Homologs in group_2310

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17735 FBDBKF_17735 65.4 Morganella morganii S1 yddA ABC-type uncharacterized transport system, permease and ATPase components
EHELCC_09760 EHELCC_09760 65.4 Morganella morganii S2 yddA ABC-type uncharacterized transport system, permease and ATPase components
NLDBIP_10140 NLDBIP_10140 65.4 Morganella morganii S4 yddA ABC-type uncharacterized transport system, permease and ATPase components
LHKJJB_07615 LHKJJB_07615 65.4 Morganella morganii S3 yddA ABC-type uncharacterized transport system, permease and ATPase components
HKOGLL_07165 HKOGLL_07165 65.4 Morganella morganii S5 yddA ABC-type uncharacterized transport system, permease and ATPase components
F4V73_RS15225 F4V73_RS15225 66.6 Morganella psychrotolerans - ABC transporter ATP-binding protein/permease

Distribution of the homologs in the orthogroup group_2310

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2310

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31826 1.05e-114 355 36 4 553 1 yddA Inner membrane ABC transporter ATP-binding protein YddA Escherichia coli (strain K12)
Q57335 5.51e-87 284 31 5 550 3 HI_0036 Uncharacterized ABC transporter ATP-binding protein HI_0036 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45221 2.86e-75 253 30 5 537 3 HI_1467 Uncharacterized ABC transporter ATP-binding protein HI_1467 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQI9 3.24e-66 230 31 11 495 1 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI8 3.24e-66 230 31 11 495 3 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q55774 1.96e-64 226 32 10 488 3 sll0182 Uncharacterized ABC transporter ATP-binding protein sll0182 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6NLC1 4.02e-62 220 26 15 641 1 ABCC2 ABC transporter D family member 2, chloroplastic Arabidopsis thaliana
Q94FB9 1.36e-20 100 22 13 525 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
Q94FB9 1.53e-08 61 19 18 546 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
P28288 1.96e-20 99 22 18 526 1 ABCD3 ATP-binding cassette sub-family D member 3 Homo sapiens
Q08120 2.7e-20 97 27 7 333 3 bacA Bacteroid development protein BacA Rhizobium meliloti (strain 1021)
O89016 7.17e-20 97 22 20 557 1 Abcd4 Lysosomal cobalamin transporter ABCD4 Mus musculus
Q7JUN3 8.53e-20 97 23 19 546 2 Abcd1 ATP-binding cassette sub-family D member 1 Drosophila melanogaster
Q9X2W0 9.94e-20 96 25 25 499 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
P55096 1.36e-19 96 23 20 524 1 Abcd3 ATP-binding cassette sub-family D member 3 Mus musculus
Q87RE5 1.47e-19 92 30 5 205 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P16970 1.68e-19 95 23 21 525 1 Abcd3 ATP-binding cassette sub-family D member 3 Rattus norvegicus
Q7MMN0 4.31e-19 90 29 4 204 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 4.31e-19 90 29 4 204 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q5E6M2 5.63e-19 90 29 4 202 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q61285 1.09e-18 93 28 6 246 1 Abcd2 ATP-binding cassette sub-family D member 2 Mus musculus
Q1GL85 1.4e-18 89 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
O14678 1.52e-18 92 21 15 512 1 ABCD4 Lysosomal cobalamin transporter ABCD4 Homo sapiens
F1RBC8 1.05e-17 90 26 5 248 2 abcd1 ATP-binding cassette sub-family D member 1 Danio rerio
P0AFY6 1.51e-17 88 25 10 338 1 sbmA Peptide antibiotic transporter SbmA Escherichia coli (strain K12)
P0AFY7 1.51e-17 88 25 10 338 3 sbmA Peptide antibiotic transporter SbmA Escherichia coli O157:H7
Q9QY44 2.03e-17 89 26 5 246 1 Abcd2 ATP-binding cassette sub-family D member 2 Rattus norvegicus
Q54W19 2.11e-17 89 25 11 357 3 abcD1 ABC transporter D family member 1 Dictyostelium discoideum
Q5NQX0 2.18e-17 84 32 7 201 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P23886 2.52e-17 89 32 6 219 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q8T8P3 3.29e-17 89 23 17 512 3 abcD2 ABC transporter D family member 2 Dictyostelium discoideum
P33897 4.01e-17 88 25 5 247 1 ABCD1 ATP-binding cassette sub-family D member 1 Homo sapiens
Q9KQB8 6.26e-17 84 29 4 204 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1B9K8 1.09e-16 83 32 2 156 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q9UBJ2 1.59e-16 86 30 3 168 1 ABCD2 ATP-binding cassette sub-family D member 2 Homo sapiens
Q3IWB5 3.14e-16 82 31 7 190 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q160Y9 3.16e-16 82 31 9 193 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
D3ZHR2 3.36e-16 85 29 3 193 1 Abcd1 ATP-binding cassette sub-family D member 1 Rattus norvegicus
Q5LUR8 4.55e-16 81 32 7 177 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P48410 5.48e-16 85 30 3 169 1 Abcd1 ATP-binding cassette sub-family D member 1 Mus musculus
Q73P93 9.14e-16 83 31 7 195 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q0S0X2 1.07e-15 80 33 6 174 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
A0LCH8 1.08e-15 80 36 7 171 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q4L8L7 1.26e-15 79 28 6 201 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q2SPI3 1.3e-15 80 33 8 189 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
P54537 2.44e-15 79 29 7 198 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q5PB72 4.56e-15 78 26 10 243 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q0P9X7 5.09e-15 78 30 6 203 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q54W20 5.87e-15 82 31 4 172 3 abcD3 ABC transporter D family member 3 Dictyostelium discoideum
Q4UJW5 6.27e-15 77 28 8 206 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1R155 6.4e-15 78 34 6 148 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
O84071 6.62e-15 78 34 8 189 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A1VZQ5 8.39e-15 77 30 6 203 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9WXX8 9.08e-15 77 30 4 182 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6FFL0 1.26e-14 77 32 6 177 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P45081 1.31e-14 80 31 4 189 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5WBL0 1.45e-14 77 35 4 151 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q1CJG3 2.59e-14 76 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 2.59e-14 76 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 2.59e-14 76 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q57213 2.72e-14 75 32 5 179 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77279 2.77e-14 75 31 6 210 1 fetA Probable iron export ATP-binding protein FetA Escherichia coli (strain K12)
Q3YSK9 2.86e-14 76 25 8 232 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q66AT7 4.68e-14 75 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1RGL1 5.33e-14 75 28 8 206 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q6D4A8 7.03e-14 75 32 11 207 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q68W42 7.43e-14 78 27 6 210 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q92G36 7.92e-14 74 28 8 206 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6LTB1 8.04e-14 75 27 5 203 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q48PV0 8.48e-14 75 29 7 204 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2GJA5 8.94e-14 74 28 9 206 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
P48334 9.71e-14 74 30 7 194 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q9PKX1 1.14e-13 74 33 9 202 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q4FU75 1.42e-13 77 30 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A0KPH6 1.54e-13 74 27 6 206 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q2SE49 1.63e-13 73 28 4 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hahella chejuensis (strain KCTC 2396)
Q57554 1.69e-13 73 32 6 175 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P44513 1.86e-13 75 33 7 201 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KXJ6 1.9e-13 76 29 7 207 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q87UN0 2.03e-13 73 28 6 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2GFZ6 2.99e-13 73 31 5 154 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q831K6 3.03e-13 74 29 7 188 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1QDA8 3.11e-13 76 30 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q28VN1 3.6e-13 72 25 5 194 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q1BWL4 3.61e-13 74 30 5 198 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 3.61e-13 74 30 5 198 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q82B58 3.75e-13 75 29 7 210 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8T9W2 4.22e-13 75 24 5 292 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
A1JRI2 4.39e-13 72 30 8 204 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0A125QXJ1 4.51e-13 75 28 5 208 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q6D5H7 4.75e-13 73 33 7 187 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7N545 5e-13 72 29 7 206 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9X0Y8 5.78e-13 72 31 8 195 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q4QP85 5.97e-13 73 32 7 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q8RGC8 6.18e-13 73 27 6 196 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q6ME20 6.83e-13 73 31 5 186 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q1BG75 7.38e-13 72 32 4 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 7.38e-13 72 32 4 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q895C4 7.52e-13 73 29 6 191 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q6A6X6 7.62e-13 73 30 7 203 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q87JM4 8.06e-13 75 30 6 202 3 macB Macrolide export ATP-binding/permease protein MacB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q57399 8.35e-13 72 34 9 185 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SK28 8.51e-13 72 32 5 173 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q65TH4 8.67e-13 74 29 6 203 3 macB Macrolide export ATP-binding/permease protein MacB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q54U44 1.01e-12 75 27 4 190 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q8NSN2 1.01e-12 73 30 7 203 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8D385 1.16e-12 71 32 5 165 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8G5P8 1.27e-12 73 30 6 187 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q9X196 1.32e-12 73 29 6 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q74K65 1.38e-12 72 27 6 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q21XJ9 1.45e-12 71 33 6 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q54JR2 1.6e-12 74 25 3 198 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q8RI39 1.72e-12 72 29 5 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9V2E4 1.73e-12 71 27 8 205 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q44613 1.8e-12 70 33 10 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0AAG5 1.82e-12 73 27 5 206 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 1.82e-12 73 27 5 206 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 1.82e-12 73 27 5 206 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
Q4ZZS2 1.84e-12 71 27 6 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q668T8 1.93e-12 70 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ST87 1.96e-12 74 26 4 191 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
P27675 1.96e-12 70 29 7 202 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q5HBR8 1.98e-12 70 29 9 200 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.98e-12 70 29 9 200 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q9Z8J5 2.13e-12 70 30 6 187 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q59R09 2.35e-12 73 31 7 209 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1CHI9 2.38e-12 70 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD58 2.38e-12 70 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q1C647 2.38e-12 70 30 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q03P57 2.38e-12 72 29 6 186 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P10346 2.48e-12 70 31 9 199 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q82VK1 2.54e-12 73 28 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q6G2E2 2.57e-12 72 30 9 206 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q818I7 2.63e-12 70 30 5 202 3 pstB Phosphate import ATP-binding protein PstB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9KU04 2.77e-12 70 28 7 215 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3CMQ7 2.83e-12 72 29 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q1WVG9 3.02e-12 71 30 9 205 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
O70595 3.08e-12 73 27 4 205 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
Q73GK9 3.34e-12 70 33 6 156 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q6D606 3.45e-12 69 27 5 204 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z2L6 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 3.46e-12 70 30 10 210 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 3.46e-12 70 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q50966 3.69e-12 71 36 5 157 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q4L4R9 3.89e-12 71 30 7 190 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q9DC29 3.94e-12 72 23 18 458 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
Q87S48 3.97e-12 70 27 7 229 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3KKA1 4.06e-12 70 27 6 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q5GRS1 4.14e-12 69 30 4 149 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
P33916 4.23e-12 72 32 8 209 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 1.7e-08 60 29 7 198 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q1Q889 4.35e-12 69 31 5 157 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q57538 4.71e-12 72 30 4 206 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45022 5.04e-12 69 30 9 206 3 HI_1078 Probable amino-acid ABC transporter ATP-binding protein HI_1078 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9LZJ5 5.1e-12 72 30 6 184 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q3A9G5 5.12e-12 70 30 7 197 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q82CD3 5.2e-12 69 34 7 175 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P41909 5.28e-12 72 30 4 158 1 PXA1 Peroxisomal long-chain fatty acid import protein 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8YDJ8 5.3e-12 70 29 9 221 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q042G7 5.84e-12 70 27 6 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q4WLN7 5.89e-12 72 31 7 209 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q89AJ0 6.09e-12 69 28 8 217 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P39456 6.11e-12 69 27 7 203 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q325N3 6.13e-12 69 33 5 183 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q03ZQ0 7.17e-12 70 30 4 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
O34979 7.28e-12 68 29 7 199 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
P45275 7.48e-12 68 27 8 220 3 HI_1618 Uncharacterized ABC transporter ATP-binding protein HI_1618 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34677 7.96e-12 68 30 9 199 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
P9WER4 8.05e-12 72 27 7 223 3 braE ABC-type transporter braE Annulohypoxylon truncatum
Q576K0 8.09e-12 69 29 9 221 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 8.09e-12 69 29 9 221 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q9ZCC4 8.13e-12 68 26 8 206 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia prowazekii (strain Madrid E)
Q981Y8 8.29e-12 68 35 7 179 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8DZJ0 1.01e-11 70 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.01e-11 70 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.01e-11 70 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q5KVK2 1.09e-11 70 31 7 187 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q8ELQ6 1.14e-11 70 31 6 187 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q83KR7 1.19e-11 68 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.19e-11 68 30 10 210 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
H2LNR5 1.21e-11 71 24 8 305 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q6BXD7 1.23e-11 71 26 9 298 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5FA19 1.26e-11 69 36 5 157 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q00564 1.42e-11 70 30 11 231 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q49W48 1.44e-11 69 30 6 188 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q54P13 1.48e-11 71 23 10 281 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q8X5I6 1.49e-11 68 33 5 184 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q2NSG3 1.51e-11 67 30 5 185 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Sodalis glossinidius (strain morsitans)
Q92UV5 1.53e-11 70 31 6 193 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q0RKH4 1.57e-11 68 31 7 172 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8UCM5 1.59e-11 68 29 6 197 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
A0KMJ3 1.62e-11 70 28 5 201 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3MBW2 1.73e-11 68 28 6 209 3 pstB2 Phosphate import ATP-binding protein PstB 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P68580 1.74e-11 70 28 8 230 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 1.74e-11 70 28 8 230 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
Q668E1 1.76e-11 68 27 8 225 3 pstB1 Phosphate import ATP-binding protein PstB 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CK45 1.76e-11 68 27 8 225 3 pstB1 Phosphate import ATP-binding protein PstB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCX5 1.76e-11 68 27 8 225 3 pstB1 Phosphate import ATP-binding protein PstB 1 Yersinia pestis
Q1C5N7 1.76e-11 68 27 8 225 3 pstB1 Phosphate import ATP-binding protein PstB 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1LQF6 1.76e-11 69 31 8 203 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q4W575 1.82e-11 69 35 6 161 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.82e-11 69 35 6 161 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P74981 1.82e-11 68 37 9 169 1 hmuV Hemin import ATP-binding protein HmuV Yersinia enterocolitica
Q3Z542 1.83e-11 68 33 5 183 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 1.83e-11 68 33 5 183 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
A1B9H9 1.94e-11 67 35 8 176 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q6D2D5 1.97e-11 68 29 9 220 3 pstB1 Phosphate import ATP-binding protein PstB 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q03PY5 2.02e-11 68 27 5 191 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6FYL0 2.03e-11 70 28 7 201 3 macB Macrolide export ATP-binding/permease protein MacB Bartonella quintana (strain Toulouse)
Q1M7A6 2.1e-11 67 32 6 179 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q92P76 2.25e-11 68 29 5 179 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q4PH16 2.3e-11 70 25 9 286 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q82MV1 2.35e-11 67 34 5 146 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q5WJP0 2.54e-11 68 31 6 186 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q830W6 2.6e-11 68 27 4 160 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q49ZT6 2.62e-11 67 27 7 205 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6FAN3 2.65e-11 68 30 6 198 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q03203 2.72e-11 70 29 7 244 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q8FV85 2.78e-11 68 31 7 201 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.78e-11 68 31 7 201 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.78e-11 68 31 7 201 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.78e-11 68 31 7 201 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
P45861 2.79e-11 69 27 8 231 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q0P9C4 2.81e-11 69 25 6 251 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q6MCV4 2.82e-11 68 30 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q13ZK7 2.84e-11 68 30 5 191 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q7MNI7 2.87e-11 67 28 9 230 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio vulnificus (strain YJ016)
Q8DEW5 2.87e-11 67 28 9 230 3 pstB1 Phosphate import ATP-binding protein PstB 1 Vibrio vulnificus (strain CMCP6)
Q217B2 2.87e-11 67 34 7 177 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q1RFH8 2.91e-11 67 33 5 187 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 2.91e-11 67 33 5 187 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9CJB8 2.93e-11 70 29 11 234 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q9I190 3.01e-11 70 26 10 236 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q46Y69 3.06e-11 68 31 8 203 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q39GW5 3.11e-11 68 32 3 158 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6Y306 3.16e-11 70 29 4 171 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q0AGF4 3.32e-11 68 30 4 159 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8FUU5 3.39e-11 68 29 9 221 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
P45171 3.48e-11 68 30 4 154 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SFW6 3.49e-11 68 30 8 201 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q0BFQ0 3.54e-11 68 31 4 162 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q7VMF9 3.83e-11 69 29 7 202 3 macB Macrolide export ATP-binding/permease protein MacB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q4QK57 3.87e-11 68 30 4 154 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
O21280 3.94e-11 66 27 4 183 3 CCMA Cytochrome c biogenesis ATP-binding export protein CcmA Reclinomonas americana
Q2RPB4 3.99e-11 69 32 9 200 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q83LR7 4.23e-11 69 28 8 225 3 macB Macrolide export ATP-binding/permease protein MacB Shigella flexneri
Q9ZCM8 4.28e-11 69 27 5 184 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q07LU3 4.33e-11 67 33 7 171 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q0RT43 4.41e-11 67 30 9 208 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q66FK0 4.61e-11 67 35 6 167 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 4.61e-11 67 35 6 167 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 4.61e-11 67 35 6 167 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 4.61e-11 67 35 6 167 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q65V02 4.7e-11 66 29 5 179 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2W4W1 4.76e-11 67 28 7 203 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q4JTG9 4.87e-11 68 31 8 203 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
A1VYW8 4.87e-11 69 31 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q8LGU1 4.94e-11 69 26 4 191 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q6CYU2 5.1e-11 67 30 9 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q62K56 5.2e-11 67 30 7 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q02MI4 5.53e-11 68 26 9 231 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain UCBPP-PA14)
Q63TW1 5.54e-11 67 30 6 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q138A9 5.61e-11 66 32 8 191 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q5FQN4 5.67e-11 65 30 2 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Gluconobacter oxydans (strain 621H)
Q2K6Q4 6.07e-11 67 27 8 215 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
O57872 6.14e-11 66 28 8 209 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8Z5W6 6.21e-11 66 29 9 207 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q4KKK4 6.22e-11 66 26 6 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q80WJ6 6.29e-11 69 29 4 171 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q4UMZ3 6.33e-11 68 27 5 205 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3JSR6 6.46e-11 67 30 7 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q0A9E2 6.53e-11 66 27 7 210 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8FKF5 6.55e-11 66 30 4 177 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32IZ6 6.68e-11 66 33 5 187 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q65F80 6.88e-11 67 29 6 198 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q60AI1 6.93e-11 67 32 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5E586 6.94e-11 67 30 6 187 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q04BG2 7.42e-11 67 28 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q48CA0 7.69e-11 66 31 6 200 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8DPC2 7.71e-11 67 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 7.71e-11 67 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 7.71e-11 67 28 6 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q87UI3 7.98e-11 66 29 7 224 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5PIA5 8.07e-11 66 30 10 205 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 8.07e-11 66 30 10 205 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8DUF7 8.39e-11 67 28 5 166 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5E3S7 8.79e-11 65 29 4 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0VTB6 8.96e-11 66 29 6 208 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1GB17 8.96e-11 67 28 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q54VJ0 9.05e-11 68 31 5 171 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q1QSE9 9.06e-11 66 31 9 202 3 pstB2 Phosphate import ATP-binding protein PstB 2 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5HVG3 9.5e-11 68 31 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni (strain RM1221)
O15439 9.51e-11 68 23 6 271 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
G5EFD4 9.86e-11 68 28 5 215 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q1R597 1.01e-10 65 34 8 177 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q8FCJ1 1.01e-10 65 34 8 177 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 1.01e-10 65 34 8 177 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2LVL0 1.03e-10 68 24 7 234 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q0PAR0 1.05e-10 68 31 8 203 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q32AY3 1.05e-10 65 34 8 177 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q6C6N0 1.05e-10 68 28 4 207 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
P91660 1.07e-10 68 29 4 171 2 l(2)03659 Probable multidrug resistance-associated protein lethal(2)03659 Drosophila melanogaster
Q4ZLS1 1.09e-10 66 31 6 200 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q0BWF7 1.1e-10 64 29 5 182 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hyphomonas neptunium (strain ATCC 15444)
Q8ELR4 1.1e-10 67 25 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O34946 1.12e-10 65 26 6 198 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q7VR29 1.12e-10 65 29 5 173 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella floridana
Q88RL1 1.12e-10 65 27 7 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8KFE9 1.13e-10 68 25 7 200 3 macB Macrolide export ATP-binding/permease protein MacB Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9CK97 1.13e-10 67 28 5 186 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
O70014 1.14e-10 65 34 8 177 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q8X5N2 1.15e-10 65 34 8 177 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
P54718 1.15e-10 67 26 10 287 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
Q38WL5 1.15e-10 67 30 5 186 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q1QE80 1.16e-10 67 31 5 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q54NL1 1.17e-10 68 30 5 175 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 3.19e-06 54 26 4 180 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q254K9 1.17e-10 66 30 8 201 3 metN Methionine import ATP-binding protein MetN Chlamydia felis (strain Fe/C-56)
Q13GD4 1.2e-10 65 34 5 171 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Paraburkholderia xenovorans (strain LB400)
Q88F88 1.22e-10 67 28 7 201 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2YVT7 1.23e-10 66 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1IGY7 1.23e-10 65 27 7 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q68Y13 1.24e-10 65 26 8 206 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P77622 1.27e-10 66 32 8 180 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
B5X0E4 1.29e-10 68 27 5 197 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 0.000118 48 24 6 197 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q54V86 1.36e-10 68 30 4 170 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q8UKE4 1.4e-10 67 28 7 208 3 macB Macrolide export ATP-binding/permease protein MacB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5WCI1 1.49e-10 65 30 3 160 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
P78966 1.5e-10 68 30 9 208 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.31e-05 52 25 5 185 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q64SQ6 1.52e-10 67 27 5 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q6D8T5 1.53e-10 67 27 5 206 3 macB Macrolide export ATP-binding/permease protein MacB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q83MA0 1.62e-10 65 32 5 183 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q5LBT4 1.65e-10 67 27 5 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q2JGF5 1.66e-10 65 30 6 170 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
P44407 1.69e-10 67 26 5 220 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I4A9 1.69e-10 65 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q66D26 1.7e-10 65 28 6 185 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CFV9 1.7e-10 65 28 6 185 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGU5 1.7e-10 65 28 6 185 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis
Q1C9L0 1.7e-10 65 28 6 185 3 phnC Phosphonates import ATP-binding protein PhnC Yersinia pestis bv. Antiqua (strain Antiqua)
P45092 1.72e-10 65 27 7 218 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7A7E3 1.79e-10 66 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 1.79e-10 66 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
E9Q236 1.84e-10 67 25 4 215 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
Q24QI5 1.85e-10 66 29 8 229 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q14Q07 1.92e-10 66 28 5 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q7ULB5 1.95e-10 67 27 5 211 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8XZQ4 1.95e-10 65 31 8 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1MQ44 2.1e-10 66 28 6 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5YRD1 2.1e-10 65 28 7 202 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q2YAD6 2.29e-10 66 30 4 155 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q92337 2.31e-10 67 22 10 323 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8NY21 2.44e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 2.44e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q87PH3 2.52e-10 66 29 5 187 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q97ZT9 2.52e-10 64 28 5 194 3 pstB Phosphate import ATP-binding protein PstB Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6MMH0 2.67e-10 64 27 6 201 3 pstB Phosphate import ATP-binding protein PstB Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9PF03 2.68e-10 65 31 5 182 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q5HIL5 2.69e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 2.69e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 2.69e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q21WN9 2.73e-10 66 24 7 270 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
O75027 2.79e-10 67 26 10 314 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
P0A9S0 2.84e-10 63 33 8 175 3 ftsE Cell division ATP-binding protein FtsE Shigella flexneri
P0A9R7 2.84e-10 63 33 8 175 1 ftsE Cell division ATP-binding protein FtsE Escherichia coli (strain K12)
P0A9R8 2.84e-10 63 33 8 175 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9R9 2.84e-10 63 33 8 175 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O157:H7
Q5X627 2.86e-10 65 31 5 152 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q58429 2.91e-10 64 28 5 182 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6G1V5 2.92e-10 66 26 6 201 3 macB Macrolide export ATP-binding/permease protein MacB Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q3ICT8 2.99e-10 64 33 7 166 3 hmuV Hemin import ATP-binding protein HmuV Pseudoalteromonas translucida (strain TAC 125)
P08183 3.06e-10 67 27 6 202 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 4.64e-05 50 21 4 182 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q9CM47 3.07e-10 66 29 9 204 3 macB Macrolide export ATP-binding/permease protein MacB Pasteurella multocida (strain Pm70)
Q881U6 3.18e-10 63 29 6 200 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8CRB0 3.18e-10 63 27 6 200 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7NQN5 3.19e-10 65 28 7 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8NR42 3.19e-10 64 32 6 175 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6GJL2 3.28e-10 65 29 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q92AF9 3.37e-10 63 26 6 187 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P45127 3.39e-10 66 28 7 204 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q81GC1 3.43e-10 65 28 3 153 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9KS33 3.5e-10 65 28 6 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9LYS2 3.53e-10 67 28 4 170 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
O85818 3.54e-10 65 29 4 154 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q4KGX6 3.54e-10 64 31 4 166 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q02QT1 3.57e-10 64 31 8 199 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
P77265 3.59e-10 66 28 7 218 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
Q07LQ4 3.64e-10 64 31 6 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q832Y6 3.67e-10 65 29 6 187 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q82TL6 3.71e-10 65 30 4 159 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9R1X5 3.77e-10 67 26 5 204 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 0.000727 46 24 4 195 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q2K164 3.77e-10 64 32 3 161 3 tauB Taurine import ATP-binding protein TauB Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q61102 3.81e-10 66 26 10 313 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q7CN92 4e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 4e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q04B25 4.04e-10 65 29 6 191 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q4FQ27 4.11e-10 63 31 5 158 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9MAH4 4.13e-10 66 27 4 193 3 ABCG10 ABC transporter G family member 10 Arabidopsis thaliana
F1M3J4 4.14e-10 66 24 4 229 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
P46920 4.21e-10 65 35 6 160 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q1GZI0 4.23e-10 66 24 14 361 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q46ZU5 4.3e-10 64 32 5 165 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1MEG2 4.37e-10 64 26 6 215 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q6LR20 4.39e-10 65 29 5 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q834B4 4.45e-10 63 28 6 191 3 pstB1 Phosphate import ATP-binding protein PstB 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1GAN9 4.46e-10 65 29 6 191 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1QCN2 4.53e-10 63 29 5 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9QYM0 5.05e-10 66 26 5 204 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 0.000233 48 23 8 259 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
O34338 5.13e-10 63 29 7 195 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q02Z10 5.22e-10 65 26 5 186 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q9CGD4 5.34e-10 65 26 5 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q6GE75 5.36e-10 63 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q9CP24 5.64e-10 63 30 4 152 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q5XCA4 5.66e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8EB59 5.7e-10 63 31 6 176 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0I2Z4 5.72e-10 64 26 5 198 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
P94440 5.77e-10 64 28 6 180 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q5E3B8 5.79e-10 63 26 5 215 3 pstB2 Phosphate import ATP-binding protein PstB 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5HLN4 5.87e-10 63 26 5 200 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1J6Q6 6.08e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 6.08e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 6.08e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 6.08e-10 65 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0CZ35 6.36e-10 64 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 6.36e-10 64 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 6.36e-10 64 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8T6H8 6.4e-10 66 29 4 169 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q9HT73 6.44e-10 63 25 6 197 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 6.44e-10 63 25 6 197 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2YZ26 6.53e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8ZNV7 6.68e-10 63 29 10 205 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q74IV9 6.9e-10 64 26 6 189 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q7A3X3 6.91e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 6.91e-10 62 25 8 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8Y8T6 6.95e-10 64 25 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q7M816 6.96e-10 63 31 8 189 3 metN Methionine import ATP-binding protein MetN Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P44656 7.31e-10 63 32 7 175 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92GP9 7.51e-10 65 28 5 182 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8NV47 7.52e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 7.52e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 7.52e-10 62 25 8 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 7.52e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 7.52e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 7.52e-10 62 25 8 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q8UF79 7.57e-10 63 28 5 179 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9SKX0 7.66e-10 65 22 7 296 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q9SKX0 1.92e-05 51 26 5 183 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q3M5J9 7.7e-10 63 31 7 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P0A2U7 7.89e-10 62 24 5 190 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 7.89e-10 62 24 5 190 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9K789 8.07e-10 64 25 7 199 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0AGP9 8.09e-10 64 25 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q4FL37 8.23e-10 64 34 5 159 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q65UE1 8.31e-10 64 29 4 158 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5E4D8 8.37e-10 63 31 7 197 3 pstB1 Phosphate import ATP-binding protein PstB 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4WT65 8.41e-10 65 29 8 202 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT65 8.79e-06 52 24 5 193 2 abcB ABC multidrug transporter B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q3IX40 8.49e-10 64 30 6 199 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P0A9W5 8.68e-10 65 29 8 205 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 8.68e-10 65 29 8 205 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 8.68e-10 65 29 8 205 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
Q9CPN2 8.82e-10 62 29 6 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pasteurella multocida (strain Pm70)
Q0I5E9 8.9e-10 64 29 8 198 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
P21448 8.96e-10 65 26 6 204 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 1.46e-05 52 22 6 221 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q9CP06 9.03e-10 64 30 4 158 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
P21441 9.12e-10 65 26 6 216 3 PGPA Multidrug resistance protein Leishmania tarentolae
A0A0H2VFI8 9.23e-10 65 29 8 205 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2SJY7 9.29e-10 64 28 5 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q31I51 9.44e-10 63 29 5 181 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3ILC5 9.75e-10 63 29 7 215 3 pstB Phosphate import ATP-binding protein PstB Pseudoalteromonas translucida (strain TAC 125)
Q92DL6 9.76e-10 64 25 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6Q876 1.01e-09 65 27 6 208 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 6.57e-07 56 25 7 236 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q65VG9 1.02e-09 63 28 7 197 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I2G0 1.06e-09 62 31 5 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Histophilus somni (strain 129Pt)
Q8D3A0 1.07e-09 62 30 7 171 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Wigglesworthia glossinidia brevipalpis
P0A9U3 1.09e-09 64 28 7 191 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 1.09e-09 64 28 7 191 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 1.09e-09 64 28 7 191 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q4A5A5 1.09e-09 63 24 5 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
Q52666 1.1e-09 62 28 7 196 3 bztD Glutamate/glutamine/aspartate/asparagine transport ATP-binding protein BztD Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q4QLJ9 1.11e-09 62 29 6 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus influenzae (strain 86-028NP)
Q0T7M2 1.12e-09 62 32 5 183 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri serotype 5b (strain 8401)
P34712 1.12e-09 65 26 5 200 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 5.96e-08 59 27 3 159 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P47705 1.12e-09 63 27 7 209 3 MG467 Putative ABC transporter ATP-binding protein MG467 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q5XDS8 1.13e-09 63 27 7 201 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
O15440 1.17e-09 65 25 5 204 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
O15440 0.000703 46 24 4 195 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
Q89ER4 1.18e-09 63 29 5 185 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HYG4 1.18e-09 63 31 8 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q704E8 1.18e-09 65 25 10 315 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q39LW7 1.19e-09 63 28 5 182 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5M4F2 1.19e-09 62 29 8 184 3 pstB2 Phosphate import ATP-binding protein PstB 2 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LZU2 1.19e-09 62 29 8 184 3 pstB2 Phosphate import ATP-binding protein PstB 2 Streptococcus thermophilus (strain CNRZ 1066)
Q8P2K6 1.2e-09 63 27 7 203 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q84EY8 1.2e-09 62 32 5 187 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
Q2YJJ8 1.3e-09 63 26 5 175 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 1.3e-09 63 26 5 175 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
Q99PE7 1.33e-09 64 28 6 188 1 Abcg5 ATP-binding cassette sub-family G member 5 Rattus norvegicus
Q6MIP7 1.34e-09 62 29 7 220 3 phnC Phosphonates import ATP-binding protein PhnC Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q3Z3Q4 1.35e-09 64 28 9 229 3 macB Macrolide export ATP-binding/permease protein MacB Shigella sonnei (strain Ss046)
Q1RE44 1.39e-09 64 28 9 229 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli (strain UTI89 / UPEC)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18435
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein/permease
Location 4045946 - 4047655 (strand: -1)
Length 1710 (nucleotides) / 569 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2310
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF06472 ABC transporter transmembrane region 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4178 General function prediction only (R) R ABC-type uncharacterized transport system, permease and ATPase components

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02471 vitamin B12/bleomycin/antimicrobial peptide transport system ATP-binding/permease protein ABC transporters -

Protein Sequence

MKTIKQFFYLVSPFWGRRTALYCWFLLILSLTLTLSSVWFNVKMNEWNGSFYNALQQLDGQALYKLLQQFVIIIAGLITVVVMGDFLRQKMIIRWREGMTEQVLERWLSKNSKHYMLRLTSQEPDNPDQRIAEDIRLLIESTMRLTVTFLHSLLTLISFATILWSLSGALSFSLAGKEWNIPGYMFWACIIYTLIGITITQLIGSPLRKINMDKQRKEADYRTALITRKQHGDAIAGQRGEMSDRHELMGRFLGVIRNWNNLIRYERNLAFFTVGYQQATAMAPIIFALPKFLAGELMLGGLMQLRQAFSSVAGALSWFIFSYKEIAAWQATVTRLYHFVVLLEHDHQPEITELDDKQTKLTANLSLFMQDDRLLINNIHFSLKAGELAVIEGSSGIGKSTLLRALSGHWPYFKGDIQRVTNISWLPQRMYLPVARLDSLLAYPCQASQFSQQEYQEVLHWVGLDKIKNQLSLETDWTTRLSGGEQQRLIFARLLLNKPDLILLDETTSALDEQNALHMLLLLKQHLPTSGIVLVSHQRFTHAIAEQVISLQAPTASSSQSAGVTEYVS

Flanking regions ( +/- flanking 50bp)

TTAATGTGAGCAACCGAGTCAATAAACAATAAAAACATGACAAATAAGCAATGAAAACAATAAAACAATTTTTCTATTTGGTTTCACCTTTTTGGGGGCGGCGTACCGCCCTTTACTGCTGGTTCCTATTAATTCTCTCTTTAACGTTAACCCTCTCATCCGTTTGGTTTAACGTCAAAATGAATGAATGGAATGGCAGCTTCTATAACGCCCTACAACAACTCGATGGGCAAGCCTTATATAAACTGCTTCAACAGTTTGTGATTATTATTGCCGGATTAATTACCGTAGTCGTGATGGGTGATTTCTTACGCCAAAAAATGATCATTCGCTGGCGTGAAGGTATGACAGAGCAAGTGCTTGAGCGCTGGCTATCAAAAAATAGTAAACACTATATGTTGCGGTTAACCTCGCAAGAGCCAGACAACCCCGACCAACGAATTGCCGAAGATATTCGTTTACTAATTGAATCGACAATGCGCTTAACAGTGACCTTTTTACATTCACTGTTAACGCTTATCTCTTTTGCCACTATTTTATGGTCACTCTCTGGTGCGCTCTCTTTCTCTTTAGCAGGCAAAGAGTGGAATATACCGGGTTATATGTTCTGGGCCTGTATTATTTATACCCTTATCGGGATCACCATCACCCAGCTCATTGGTTCTCCATTACGTAAAATCAATATGGATAAACAGCGTAAAGAGGCAGATTACCGTACTGCGCTTATCACACGTAAACAACATGGTGATGCTATTGCTGGTCAACGGGGTGAAATGAGCGATCGTCATGAACTGATGGGACGCTTTTTAGGGGTGATCCGCAACTGGAATAACCTTATCCGTTATGAAAGAAACCTTGCTTTCTTTACTGTGGGTTATCAGCAAGCCACGGCAATGGCGCCAATTATTTTTGCTTTGCCAAAATTCCTCGCCGGCGAATTAATGCTAGGGGGATTAATGCAGTTACGACAAGCCTTCTCCAGTGTTGCTGGGGCATTAAGCTGGTTTATTTTCTCCTATAAAGAGATTGCCGCATGGCAGGCAACGGTTACCCGTCTTTATCATTTTGTGGTGTTGTTAGAGCATGATCACCAACCTGAGATCACCGAGTTAGATGATAAACAAACTAAGCTGACAGCCAATTTATCGCTATTTATGCAAGACGATAGATTATTAATTAACAATATTCACTTTTCTCTCAAAGCGGGTGAATTGGCGGTAATTGAAGGTAGCTCAGGTATCGGGAAATCAACACTGTTACGTGCGTTAAGCGGCCACTGGCCTTATTTTAAAGGAGATATTCAACGGGTAACCAATATCAGTTGGCTCCCACAACGTATGTATCTGCCTGTTGCCCGCTTAGATAGCTTATTGGCTTATCCTTGCCAAGCATCTCAGTTCTCACAACAAGAGTACCAAGAAGTGCTTCATTGGGTGGGGCTAGATAAAATAAAAAATCAGCTTTCACTGGAAACAGATTGGACAACACGCTTATCCGGTGGTGAACAACAACGTCTTATCTTTGCCCGTTTATTACTCAATAAACCCGATCTTATTTTATTAGATGAAACCACATCCGCTCTTGATGAACAAAATGCCCTACATATGTTGTTATTACTTAAACAGCATCTACCAACCTCGGGCATTGTCTTAGTCAGTCATCAGCGTTTCACTCACGCTATTGCCGAGCAAGTAATTTCATTACAAGCGCCGACTGCGTCCTCCTCTCAATCAGCTGGAGTTACTGAATATGTATCGTAAGTTACTGATTATCTCAGTCAGTTTATCACTTCTGGGTTGTGCAACAGGCA