp. cremoris (strain SK11)
A2RJQ6 4.76e-13 73 34 3 138 3 obg GTPase Obg Lactococcus lactis subsp. cremoris (strain MG1363)
B8GYI7 4.94e-13 72 36 1 106 1 cgtA GTPase Obg/CgtA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CB41 4.94e-13 72 36 1 106 3 obg GTPase Obg Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1LSJ9 5.41e-13 72 36 3 127 3 obg GTPase Obg Baumannia cicadellinicola subsp. Homalodisca coagulata
A3NDS7 5.58e-13 72 32 3 139 3 obg GTPase Obg Burkholderia pseudomallei (strain 668)
Q3BW46 5.71e-13 72 34 3 137 3 obg GTPase Obg Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q605N2 5.71e-13 72 39 1 99 3 obg GTPase Obg Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B5ELU2 5.96e-13 72 36 4 129 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J427 5.96e-13 72 36 4 129 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q9RY66 6e-13 73 31 4 173 3 obg GTPase Obg Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q63QM0 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia pseudomallei (strain K96243)
Q3JNG0 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia pseudomallei (strain 1710b)
A3NZJ0 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia pseudomallei (strain 1106a)
A1V0P1 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia mallei (strain SAVP1)
Q62GV4 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia mallei (strain ATCC 23344)
A2S5R8 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10229)
A3MR90 6.12e-13 72 32 3 139 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10247)
B2GGD9 6.48e-13 73 34 3 127 3 obg GTPase Obg Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q8PN23 6.62e-13 72 32 3 152 3 obg GTPase Obg Xanthomonas axonopodis pv. citri (strain 306)
Q1B629 6.66e-13 73 34 3 129 3 obg GTPase Obg Mycobacterium sp. (strain MCS)
A1UJ07 6.66e-13 73 34 3 129 3 obg GTPase Obg Mycobacterium sp. (strain KMS)
A3Q2F3 6.66e-13 73 34 3 129 3 obg GTPase Obg Mycobacterium sp. (strain JLS)
Q1LIQ0 6.77e-13 72 34 3 132 3 obg GTPase Obg Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4FP46 6.82e-13 72 37 1 106 3 obg GTPase Obg Pelagibacter ubique (strain HTCC1062)
Q30XW0 6.87e-13 72 34 3 132 3 obg GTPase Obg Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B8DRN9 7.34e-13 72 36 5 138 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q21YZ9 7.54e-13 72 34 4 127 3 obg GTPase Obg Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A6LD68 7.6e-13 72 37 1 106 3 obg GTPase Obg Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A5VD74 7.69e-13 72 29 8 216 3 obg GTPase Obg Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B2SYV2 7.75e-13 72 35 4 134 3 obg GTPase Obg Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2V968 7.96e-13 72 35 3 128 3 obg GTPase Obg Sulfurihydrogenibium sp. (strain YO3AOP1)
A0LCZ3 8.85e-13 72 35 4 130 3 obg GTPase Obg Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A2SD36 8.92e-13 72 34 3 112 3 obg GTPase Obg Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
C3M9X9 9.2e-13 72 37 3 108 3 obg GTPase Obg Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3SKG2 9.21e-13 72 38 2 100 3 obg GTPase Obg Thiobacillus denitrificans (strain ATCC 25259)
Q2LR77 9.77e-13 72 34 2 129 3 obg GTPase Obg Syntrophus aciditrophicus (strain SB)
Q4A6N4 9.84e-13 72 27 5 221 3 obg GTPase Obg Mycoplasmopsis synoviae (strain 53)
B2JHD7 9.87e-13 72 33 3 132 3 obg GTPase Obg Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A9IFF9 9.91e-13 72 29 7 217 3 obg GTPase Obg Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q13U15 1.02e-12 72 33 3 132 3 obg GTPase Obg Paraburkholderia xenovorans (strain LB400)
Q89ZI9 1.13e-12 72 37 1 105 3 obg GTPase Obg Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B3R898 1.3e-12 71 33 3 132 3 obg GTPase Obg Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A1AT81 1.3e-12 71 31 3 130 3 obg GTPase Obg Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A6UDV6 1.32e-12 71 36 2 108 3 obg GTPase Obg Sinorhizobium medicae (strain WSM419)
Q92LB4 1.32e-12 71 36 2 108 3 obg GTPase Obg Rhizobium meliloti (strain 1021)
B1JVA1 1.33e-12 71 32 3 133 3 obg GTPase Obg Burkholderia orbicola (strain MC0-3)
A0K4B0 1.33e-12 71 32 3 133 3 obg GTPase Obg Burkholderia cenocepacia (strain HI2424)
Q5WTF1 1.34e-12 71 33 4 134 3 obg GTPase Obg Legionella pneumophila (strain Lens)
Q8RHS8 1.35e-12 72 32 3 128 3 obg GTPase Obg Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5X1P1 1.38e-12 71 33 4 134 3 obg GTPase Obg Legionella pneumophila (strain Paris)
B1YSU7 1.39e-12 71 32 3 129 3 obg GTPase Obg Burkholderia ambifaria (strain MC40-6)
Q1BZE0 1.4e-12 71 32 3 133 3 obg GTPase Obg Burkholderia orbicola (strain AU 1054)
B4E5X0 1.4e-12 71 32 3 133 3 obg GTPase Obg Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A4JBB8 1.41e-12 71 32 3 129 3 obg GTPase Obg Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q5ZS70 1.5e-12 71 33 4 134 3 obg GTPase Obg Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0K6P6 1.51e-12 71 33 3 132 3 obg GTPase Obg Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A5IAS7 1.52e-12 71 33 4 134 3 obg GTPase Obg Legionella pneumophila (strain Corby)
Q46X17 1.52e-12 71 33 3 132 3 obg GTPase Obg Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9AI60 1.53e-12 71 33 3 133 3 obg GTPase Obg Burkholderia multivorans (strain ATCC 17616 / 249)
Q98EZ3 1.59e-12 71 32 6 169 3 obg GTPase Obg Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1B9C8 1.59e-12 71 37 2 108 3 obg GTPase Obg Paracoccus denitrificans (strain Pd 1222)
Q2JDP2 1.61e-12 72 36 5 136 3 obg GTPase Obg Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q0BIH8 1.65e-12 71 32 3 129 3 obg GTPase Obg Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2Y807 1.66e-12 71 34 3 132 3 obg GTPase Obg Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B0U3R3 1.71e-12 71 37 2 100 3 obg GTPase Obg Xylella fastidiosa (strain M12)
Q1DC95 1.77e-12 72 33 4 130 3 obg GTPase Obg Myxococcus xanthus (strain DK1622)
Q39JU7 1.78e-12 71 32 3 133 3 obg GTPase Obg Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1R0C0 1.79e-12 71 35 4 142 3 obg GTPase Obg Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q9PAS3 1.85e-12 71 37 2 100 3 obg GTPase Obg Xylella fastidiosa (strain 9a5c)
Q64XA5 1.92e-12 71 35 1 106 3 obg GTPase Obg Bacteroides fragilis (strain YCH46)
Q5LGG9 1.94e-12 71 35 1 106 3 obg GTPase Obg Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A8ZRY1 2.02e-12 70 33 2 137 3 obg GTPase Obg Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A0PU15 2.05e-12 71 34 3 129 3 obg GTPase Obg Mycobacterium ulcerans (strain Agy99)
Q68VS1 2.07e-12 70 36 4 129 3 obg GTPase Obg Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B9JER1 2.09e-12 71 40 3 102 3 obg GTPase Obg Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B1MMY5 2.09e-12 71 34 3 129 3 obg GTPase Obg Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B8J4L3 2.12e-12 71 32 3 138 3 obg GTPase Obg Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q47MV6 2.16e-12 71 33 4 130 3 obg GTPase Obg Thermobifida fusca (strain YX)
B9M3W3 2.21e-12 70 31 4 138 3 obg GTPase Obg Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q1IW72 2.23e-12 71 30 4 172 3 obg GTPase Obg Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q5NR23 2.41e-12 70 33 3 138 3 obg GTPase Obg Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2RKZ8 2.44e-12 71 33 3 142 3 obg GTPase Obg Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A6Q4D2 2.6e-12 70 29 4 175 3 obg GTPase Obg Nitratiruptor sp. (strain SB155-2)
B1X580 2.64e-12 70 36 2 111 3 obg Putative GTPase Obg Paulinella chromatophora
Q4JWT6 2.66e-12 71 33 2 129 3 obg GTPase Obg Corynebacterium jeikeium (strain K411)
Q3J6S0 2.69e-12 70 32 3 127 3 obg GTPase Obg Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0VSE6 2.7e-12 70 34 3 128 3 obg GTPase Obg Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q92G19 2.74e-12 70 35 3 131 3 obg GTPase Obg Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q11CP6 2.8e-12 70 37 3 108 3 obg GTPase Obg Chelativorans sp. (strain BNC1)
B3PIU9 2.81e-12 70 34 3 128 3 obg GTPase Obg Cellvibrio japonicus (strain Ueda107)
Q6F0U3 2.87e-12 70 31 2 138 3 obg GTPase Obg Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q1RGV9 2.99e-12 70 34 3 130 3 obg GTPase Obg Rickettsia bellii (strain RML369-C)
A8GUG0 2.99e-12 70 34 3 130 3 obg GTPase Obg Rickettsia bellii (strain OSU 85-389)
Q24SP0 3.13e-12 70 32 2 140 3 obg GTPase Obg Desulfitobacterium hafniense (strain Y51)
A6GZB7 3.26e-12 70 35 1 106 3 obg GTPase Obg Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q5FUL2 3.31e-12 70 41 3 101 3 obg GTPase Obg Gluconobacter oxydans (strain 621H)
Q7ND61 3.32e-12 70 33 2 130 3 obg GTPase Obg Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7CW97 3.34e-12 70 38 2 102 3 obg GTPase Obg Agrobacterium fabrum (strain C58 / ATCC 33970)
Q87BL2 3.34e-12 70 37 2 100 3 obg GTPase Obg Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6V6 3.34e-12 70 37 2 100 3 obg GTPase Obg Xylella fastidiosa (strain M23)
Q0RPF6 3.42e-12 71 36 5 136 3 obg GTPase Obg Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
C0QLE9 3.48e-12 70 34 4 132 3 obg GTPase Obg Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B8FUR9 3.72e-12 70 32 2 140 3 obg GTPase Obg Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A1TC21 3.72e-12 70 33 3 129 3 obg GTPase Obg Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A1R787 3.76e-12 70 32 3 128 3 obg GTPase Obg Paenarthrobacter aurescens (strain TC1)
Q7VZX6 3.91e-12 70 37 1 100 3 obg GTPase Obg Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1P2 3.91e-12 70 37 1 100 3 obg GTPase Obg Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQL8 3.91e-12 70 37 1 100 3 obg GTPase Obg Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A0JXJ8 4.05e-12 70 32 2 126 3 obg GTPase Obg Arthrobacter sp. (strain FB24)
Q2SZG0 4.15e-12 70 32 3 133 3 obg GTPase Obg Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6YRC6 4.35e-12 70 32 3 128 3 obg GTPase Obg Onion yellows phytoplasma (strain OY-M)
C0QX49 4.45e-12 70 38 1 105 3 obg GTPase Obg Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A5GD29 4.73e-12 69 30 3 138 3 obg GTPase Obg Geotalea uraniireducens (strain Rf4)
Q0AWJ4 4.77e-12 70 34 4 138 3 obg GTPase Obg Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B8GQQ3 4.91e-12 69 33 3 138 3 obg GTPase Obg Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A4XAG1 5.12e-12 70 33 2 128 3 obg GTPase Obg Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q2S9T3 5.28e-12 70 35 2 131 3 obg GTPase Obg Hahella chejuensis (strain KCTC 2396)
B2HMG1 5.44e-12 70 34 3 129 3 obg GTPase Obg Mycobacterium marinum (strain ATCC BAA-535 / M)
Q0D3S3 5.53e-12 70 41 2 100 3 OBGC1 Probable GTP-binding protein OBGC1, chloroplastic Oryza sativa subsp. japonica
A2YPR8 5.53e-12 70 41 2 100 3 OBGC1 Probable GTP-binding protein OBGC1, chloroplastic Oryza sativa subsp. indica
A8M0Y9 5.66e-12 70 34 3 127 3 obg GTPase Obg Salinispora arenicola (strain CNS-205)
Q2L062 5.72e-12 69 37 1 100 3 obg GTPase Obg Bordetella avium (strain 197N)
Q8L7L0 5.78e-12 70 39 1 99 2 OBGL GTP-binding protein OBGC, chloroplastic Arabidopsis thaliana
A4T2J4 5.93e-12 70 33 3 129 3 obg GTPase Obg Mycolicibacterium gilvum (strain PYR-GCK)
A5IYU8 5.99e-12 70 32 2 128 3 obg GTPase Obg Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q3AF51 6.45e-12 70 33 3 132 3 obg GTPase Obg Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2KAW2 6.76e-12 70 30 4 142 3 obg GTPase Obg Elusimicrobium minutum (strain Pei191)
B3QVU6 6.87e-12 69 35 1 105 3 obg GTPase Obg Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q7NB30 7.17e-12 69 36 2 111 3 obg GTPase Obg Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q2QZ37 7.2e-12 70 34 3 129 2 OBGM Probable GTP-binding protein OBGM, mitochondrial Oryza sativa subsp. japonica
B6IQZ9 7.27e-12 69 36 2 108 3 obg GTPase Obg Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2NCX8 7.38e-12 69 34 4 130 3 obg GTPase Obg Erythrobacter litoralis (strain HTCC2594)
Q03F34 7.48e-12 69 32 3 140 3 obg GTPase Obg Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A8GTZ9 7.53e-12 69 34 3 129 3 obg GTPase Obg Rickettsia rickettsii (strain Sheila Smith)
B0BVJ1 7.53e-12 69 34 3 129 3 obg GTPase Obg Rickettsia rickettsii (strain Iowa)
Q4UJV1 7.53e-12 69 37 2 107 3 obg GTPase Obg Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q12F99 7.6e-12 69 33 4 135 3 obg GTPase Obg Polaromonas sp. (strain JS666 / ATCC BAA-500)
B3PRZ3 7.64e-12 69 39 2 100 3 obg GTPase Obg Rhizobium etli (strain CIAT 652)
Q4FRK6 8.08e-12 69 30 5 193 3 obg GTPase Obg Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B4U7P8 8.16e-12 68 33 5 162 3 obg GTPase Obg Hydrogenobaculum sp. (strain Y04AAS1)
Q2K2X6 8.5e-12 69 39 2 100 3 obg GTPase Obg Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0AKX2 9.15e-12 68 37 3 106 3 obg GTPase Obg Maricaulis maris (strain MCS10)
A1VK90 9.28e-12 69 33 4 135 3 obg GTPase Obg Polaromonas naphthalenivorans (strain CJ2)
Q1MA76 9.36e-12 69 38 2 100 3 obg GTPase Obg Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B9L605 9.37e-12 68 33 2 127 3 obg GTPase Obg Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B1N057 9.71e-12 69 37 1 100 3 obg GTPase Obg Leuconostoc citreum (strain KM20)
A0R149 9.72e-12 69 31 4 151 3 obg GTPase Obg Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A8GQ55 9.75e-12 68 36 2 110 3 obg GTPase Obg Rickettsia akari (strain Hartford)
Q851Q6 1e-11 69 41 2 97 2 Os03g0799700 Probable GTP-binding protein OBGC2 Oryza sativa subsp. japonica
Q2NIK0 1.01e-11 69 32 3 127 3 obg GTPase Obg Aster yellows witches'-broom phytoplasma (strain AYWB)
B5ZUE3 1.03e-11 68 38 2 100 3 obg GTPase Obg Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q5FH94 1.12e-11 68 33 1 107 3 obg GTPase Obg Ehrlichia ruminantium (strain Gardel)
Q5HB45 1.14e-11 68 33 1 107 3 obg GTPase Obg Ehrlichia ruminantium (strain Welgevonden)
A6L100 1.19e-11 68 35 1 106 3 obg GTPase Obg Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q6G4Z2 1.21e-11 68 36 3 108 3 obg GTPase Obg Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A8F063 1.21e-11 68 37 2 107 3 obg GTPase Obg Rickettsia canadensis (strain McKiel)
Q2GGS7 1.24e-11 68 36 2 107 3 obg GTPase Obg Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q7MYX6 1.24e-11 68 34 3 127 3 obg GTPase Obg Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q4QM31 1.25e-11 68 33 3 127 3 obg GTPase Obg Haemophilus influenzae (strain 86-028NP)
Q3IXX9 1.25e-11 68 39 3 102 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PQJ0 1.25e-11 68 39 3 102 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9KW04 1.27e-11 68 39 3 102 3 obg GTPase Obg Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B0UMS4 1.32e-11 68 37 3 108 3 obg GTPase Obg Methylobacterium sp. (strain 4-46)
B3CQ33 1.35e-11 68 37 1 100 3 obg GTPase Obg Orientia tsutsugamushi (strain Ikeda)
A5CDM6 1.35e-11 68 37 1 100 3 obg GTPase Obg Orientia tsutsugamushi (strain Boryong)
Q3YRX8 1.36e-11 68 29 2 131 3 obg GTPase Obg Ehrlichia canis (strain Jake)
A1WPR5 1.42e-11 68 34 3 134 3 obg GTPase Obg Verminephrobacter eiseniae (strain EF01-2)
A9IMA6 1.47e-11 68 35 3 108 3 obg GTPase Obg Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q4AAV4 1.48e-11 68 34 3 128 3 obg GTPase Obg Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
A5FMX0 1.52e-11 68 36 1 96 3 obg GTPase Obg Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A4WZ45 1.52e-11 68 39 3 102 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q29K06 1.78e-11 68 29 8 229 3 GA10450 GTP-binding protein 10 homolog Drosophila pseudoobscura pseudoobscura

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02360
Feature type CDS
Gene ychF
Product redox-regulated ATPase YchF
Location 453725 - 454816 (strand: -1)
Length 1092 (nucleotides) / 363 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_604
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01926 50S ribosome-binding GTPase
PF06071 Protein of unknown function (DUF933)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0012 Translation, ribosomal structure and biogenesis (J) J Ribosome-binding ATPase YchF, GTP1/OBG family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06942 ribosome-binding ATPase - -

Protein Sequence

MGFKCGIVGLPNVGKSTLFNALTKAGIEAANFPFCTIEPNTGVVPMPDARLDALAEIVKPQRILPTTMEFVDIAGLVKGASKGEGLGNQFLTNIRETEAIGHVVRCFDDDNIVHVSGRVNPVEDIDTINTELALADLDTCERAIHRVQKRAKGGDKDAKLELEVLEKCLPLLENAQMLRTLNLNKEEMGAIRYLSFLTLKPTMYIANVNEDGFENNPYLDQVREIAEKEGSVVVPVCAAIESDIAELEDGDREEFMADLGIEEPGLNRVIRAGYALLNLQTYFTAGVKEVRAWTIPVGATAPQAAGKIHTDFEKGFIRAQTIAFEDFIQYKGEQGAKEAGKMRAEGKDYIVKDGDVLNFLFNV

Flanking regions ( +/- flanking 50bp)

CGTGCTTGCAGGCCGTTTTGGTCTGCTGTCATTTTTAAGGTGAAGAATTTATGGGTTTCAAATGTGGTATCGTCGGTCTGCCGAACGTTGGGAAATCAACGCTGTTTAACGCGCTGACCAAAGCAGGTATTGAAGCGGCGAACTTTCCGTTCTGTACAATTGAGCCGAACACCGGCGTGGTGCCGATGCCGGATGCCCGCCTGGATGCACTGGCGGAAATCGTAAAACCACAGCGTATTCTGCCGACCACCATGGAATTCGTCGATATCGCCGGTCTGGTGAAAGGCGCCTCCAAAGGTGAAGGTCTGGGTAACCAGTTCCTGACCAACATCCGTGAAACAGAAGCTATCGGCCACGTTGTCCGCTGCTTTGACGATGATAACATTGTTCACGTTTCCGGCCGTGTTAACCCGGTAGAAGATATTGATACCATCAATACCGAACTGGCGCTGGCTGACCTCGACACCTGTGAACGTGCTATCCACCGTGTGCAGAAACGCGCCAAAGGCGGCGACAAAGACGCGAAACTGGAGCTGGAAGTACTGGAAAAATGCCTGCCGCTGCTGGAAAACGCACAGATGCTGCGCACACTGAACCTGAATAAAGAAGAAATGGGGGCGATCCGCTACCTGAGCTTCCTGACCCTGAAACCAACCATGTACATTGCCAACGTCAATGAAGATGGCTTTGAAAACAACCCGTATCTGGATCAGGTGCGTGAAATCGCAGAGAAAGAAGGTTCAGTTGTGGTGCCGGTATGCGCGGCAATCGAATCCGATATCGCTGAGCTGGAGGATGGTGACCGCGAAGAGTTTATGGCTGACCTCGGTATCGAAGAACCGGGCCTGAACCGCGTGATCCGCGCCGGTTACGCCCTGCTTAACCTGCAGACCTATTTCACCGCCGGTGTGAAAGAAGTCCGTGCATGGACTATCCCTGTCGGCGCAACCGCCCCGCAGGCAGCCGGTAAAATCCACACCGACTTTGAAAAAGGCTTTATCCGCGCCCAGACCATCGCATTTGAGGATTTCATCCAGTACAAAGGCGAACAAGGTGCAAAAGAAGCCGGTAAAATGCGCGCAGAAGGTAAAGATTACATTGTGAAAGACGGCGACGTACTGAATTTCCTGTTTAATGTGTAATCTATATTCATAAGGCATCCGGGAGGATGCCTTACCTGATATATATTTAT