Homologs in group_2238

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17140 FBDBKF_17140 100.0 Morganella morganii S1 baeS Signal transduction histidine kinase
NLDBIP_01710 NLDBIP_01710 100.0 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_00325 LHKJJB_00325 100.0 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_00365 HKOGLL_00365 100.0 Morganella morganii S5 baeS Signal transduction histidine kinase
F4V73_RS05900 F4V73_RS05900 81.9 Morganella psychrotolerans - ATP-binding protein
PMI_RS08305 PMI_RS08305 50.0 Proteus mirabilis HI4320 - ATP-binding protein

Distribution of the homologs in the orthogroup group_2238

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2238

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8GP19 2.09e-146 429 48 6 462 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q8X524 9.79e-38 146 27 13 458 2 qseC Sensor protein QseC Escherichia coli O157:H7
P40719 3.88e-37 144 27 13 458 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P45336 1.75e-36 143 26 14 468 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZLZ9 3.59e-32 130 27 12 443 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 3.66e-32 130 27 12 443 3 qseC Sensor protein QseC Salmonella typhi
Q9HV31 7.81e-24 107 28 3 247 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q742C0 1.23e-21 101 27 10 302 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A3Q5L8 1.5e-21 100 27 7 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q1B3X9 1.87e-21 100 27 7 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 1.87e-21 100 27 7 265 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
A0QBR0 4.4e-21 99 26 10 302 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q4L6C5 4.6e-21 99 24 16 430 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q47457 5.17e-21 99 27 13 356 3 pcoS Probable sensor protein PcoS Escherichia coli
Q8XBY4 1.21e-20 97 26 7 279 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q70FG9 4.92e-20 94 27 8 302 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q9Z5G7 7.48e-20 95 26 10 317 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P77485 8.62e-20 95 26 7 278 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
T2KMF4 1.13e-19 96 28 5 213 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A0R3I7 1.17e-19 95 28 8 266 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QR01 1.62e-19 93 30 7 226 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0PWB3 3.13e-19 94 26 9 291 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
Q8FK37 3.55e-19 93 26 7 278 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DMC5 4.21e-19 94 27 6 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 4.36e-19 94 27 6 239 1 rcsC Sensor histidine kinase RcsC Escherichia coli
Q7A0W5 5.1e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 5.1e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 5.1e-19 92 24 12 298 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 5.1e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 5.1e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 5.1e-19 92 24 12 298 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 5.1e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 5.49e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 5.54e-19 92 24 12 298 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
P58402 7.95e-19 93 27 7 254 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P30855 1.42e-18 92 27 7 254 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q45614 1.44e-18 92 27 7 231 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P0DMK6 1.56e-18 91 27 6 262 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
I1WSZ3 2.84e-18 90 26 7 263 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q8KIY1 4.45e-18 91 26 8 308 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
A1TEL6 5.69e-18 89 26 8 288 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P36557 6.68e-18 88 26 11 334 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56128 7.05e-18 90 27 6 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P35164 1.07e-17 89 27 9 259 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P58662 1.08e-17 89 27 6 239 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1KHB8 1.4e-17 88 25 9 295 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.4e-17 88 25 9 295 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P42245 1.57e-17 86 26 5 209 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
P9WGK7 1.63e-17 88 28 8 285 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.63e-17 88 28 8 285 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.63e-17 88 28 8 285 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54SP4 2.38e-17 89 27 11 307 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.93e-07 57 22 9 276 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q6GGK7 2.42e-17 88 27 8 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
P30847 2.53e-17 87 26 7 259 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P23545 2.82e-17 88 29 5 220 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P9WGL1 3.58e-17 87 25 9 295 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 3.58e-17 87 25 9 295 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 3.58e-17 87 25 9 295 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q55932 3.92e-17 87 29 5 221 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9L523 4.33e-17 87 27 8 228 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 4.45e-17 87 27 8 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 4.45e-17 87 27 8 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 4.45e-17 87 27 8 228 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 4.45e-17 87 27 8 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
P51392 6.27e-17 87 26 6 241 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q869S5 7.02e-17 87 28 8 234 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q7A5H7 7.14e-17 86 26 8 228 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 7.14e-17 86 26 8 228 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q44007 7.73e-17 86 26 14 395 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P9WGK5 1.58e-16 84 28 6 233 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.58e-16 84 28 6 233 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.58e-16 84 28 6 233 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KLK7 1.91e-16 85 30 7 233 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P54883 2.85e-16 84 30 6 233 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P76339 3.8e-16 84 26 13 351 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
O69729 4.35e-16 84 29 9 230 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q1XD95 5.14e-16 84 25 8 269 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q8ZPP5 6.15e-16 84 28 6 238 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4L8M0 6.96e-16 83 23 7 307 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q02541 7.31e-16 83 26 8 265 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
P40330 1.6e-15 83 28 7 239 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P16575 2.02e-15 82 28 7 239 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8DPL8 2.24e-15 81 28 7 208 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 2.24e-15 81 28 7 208 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8D5Z6 2.72e-15 82 28 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
P26762 2.79e-15 82 28 7 239 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7MD16 3.07e-15 82 28 6 230 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q9ZHD4 3.66e-15 81 24 9 304 3 silS Probable sensor kinase SilS Salmonella typhimurium
O34638 4.92e-15 80 27 11 278 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
A2C884 6.69e-15 79 30 8 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
P30844 6.75e-15 79 28 11 295 1 basS Sensor protein BasS Escherichia coli (strain K12)
Q9F8D7 9.67e-15 80 29 6 216 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0AEC4 9.68e-15 80 25 5 232 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 9.68e-15 80 25 5 232 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 9.68e-15 80 25 5 232 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P49333 1.15e-14 80 28 5 225 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q9RDT3 1.17e-14 79 26 9 249 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
O33071 1.35e-14 79 25 7 287 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
O34206 1.39e-14 79 28 6 206 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q87GU5 1.85e-14 79 27 9 243 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0AEC5 1.94e-14 79 28 7 237 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.94e-14 79 28 7 237 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.94e-14 79 28 7 237 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P08400 2.15e-14 78 26 6 252 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P59342 2.22e-14 79 28 7 237 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q8CSL7 2.24e-14 78 24 10 305 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P48027 2.3e-14 79 27 5 216 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
A7MRY4 2.39e-14 79 33 9 206 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P0C5S6 2.41e-14 79 33 9 206 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
P54302 2.61e-14 79 26 7 230 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q49ZT9 3.11e-14 78 24 10 298 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7V6P7 3.22e-14 77 29 8 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
A6QD58 3.48e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q5HPC4 3.54e-14 78 24 10 305 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A215 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 3.7e-14 78 26 9 250 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 3.7e-14 78 26 9 250 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 3.7e-14 78 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
P96368 3.99e-14 78 28 12 305 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0A4I6 4.97e-14 77 26 8 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 4.97e-14 77 26 8 235 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
E0X9C7 5.08e-14 78 26 5 226 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q49XM6 5.54e-14 77 24 9 287 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P45609 8.21e-14 76 25 6 252 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q9I0I2 8.86e-14 76 25 8 263 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P45608 9.23e-14 76 27 8 233 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q6GKS6 1.07e-13 77 26 9 250 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
O49230 1.2e-13 77 27 6 234 2 ETR1 Ethylene receptor 1 Brassica oleracea
O34989 1.61e-13 76 25 14 326 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q8DMC5 1.67e-13 75 28 9 235 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P18392 2.18e-13 75 29 7 217 1 rstB Sensor protein RstB Escherichia coli (strain K12)
A5W4E3 2.41e-13 76 27 6 224 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P9WGL3 3.2e-13 75 26 8 257 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 3.32e-13 75 26 8 257 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P74111 4.27e-13 75 28 9 242 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P21865 4.51e-13 75 26 13 291 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q0IBF4 4.59e-13 73 29 8 224 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q9XH58 5.37e-13 75 25 6 241 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q5AHA0 5.7e-13 75 27 8 235 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2T0V9 5.89e-13 74 27 9 230 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9SSY6 7.44e-13 74 25 6 251 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q9SXL4 7.94e-13 74 26 10 288 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9HZ47 1e-12 73 27 9 268 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O82436 1.63e-12 73 25 6 231 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q54YH4 1.66e-12 73 23 6 239 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q08408 2.03e-12 72 24 6 226 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q54YZ9 2.17e-12 73 28 6 222 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q7U871 2.19e-12 72 28 7 220 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q3AYV8 2.21e-12 72 27 8 236 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q9APE0 2.24e-12 72 23 6 221 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
O22267 2.64e-12 73 21 7 302 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
Q95PI2 2.76e-12 73 27 8 240 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q9RQQ9 2.84e-12 72 23 6 221 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q03228 3.44e-12 72 26 7 229 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9HUI3 3.8e-12 72 25 7 235 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8CTI3 4.77e-12 70 27 10 260 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 4.77e-12 70 27 10 260 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P71380 6.46e-12 70 27 10 245 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39664 6.86e-12 70 29 6 188 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q6GIT7 7.13e-12 70 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q4LAJ8 7.19e-12 71 24 8 247 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
A0QTK3 7.45e-12 71 24 15 383 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O48929 7.68e-12 71 25 6 247 2 ETR1 Ethylene receptor Nicotiana tabacum
Q7A1J2 8.09e-12 70 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 8.09e-12 70 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 8.09e-12 70 26 9 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 8.09e-12 70 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 8.09e-12 70 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z553 9.23e-12 70 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 9.23e-12 70 25 6 275 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 9.23e-12 70 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 9.23e-12 70 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 9.23e-12 70 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q04804 1.07e-11 70 26 9 263 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O14002 1.11e-11 71 25 8 242 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P37461 1.13e-11 70 23 7 238 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q41342 1.25e-11 70 26 7 249 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P0C0F6 1.33e-11 70 24 7 247 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8Z332 1.33e-11 70 23 7 238 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q551X9 1.35e-11 70 29 6 224 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
P0C0F7 1.36e-11 70 24 7 247 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q840P7 1.37e-11 69 26 9 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q5HHW5 1.47e-11 69 26 9 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.47e-11 69 26 9 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.47e-11 69 26 9 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
Q7A3X0 1.49e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.49e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.49e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.49e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.49e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A159 1.68e-11 70 24 8 249 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NV46 1.8e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.8e-11 69 25 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q8CU87 1.91e-11 70 24 8 249 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.91e-11 70 24 8 249 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8G5E7 2.11e-11 68 27 10 243 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q6GE72 2.28e-11 69 25 6 271 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q9XH57 2.43e-11 69 27 8 249 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q9M7M1 2.74e-11 69 25 4 220 2 ETR1 Ethylene receptor Prunus persica
O49187 2.76e-11 69 25 7 234 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
A3PDI2 2.9e-11 68 27 9 233 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q38846 2.9e-11 69 26 8 262 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
A2BRQ6 3.4e-11 68 27 9 233 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A5A2P0 3.41e-11 68 25 7 228 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
O81122 4.28e-11 68 26 6 229 2 ETR1 Ethylene receptor Malus domestica
Q93CB7 4.5e-11 68 26 11 292 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8Z7H3 5.97e-11 68 23 7 269 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 6.13e-11 68 23 7 269 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 6.13e-11 68 23 7 269 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 6.13e-11 68 23 7 269 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 6.13e-11 68 23 7 269 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 6.13e-11 68 23 7 269 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 6.13e-11 68 23 7 269 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
A0A4P7TSF2 6.32e-11 67 26 8 261 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 6.32e-11 67 26 8 261 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 6.32e-11 67 26 8 261 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q2JWK9 6.8e-11 67 24 6 238 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q9KHI5 7.12e-11 68 27 8 229 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P20169 7.62e-11 68 23 7 232 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q03069 7.62e-11 67 24 5 216 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
P9WGK9 7.85e-11 67 28 8 225 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK8 8.06e-11 67 28 8 225 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 8.06e-11 67 28 8 225 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZEP3 9.02e-11 67 30 10 240 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CCJ1 9.38e-11 67 26 11 287 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q53RH0 1.1e-10 67 27 7 241 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.1e-10 67 27 7 241 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q31AE8 1.27e-10 66 25 10 261 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
P08401 1.34e-10 67 23 6 235 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q7V113 1.46e-10 66 28 9 233 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q2YZ23 1.65e-10 66 24 6 275 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A6X5X4 1.83e-10 67 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A1A697 2.46e-10 66 20 6 275 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q7BWI3 2.57e-10 65 26 6 214 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8DKG0 3.52e-10 66 25 7 245 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q08430 3.56e-10 65 24 7 219 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q52969 3.59e-10 65 26 8 234 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
B0CI82 3.59e-10 66 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8FZ86 4.13e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
Q8YIM6 4.2e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BR6 4.5e-10 65 23 5 223 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 4.5e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 4.5e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
P73276 5.31e-10 65 36 3 104 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q54U87 5.32e-10 65 25 10 255 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
A5VRX4 5.74e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P37894 6.08e-10 65 24 5 211 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8E3C7 6.59e-10 64 25 6 215 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
A9M715 6.6e-10 65 23 5 223 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
P52101 8.53e-10 64 24 11 299 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q0DKM0 8.84e-10 64 22 6 250 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
P23837 9.04e-10 64 24 9 267 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8FIB8 9.04e-10 64 24 9 267 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P72292 9.06e-10 64 27 11 240 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q83RR1 9.28e-10 64 24 9 267 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
B8AY75 9.32e-10 64 22 6 250 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
P0AE82 1.17e-09 63 24 8 242 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.17e-09 63 24 8 242 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.17e-09 63 24 8 242 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P23621 1.19e-09 63 26 6 234 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q06067 1.43e-09 63 23 6 218 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q8DXQ8 1.5e-09 63 25 6 215 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P08982 1.55e-09 63 26 8 261 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.55e-09 63 26 8 261 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
Q82EB2 1.77e-09 63 27 8 219 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P41406 1.81e-09 63 26 8 261 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
B7KFU0 1.91e-09 63 26 7 241 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
P0A4I8 2.14e-09 62 25 9 275 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.14e-09 62 25 9 275 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9K620 2.3e-09 62 26 12 307 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q06240 2.37e-09 62 26 6 215 1 vanS Sensor protein VanS Enterococcus faecium
Q8XA47 2.54e-09 62 23 11 299 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
P16497 2.56e-09 63 27 7 222 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q8X739 2.58e-09 62 23 9 267 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q47745 2.59e-09 62 21 13 397 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q9C5U1 2.92e-09 63 21 6 280 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q5A599 2.93e-09 63 20 6 264 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A1A696 3.12e-09 63 24 1 148 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
A2WYI4 3.14e-09 63 24 1 148 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
P44578 3.15e-09 62 25 6 219 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2JKD9 3.35e-09 62 24 6 238 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
B2J946 3.38e-09 62 26 10 263 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q86CZ2 4.38e-09 62 25 10 239 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q4L482 4.53e-09 61 24 4 222 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P10955 4.94e-09 62 24 15 341 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q6GJ10 5.01e-09 61 24 6 250 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
A1A698 5.08e-09 62 23 1 156 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
P39453 5.19e-09 62 23 9 257 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q07737 6.24e-09 62 23 9 315 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
B7K3M6 6.53e-09 61 26 8 240 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9ZWL6 6.53e-09 62 26 6 234 2 ETR1 Ethylene receptor Passiflora edulis
Q8CTL4 7.5e-09 60 26 7 230 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 7.5e-09 60 26 7 230 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A6Z3 7.92e-09 60 24 6 233 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 7.92e-09 60 24 6 233 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 7.92e-09 60 24 6 233 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 7.92e-09 60 24 6 233 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 7.92e-09 60 24 6 233 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q55630 8.98e-09 60 23 5 226 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O31661 9.33e-09 61 28 6 219 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q8NXR5 1.48e-08 60 25 5 208 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 1.48e-08 60 25 5 208 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
Q2YSS1 1.51e-08 60 25 5 208 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8Z182 1.54e-08 60 25 5 208 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 1.54e-08 60 25 5 208 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 1.54e-08 60 25 5 208 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 1.54e-08 60 25 5 208 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 1.54e-08 60 25 5 208 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q04850 1.84e-08 60 26 7 212 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P18540 2.14e-08 60 26 8 233 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8CRA8 2.23e-08 60 21 5 260 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8X614 2.26e-08 60 23 9 238 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
P94414 2.48e-08 59 21 10 313 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q49VK4 2.68e-08 59 25 10 261 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9C5U2 2.82e-08 60 25 4 199 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q3S4A7 3.37e-08 59 23 6 251 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q9LCC2 3.65e-08 59 25 13 274 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P58356 3.89e-08 59 23 9 257 3 torS Sensor protein TorS Escherichia coli O157:H7
P94608 4.61e-08 59 26 8 219 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0A0H3GPN8 4.69e-08 58 22 7 241 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q04943 4.91e-08 58 27 9 250 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B1WYT4 5.35e-08 58 23 8 241 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
E5KK10 5.94e-08 58 22 8 246 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P14377 8.14e-08 58 21 16 411 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q5HLN1 1.32e-07 57 20 5 260 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q54RP6 1.46e-07 58 23 6 206 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q06904 1.55e-07 57 26 8 248 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1A699 1.77e-07 57 23 2 158 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
A7HD43 2.71e-07 56 24 8 221 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q9C5U0 3.07e-07 57 24 2 150 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
Q55168 3.31e-07 56 26 11 246 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9R6X3 3.91e-07 56 24 8 229 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q55E44 4.59e-07 56 24 2 144 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
P26489 5.14e-07 55 26 8 203 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P45675 5.14e-07 55 27 11 239 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
Q9K997 5.86e-07 55 27 7 187 3 dctS Probable C4-dicarboxylate sensor kinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q44930 7.51e-07 54 23 9 225 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
O32193 7.59e-07 55 20 12 309 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P0DOA0 9.12e-07 55 25 10 236 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O35044 1.19e-06 53 25 6 224 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q9P7Q7 1.28e-06 55 20 7 248 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P33113 1.4e-06 54 25 8 250 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
O31671 1.96e-06 53 21 5 220 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P45670 1.98e-06 53 23 9 227 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
Q9P896 2.19e-06 53 20 8 286 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0A2D9 2.77e-06 52 25 9 221 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 2.77e-06 52 25 9 221 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q9HU20 3.55e-06 53 26 7 210 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2FWH7 3.83e-06 53 21 5 208 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q54Q69 4.88e-06 53 27 5 148 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q9KM24 5.13e-06 52 26 8 217 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0JK50 5.48e-06 52 21 5 237 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9HWA7 6.33e-06 52 24 8 250 1 pprA Two-component sensor PprA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P19906 6.41e-06 52 25 11 281 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q9HWR3 6.42e-06 52 24 6 231 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10578 8.98e-06 51 24 8 209 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q8DMT2 9.29e-06 51 26 7 219 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O34971 1.86e-05 51 26 7 171 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q54W36 4.2e-05 50 22 3 154 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P06218 4.38e-05 49 24 9 221 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q8DN03 4.77e-05 49 21 6 229 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 4.77e-05 49 21 6 229 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P40758 6.08e-05 48 31 8 145 1 glnK Sensor histidine kinase GlnK Bacillus subtilis (strain 168)
P39764 0.000162 47 22 7 259 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
P07168 0.000212 47 27 10 236 3 virA Wide host range VirA protein Rhizobium radiobacter
O24972 0.000217 47 22 8 268 1 arsS Sensor histidine kinase ArsS Helicobacter pylori (strain ATCC 700392 / 26695)
P10799 0.000222 47 27 10 236 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q8YR50 0.000231 47 29 1 86 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52687 0.000232 47 27 6 180 1 citA Sensor histidine kinase CitA Klebsiella pneumoniae
O74539 0.000236 47 21 8 253 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3M8A7 0.000298 46 29 1 86 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3J6C1 0.000483 46 27 11 218 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P10047 0.000711 45 27 4 120 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P0C0Z0 0.001 45 27 11 218 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_01750
Feature type CDS
Gene baeS
Product Signal transduction histidine kinase
Location 341199 - 342617 (strand: -1)
Length 1419 (nucleotides) / 472 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2238
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Protein Sequence

MRIRSFFVYTVLLQTFSMLLLWGVWIAWLKYAYLPGLSEDFNAQQMVIARGVSDTLRETPTDSATFPQIARALESMYANAMKSGLEEENYDPLVAILHSTTGEVLYSNKPDVHIPLKPDGIERFTEDGETWYLAYNTDPDMQRTAVIGESGTDRHMLIGDPATGTAVPLLFILGTMLSSTIITTYLSLRPLRETTRSIATRNPGNLTPISMKYQYNEMRPVLHAINQLMQRVDAANLREKQFMADAAHELRTPIAAVLAQIHLLKQIDDPAERNEITADMEISLDRAVSLSRQLIDLARLETEDYPLKMEEIDLTQALSHTIAMLVPYALRKNIEFSFDGPESCIVVTDKQALFSIINNILNNAVKYCPPDSQAEVSLDTGNPEEVQIIIRDNGNGISEQYRHRLFSRFFRVPGCSENGSGLGLAIAQNLAEKIGGYLSVTDGLQQRGIGFVIHIPAKNREISAASHDSSDT

Flanking regions ( +/- flanking 50bp)

TGATTACCGTCCGCGGAATTGGTTATCTGCTGAAAAAGGACAGCGAATAAGTGAGAATCCGCTCATTCTTTGTTTATACCGTTCTCCTTCAGACCTTCTCAATGCTCCTGCTGTGGGGCGTCTGGATAGCCTGGCTGAAATACGCTTATCTGCCCGGTTTAAGTGAAGATTTTAATGCCCAGCAGATGGTGATTGCCCGTGGTGTCTCTGACACACTGCGGGAAACCCCCACGGATTCCGCCACCTTCCCGCAGATTGCCCGTGCCCTGGAGAGTATGTACGCCAATGCGATGAAAAGCGGCCTGGAAGAGGAAAATTATGATCCGCTGGTCGCTATTCTGCACAGTACAACGGGTGAAGTGCTGTACAGTAATAAACCGGATGTTCATATTCCGCTGAAACCTGACGGAATCGAGCGTTTCACCGAGGACGGCGAAACCTGGTATCTTGCTTATAATACCGACCCGGATATGCAGCGCACCGCTGTTATCGGGGAATCCGGCACTGACCGCCATATGCTGATCGGCGACCCGGCAACCGGCACCGCCGTCCCGCTGCTGTTTATTCTCGGCACCATGCTCTCATCCACGATTATCACCACCTATCTCAGTCTGCGCCCGCTGCGTGAAACCACCCGCAGTATCGCCACCCGTAATCCCGGCAACCTGACACCCATCAGCATGAAGTATCAGTACAATGAAATGCGTCCGGTACTGCATGCCATTAACCAGCTGATGCAGCGGGTGGATGCCGCCAATCTGCGGGAAAAACAGTTTATGGCGGATGCCGCTCATGAACTGCGTACGCCGATTGCCGCCGTACTGGCACAAATTCATCTGCTCAAACAGATCGATGACCCGGCGGAGCGCAACGAAATCACCGCGGATATGGAAATCAGTCTGGATCGCGCGGTATCACTGTCACGGCAACTGATTGATCTGGCCCGGCTGGAAACGGAAGATTATCCGCTGAAAATGGAAGAGATCGACCTGACCCAGGCACTGAGCCACACCATTGCCATGCTGGTGCCCTACGCCCTGCGCAAAAATATTGAGTTTTCCTTCGACGGTCCGGAAAGCTGCATTGTTGTCACCGATAAACAGGCGCTGTTCTCCATCATCAACAATATTCTGAATAACGCGGTGAAATACTGCCCGCCGGACAGTCAGGCAGAAGTCTCGCTGGACACCGGCAACCCGGAGGAAGTGCAGATTATTATCCGCGATAACGGCAACGGCATCAGTGAGCAGTACCGCCACCGCCTGTTCTCGCGCTTTTTCCGTGTGCCGGGCTGCAGTGAGAACGGCAGCGGTCTCGGTCTTGCCATTGCACAGAATCTGGCAGAAAAAATCGGTGGTTATCTCTCCGTCACCGACGGATTGCAGCAGCGCGGTATCGGGTTTGTGATCCACATTCCGGCAAAAAACCGTGAAATTTCCGCTGCCTCCCATGACAGTTCTGATACATAAGGCTATGCTGAAAAAAGTCAGAACAGGAGGGACAGATGAAACAGGCACTG