Homologs in group_2342

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17735 FBDBKF_17735 100.0 Morganella morganii S1 yddA ABC-type uncharacterized transport system, permease and ATPase components
NLDBIP_10140 NLDBIP_10140 100.0 Morganella morganii S4 yddA ABC-type uncharacterized transport system, permease and ATPase components
LHKJJB_07615 LHKJJB_07615 100.0 Morganella morganii S3 yddA ABC-type uncharacterized transport system, permease and ATPase components
HKOGLL_07165 HKOGLL_07165 100.0 Morganella morganii S5 yddA ABC-type uncharacterized transport system, permease and ATPase components
F4V73_RS15225 F4V73_RS15225 89.0 Morganella psychrotolerans - ABC transporter ATP-binding protein/permease
PMI_RS18435 PMI_RS18435 65.4 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein/permease

Distribution of the homologs in the orthogroup group_2342

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2342

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31826 4.57e-118 363 35 3 551 1 yddA Inner membrane ABC transporter ATP-binding protein YddA Escherichia coli (strain K12)
Q57335 9.76e-81 267 30 6 542 3 HI_0036 Uncharacterized ABC transporter ATP-binding protein HI_0036 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQI9 2.3e-73 249 32 10 536 1 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI8 2.3e-73 249 32 10 536 3 bacA Hydrophilic compounds import ATP-binding/permease protein BacA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45221 4.08e-72 244 28 7 553 3 HI_1467 Uncharacterized ABC transporter ATP-binding protein HI_1467 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6NLC1 6.34e-65 228 27 13 633 1 ABCC2 ABC transporter D family member 2, chloroplastic Arabidopsis thaliana
Q55774 8.03e-63 221 32 8 471 3 sll0182 Uncharacterized ABC transporter ATP-binding protein sll0182 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q94FB9 2.3e-29 127 24 17 556 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
Q94FB9 1.57e-18 93 22 13 548 1 ABCD1 ABC transporter D family member 1 Arabidopsis thaliana
O89016 1.85e-27 120 24 21 594 1 Abcd4 Lysosomal cobalamin transporter ABCD4 Mus musculus
Q8T8P3 1.01e-26 118 23 14 575 3 abcD2 ABC transporter D family member 2 Dictyostelium discoideum
O14678 5.47e-25 112 23 14 512 1 ABCD4 Lysosomal cobalamin transporter ABCD4 Homo sapiens
P55096 9.91e-24 109 23 24 578 1 Abcd3 ATP-binding cassette sub-family D member 3 Mus musculus
P16970 3.08e-23 107 23 20 529 1 Abcd3 ATP-binding cassette sub-family D member 3 Rattus norvegicus
Q61285 5.2e-23 107 22 17 571 1 Abcd2 ATP-binding cassette sub-family D member 2 Mus musculus
Q9QY44 9.77e-23 106 22 18 572 1 Abcd2 ATP-binding cassette sub-family D member 2 Rattus norvegicus
P28288 1.08e-22 105 23 20 529 1 ABCD3 ATP-binding cassette sub-family D member 3 Homo sapiens
Q9UBJ2 2.78e-22 104 22 17 570 1 ABCD2 ATP-binding cassette sub-family D member 2 Homo sapiens
F1RBC8 3.86e-21 101 24 23 575 2 abcd1 ATP-binding cassette sub-family D member 1 Danio rerio
Q54W19 2e-20 99 25 13 358 3 abcD1 ABC transporter D family member 1 Dictyostelium discoideum
P33897 3.27e-19 95 27 8 250 1 ABCD1 ATP-binding cassette sub-family D member 1 Homo sapiens
Q7JUN3 3.62e-19 95 23 18 500 2 Abcd1 ATP-binding cassette sub-family D member 1 Drosophila melanogaster
Q68W42 4.15e-19 94 29 5 213 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1GL85 4.88e-19 90 34 8 197 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
A0LCH8 5.16e-19 90 35 9 224 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9ZCM8 8.22e-19 93 28 5 213 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
B5X0E4 1.42e-18 93 28 8 286 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 6.2e-08 59 27 5 199 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q54W20 2.36e-18 92 34 4 156 3 abcD3 ABC transporter D family member 3 Dictyostelium discoideum
Q4UMZ3 3.46e-18 91 28 4 206 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P48410 6.77e-18 91 26 8 250 1 Abcd1 ATP-binding cassette sub-family D member 1 Mus musculus
Q5E6M2 1.42e-17 86 31 8 206 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4L8L7 1.87e-17 85 30 6 197 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
D3ZHR2 1.92e-17 89 26 8 250 1 Abcd1 ATP-binding cassette sub-family D member 1 Rattus norvegicus
Q9X2W0 2.16e-17 89 30 6 211 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
Q92GP9 2.22e-17 89 28 4 198 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P0AFY6 3.23e-17 87 23 9 339 1 sbmA Peptide antibiotic transporter SbmA Escherichia coli (strain K12)
P0AFY7 3.23e-17 87 23 9 339 3 sbmA Peptide antibiotic transporter SbmA Escherichia coli O157:H7
P45861 3.63e-17 88 31 4 202 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q3IWB5 5.45e-17 84 35 7 190 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6D4E2 5.77e-17 86 34 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P23886 5.81e-17 87 35 4 181 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q08120 6.59e-17 86 23 6 326 3 bacA Bacteroid development protein BacA Rhizobium meliloti (strain 1021)
Q2SIN5 6.71e-17 87 29 3 227 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q8DQH4 9.02e-17 83 33 7 203 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM82 9.02e-17 83 33 7 203 1 ftsE Cell division ATP-binding protein FtsE Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1R155 2.22e-16 82 33 6 193 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2G2M9 2.29e-16 85 25 10 374 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 2.29e-16 85 25 10 374 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 2.29e-16 85 25 10 374 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 2.29e-16 85 25 10 374 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 2.29e-16 85 25 10 374 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 2.29e-16 85 25 10 374 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 2.29e-16 85 25 10 374 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 2.29e-16 85 25 10 374 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q87RE5 2.39e-16 82 30 7 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2YU20 2.68e-16 85 26 16 378 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
A1B9K8 3.05e-16 82 33 7 200 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q13VD7 3.21e-16 83 36 5 199 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q7MMN0 3.67e-16 82 29 6 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 3.67e-16 82 29 6 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q160Y9 4.36e-16 81 32 7 196 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LUR8 5.4e-16 81 33 8 200 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q66AT7 7.01e-16 81 33 9 200 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6FFL0 7.9e-16 81 32 9 202 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1CJG3 8.08e-16 80 33 9 200 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 8.08e-16 80 33 9 200 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 8.08e-16 80 33 9 200 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9KQB8 8.87e-16 80 31 7 206 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P41909 1.4e-15 84 29 6 194 1 PXA1 Peroxisomal long-chain fatty acid import protein 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8T9W2 1.41e-15 83 26 10 330 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
P77279 1.42e-15 79 33 7 211 1 fetA Probable iron export ATP-binding protein FetA Escherichia coli (strain K12)
Q9Z3R9 1.71e-15 81 32 6 198 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q82B58 1.85e-15 83 33 9 221 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82B58 1.69e-05 51 30 8 197 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q21PQ7 2e-15 80 30 8 195 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P47705 2.35e-15 80 32 4 194 3 MG467 Putative ABC transporter ATP-binding protein MG467 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q89AJ0 2.93e-15 79 30 7 199 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7MKU3 3.08e-15 81 33 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 3.08e-15 81 33 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8YK28 3.37e-15 79 33 7 219 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q87PH3 3.69e-15 80 33 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1JRI2 4.22e-15 79 33 8 199 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O34946 4.35e-15 78 29 7 203 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q6LTB1 4.37e-15 79 29 6 195 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q5ZWE4 4.47e-15 80 33 8 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6BXD7 4.59e-15 82 33 7 203 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9KS33 4.68e-15 80 33 8 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7RX59 4.7e-15 82 26 11 342 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q884D4 4.75e-15 82 32 6 201 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2ULH4 4.97e-15 82 24 13 429 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q32HA3 5.72e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32EY4 7.56e-15 80 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 7.66e-15 78 33 8 198 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 7.66e-15 78 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q6G2E2 8.06e-15 79 31 10 213 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5X627 8.08e-15 79 34 8 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q9CP06 8.19e-15 79 34 8 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q8FVT0 8.39e-15 79 32 8 196 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q4KJB2 8.6e-15 80 23 21 587 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P45081 8.63e-15 80 28 6 221 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1I7I9 8.81e-15 81 32 7 201 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas entomophila (strain L48)
Q5PMK1 9.15e-15 79 32 8 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q3Z2Z3 9.23e-15 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 9.23e-15 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q2YKZ7 9.27e-15 79 32 8 196 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 9.27e-15 79 32 8 196 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8Z7H7 9.57e-15 79 32 8 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
P40790 1e-14 79 32 8 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1e-14 79 32 8 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q1RD28 1.06e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.06e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 1.1e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.1e-14 79 32 7 198 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.1e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.1e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.1e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1DDP4 1.17e-14 79 36 6 183 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
O34677 1.2e-14 77 29 6 198 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q2SPI3 1.24e-14 77 32 8 198 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2M3G0 1.26e-14 81 28 7 242 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 6.85e-07 56 25 4 199 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q8XXB6 1.27e-14 80 29 4 202 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P9WQK1 1.4e-14 77 29 5 205 1 Rv0986 Uncharacterized ABC transporter ATP-binding protein Rv0986 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK0 1.4e-14 77 29 5 205 3 MT1014 Uncharacterized ABC transporter ATP-binding protein MT1014 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q83KR7 1.47e-14 77 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.47e-14 77 33 8 198 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q88R93 1.52e-14 77 35 6 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8Z5W6 1.55e-14 77 33 7 201 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q5WXF0 1.58e-14 79 33 8 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q0T5R2 1.66e-14 79 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q5PIA5 1.79e-14 77 33 7 201 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.79e-14 77 33 7 201 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
O53645 1.8e-14 80 31 4 203 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 1.51e-09 64 29 4 195 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q39IE7 1.89e-14 78 33 7 205 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1KF14 1.96e-14 80 31 4 203 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 1.62e-09 64 29 4 195 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P78966 2.09e-14 80 32 6 203 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 7.62e-06 52 30 5 179 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9LVM1 2.11e-14 80 24 11 343 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q0S0X2 2.12e-14 77 36 3 143 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
O85818 2.16e-14 78 34 8 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q2HIE9 2.37e-14 79 25 8 319 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q73P93 2.49e-14 79 30 8 200 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 0.000388 47 27 5 188 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q0I3Y9 2.57e-14 78 32 7 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q6D4A8 2.7e-14 76 32 9 200 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92NU9 2.72e-14 79 32 7 198 3 macB Macrolide export ATP-binding/permease protein MacB Rhizobium meliloti (strain 1021)
Q48KB2 2.78e-14 79 33 7 202 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
H2LNR5 2.97e-14 79 27 8 294 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q9WXX8 3.08e-14 75 30 4 178 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88F88 3.48e-14 79 32 7 201 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1RJ91 3.54e-14 79 27 4 205 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
P21441 3.69e-14 79 31 3 183 3 PGPA Multidrug resistance protein Leishmania tarentolae
Q8NSN2 3.74e-14 77 30 6 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
F9X9V4 3.82e-14 79 30 4 186 3 MYCGRDRAFT_41235 ABC-type transporter MYCGRDRAFT_41235 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q4ZV10 3.98e-14 79 31 6 201 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas syringae pv. syringae (strain B728a)
Q21XJ9 4.13e-14 76 35 6 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q046T0 4.23e-14 75 32 8 207 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P54537 4.49e-14 75 28 5 198 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q9Z8Q8 4.63e-14 77 34 7 189 3 metN Methionine import ATP-binding protein MetN Chlamydia pneumoniae
Q0BH79 4.76e-14 77 33 7 205 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q7NWX3 5.55e-14 77 34 7 196 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5E0F2 6.18e-14 78 26 4 233 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9PEE7 6.54e-14 78 26 11 338 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q3A9G5 7.43e-14 76 30 7 213 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q74LQ3 7.61e-14 75 32 8 207 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q1BY14 7.65e-14 76 34 5 199 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 7.65e-14 76 34 5 199 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
A0KPH6 7.9e-14 75 33 6 177 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q0P9C4 8.48e-14 77 23 5 248 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q87EF0 8.66e-14 77 26 11 338 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P55122 8.72e-14 78 25 18 454 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
Q8ZNV7 9.02e-14 74 32 7 201 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4K9A4 9.87e-14 77 31 7 201 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6GE75 9.92e-14 73 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q65UE1 1.1e-13 76 34 8 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0A9E2 1.14e-13 74 32 6 193 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1IGL4 1.14e-13 75 35 6 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q8KZQ6 1.21e-13 74 34 6 190 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q9NRK6 1.23e-13 77 26 8 334 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q73EL7 1.23e-13 75 30 5 209 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
P75110 1.25e-13 75 32 5 195 3 MPN_683 Putative ABC transporter ATP-binding protein MG467 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q28VN1 1.28e-13 74 30 7 194 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q4QK57 1.33e-13 76 32 9 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q9V1Q4 1.36e-13 74 32 8 203 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
Q8RY46 1.38e-13 77 30 5 203 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q5FMM1 1.4e-13 74 30 7 207 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q3KF57 1.47e-13 77 30 6 201 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain Pf0-1)
Q9I190 1.5e-13 77 31 6 198 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02MI4 1.5e-13 77 31 6 198 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain UCBPP-PA14)
Q81ZF5 1.55e-13 75 30 5 209 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6HP89 1.57e-13 75 30 5 209 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q5H0H0 1.69e-13 77 25 6 309 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.69e-13 77 25 6 309 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2LVL0 1.74e-13 77 28 3 197 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q4WLN7 1.74e-13 77 24 14 442 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8P8W4 1.76e-13 77 26 9 336 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 1.76e-13 77 26 9 336 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q7VNG4 1.77e-13 75 32 7 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q21XK2 1.82e-13 75 33 5 202 3 metN Methionine import ATP-binding protein MetN Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q3KJ31 2.01e-13 76 27 10 320 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
Q63GR8 2.11e-13 75 30 5 209 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8REG7 2.17e-13 73 27 9 215 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2YZ26 2.31e-13 73 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
E7F6F7 2.31e-13 76 26 8 294 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q3BTC8 2.5e-13 76 26 9 336 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PKS5 2.7e-13 76 26 9 336 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
P40416 2.97e-13 76 26 10 319 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q03ZQ0 3.04e-13 75 34 7 187 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8KFE9 3.04e-13 76 32 8 200 3 macB Macrolide export ATP-binding/permease protein MacB Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q6FIK3 3.06e-13 76 24 10 319 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9FUT3 3.09e-13 76 24 12 343 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q5P6D5 3.25e-13 76 31 6 196 3 macB Macrolide export ATP-binding/permease protein MacB Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6LR20 3.36e-13 74 32 7 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
P45171 3.55e-13 74 33 8 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
S3D778 3.56e-13 76 24 7 261 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 1.98e-05 51 28 5 151 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q8FRX8 3.83e-13 74 30 6 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9M0G9 3.95e-13 75 29 6 204 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q7ULB5 4.01e-13 75 32 6 199 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q0A8P9 4.04e-13 72 31 5 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7N545 4.08e-13 73 31 8 200 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9A502 4.18e-13 74 31 7 207 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9LZJ5 4.32e-13 76 28 5 189 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 7.1e-08 59 22 7 274 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q82VK1 4.43e-13 75 30 6 197 3 macB Macrolide export ATP-binding/permease protein MacB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7AKE5 4.47e-13 75 34 5 193 2 ramB ABC transporter ATP-binding protein RamB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q1M7A6 4.74e-13 72 34 6 186 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K4V4 4.81e-13 74 30 5 198 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q704E8 4.84e-13 75 26 6 306 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q65VG9 5.24e-13 73 33 6 183 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q46ZU5 5.25e-13 73 35 7 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2SY12 5.49e-13 73 34 6 199 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q31VE6 5.7e-13 72 32 8 208 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
A0A0S6XH62 5.74e-13 75 28 7 276 1 frbG ABC-type transporter frbG Fungal sp. (strain No.11243)
A0A0S6XH62 8.7e-05 49 26 5 199 1 frbG ABC-type transporter frbG Fungal sp. (strain No.11243)
P97046 5.8e-13 75 27 9 274 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
Q0I4C5 5.92e-13 75 25 5 292 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
P21440 6.39e-13 75 27 5 201 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 7.35e-10 65 29 5 195 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q61102 6.91e-13 75 30 5 214 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q6C6N0 6.94e-13 75 25 11 348 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6N798 7.04e-13 73 31 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q58903 7.3e-13 71 28 6 203 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1R5D8 7.61e-13 72 32 8 210 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 7.61e-13 72 32 8 210 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 7.61e-13 72 32 8 210 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0DKX5 7.72e-13 75 27 5 223 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P33594 7.82e-13 72 32 8 208 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q5NQX0 7.83e-13 71 34 6 183 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q81IN8 7.85e-13 73 30 5 209 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7A3X3 7.98e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 7.98e-13 71 28 5 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8UBB7 7.99e-13 73 31 6 199 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3YW48 8.12e-13 72 32 8 208 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q5FA19 8.13e-13 73 32 6 203 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P0DKX6 8.35e-13 75 27 5 223 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q50966 8.58e-13 73 31 7 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q8NV47 8.61e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 8.61e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 8.61e-13 71 28 5 203 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 8.61e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 8.61e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 8.61e-13 71 28 5 203 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q9KXJ6 8.71e-13 74 30 9 217 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0RT43 8.71e-13 72 33 7 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q9CHL8 9.97e-13 74 27 9 273 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
Q4W575 1.01e-12 73 33 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.01e-12 73 33 6 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5B1Q2 1.03e-12 74 24 6 294 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0I4A9 1.04e-12 72 31 8 197 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q4KC87 1.04e-12 73 35 7 184 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q87UI3 1.04e-12 72 33 5 177 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7VR44 1.06e-12 74 27 4 197 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q32EX7 1.08e-12 71 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q8U8D6 1.11e-12 72 33 5 175 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5E586 1.17e-12 73 31 7 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1QBW0 1.22e-12 74 29 5 222 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q13LD8 1.22e-12 73 33 7 197 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q8X4L6 1.27e-12 71 32 8 208 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q9LYS2 1.28e-12 74 31 5 186 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q32AQ1 1.29e-12 71 32 8 208 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
P75957 1.3e-12 71 34 6 188 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q08201 1.34e-12 74 27 4 201 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 5.58e-10 66 29 5 195 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
P39456 1.35e-12 71 30 8 206 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
P54933 1.37e-12 72 33 8 196 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q54P13 1.42e-12 74 23 9 288 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 1.79e-05 51 23 4 196 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q39GW5 1.51e-12 72 36 6 176 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O14286 1.55e-12 73 23 9 320 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59479 1.56e-12 71 31 8 202 3 PH1815 Putative ABC transporter ATP-binding protein PH1815 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q03PF2 1.58e-12 72 35 9 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6F0V4 1.62e-12 72 32 7 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q9LSJ6 1.65e-12 74 27 4 200 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 3.85e-06 53 26 7 203 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
P37608 1.65e-12 73 21 11 385 3 lcnDR3 Lacticin-481/lactococcin-DR transport/processing ATP-binding protein lcnDR3 Lactococcus lactis subsp. lactis
P33116 1.72e-12 73 24 7 305 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
Q03203 1.73e-12 73 23 11 335 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q8LGU1 1.74e-12 74 26 4 199 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 2.65e-07 57 26 6 200 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q4FS42 1.77e-12 73 29 5 214 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1WSB9 1.78e-12 71 27 6 226 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q9X0Y8 1.8e-12 70 30 6 188 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8RQL7 1.83e-12 70 30 7 205 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
G5EFD4 1.85e-12 73 28 3 194 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q1LNM0 1.97e-12 71 34 4 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1BWL4 2.01e-12 72 34 5 176 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 2.01e-12 72 34 5 176 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q0SK28 2.06e-12 70 34 8 200 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q8FV85 2.3e-12 72 34 9 202 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.3e-12 72 34 9 202 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.3e-12 72 34 9 202 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.3e-12 72 34 9 202 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q2SZW0 2.43e-12 73 32 6 202 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P71082 2.63e-12 73 24 15 405 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
Q88ZJ6 2.7e-12 72 33 9 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6LN52 2.87e-12 71 32 4 182 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q8ELQ6 2.99e-12 71 29 6 200 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2UPC0 3.17e-12 73 27 4 225 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q1BG75 3.44e-12 70 32 2 161 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 3.44e-12 70 32 2 161 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q0BFQ0 3.45e-12 71 33 5 185 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2K1C8 3.46e-12 71 30 6 196 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2IBA1 3.48e-12 73 25 11 304 3 CFTR Cystic fibrosis transmembrane conductance regulator Chlorocebus aethiops
Q2IBA1 7.53e-05 49 22 4 184 3 CFTR Cystic fibrosis transmembrane conductance regulator Chlorocebus aethiops
P23174 3.53e-12 73 26 4 201 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 3.92e-10 66 29 5 195 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q4JTG9 3.55e-12 71 30 6 202 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q7N6C6 3.61e-12 72 28 3 196 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0AGF4 3.69e-12 71 31 8 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8FW07 3.8e-12 71 32 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 3.8e-12 71 32 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q31ZH4 3.91e-12 69 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q00564 3.97e-12 72 29 8 206 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
P0A4W5 4.09e-12 72 26 9 337 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 4.09e-12 72 26 9 337 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7NQN5 4.16e-12 71 33 8 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2YKR8 4.2e-12 71 32 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q5LX21 4.32e-12 71 31 5 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9NP58 4.32e-12 72 28 3 212 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q5KVK2 4.53e-12 71 31 6 199 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
P97998 4.58e-12 72 26 16 359 3 MDL1 ATP-dependent permease MDL1 Candida albicans
P9WQJ0 4.66e-12 72 26 9 337 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P57552 4.68e-12 72 27 4 199 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A0A0D1CZ63 4.87e-12 72 33 3 150 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1CZ63 1.38e-08 61 24 5 259 2 fer6 Multidrug resistance protein fer6 Ustilago maydis (strain 521 / FGSC 9021)
Q3Z300 4.9e-12 69 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 4.9e-12 69 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 4.9e-12 69 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 4.9e-12 69 34 6 188 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q830W6 5.08e-12 71 31 9 194 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
P21439 5.12e-12 72 26 4 208 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 1.8e-09 64 28 5 195 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q9CMG7 5.22e-12 72 28 5 198 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
A0A125QXJ1 5.27e-12 72 28 3 212 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
O57872 5.36e-12 69 27 7 203 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q02QT1 5.54e-12 70 35 6 191 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8XZQ4 5.55e-12 70 34 5 185 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3M4H5 5.61e-12 69 29 5 202 3 pstB5 Phosphate import ATP-binding protein PstB 5 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A1TXH7 5.85e-12 71 32 8 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8TSC8 6.13e-12 72 29 7 204 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 1.12e-07 58 28 8 202 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6MCV4 6.18e-12 70 31 7 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
A0A059JK44 6.2e-12 72 30 5 197 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 0.00012 48 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
O07550 6.24e-12 72 25 6 232 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
Q8YYE2 6.28e-12 69 29 5 202 3 pstB2 Phosphate import ATP-binding protein PstB 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
F2Q5G0 6.31e-12 72 30 5 197 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 0.00012 48 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P0CU83 6.4e-12 72 30 5 197 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 0.000181 48 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P96063 6.9e-12 70 31 5 184 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2S3A3 6.99e-12 69 32 7 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
F2RPA4 7.1e-12 72 30 5 197 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 0.000132 48 34 2 73 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q325N3 7.2e-12 69 31 5 182 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
O06967 7.29e-12 71 25 6 274 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
Q83LP0 7.4e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q32E34 7.47e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 7.47e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
Q1RDU4 7.47e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
P60752 7.47e-12 71 28 3 196 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
Q8FJB1 7.47e-12 71 28 3 196 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 7.47e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P60753 7.47e-12 71 28 3 196 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q54V86 7.92e-12 72 28 4 183 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 3.82e-06 53 25 5 187 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q82CD3 7.94e-12 68 36 6 172 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q3Z3K7 8.01e-12 71 28 3 196 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
Q8G5P8 8.42e-12 70 29 6 203 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q5PGH0 8.44e-12 71 28 3 195 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P59852 8.65e-12 71 28 6 199 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
P44785 8.83e-12 70 30 5 194 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9TSP5 8.91e-12 72 25 11 304 3 CFTR Cystic fibrosis transmembrane conductance regulator Papio anubis
Q9TSP5 3.83e-05 50 22 4 184 3 CFTR Cystic fibrosis transmembrane conductance regulator Papio anubis
Q9TUQ2 9.14e-12 72 25 11 304 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca nemestrina
Q9TUQ2 3.93e-05 50 22 4 184 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca nemestrina
O75027 9.18e-12 71 29 4 199 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q1MCN6 9.28e-12 70 29 5 196 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q57243 9.31e-12 68 27 6 190 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SZJ3 9.4e-12 69 32 8 208 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q8X5I6 9.53e-12 68 30 5 182 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q72FW5 9.56e-12 70 32 10 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q12C33 9.64e-12 71 31 5 203 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8NQU4 9.66e-12 68 31 11 211 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q00553 9.79e-12 72 25 11 304 2 CFTR Cystic fibrosis transmembrane conductance regulator Macaca mulatta
Q00553 3.93e-05 50 22 4 184 2 CFTR Cystic fibrosis transmembrane conductance regulator Macaca mulatta
Q7JII7 9.79e-12 72 25 11 304 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fuscata fuscata
Q7JII7 3.93e-05 50 22 4 184 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fuscata fuscata
Q7JII8 9.79e-12 72 25 11 304 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fascicularis
Q7JII8 3.93e-05 50 22 4 184 3 CFTR Cystic fibrosis transmembrane conductance regulator Macaca fascicularis
Q48KI4 9.92e-12 68 31 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9KL04 9.95e-12 70 32 6 191 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q2JGF5 9.96e-12 69 33 6 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q2SXD1 9.98e-12 68 30 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q83J77 1e-11 68 32 8 208 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q5WCI1 1.01e-11 68 31 5 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
O70595 1.02e-11 71 28 3 212 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
Q4QMH4 1.04e-11 70 30 6 202 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q1BUV6 1.07e-11 71 30 4 198 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
Q8YCB1 1.07e-11 70 31 5 197 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63359 1.08e-11 71 28 3 195 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 1.08e-11 71 28 3 195 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 1.08e-11 71 28 3 195 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q4HVU7 1.08e-11 71 24 7 296 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q38WL5 1.08e-11 70 31 4 182 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q10418 1.16e-11 71 27 5 196 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
O28912 1.19e-11 68 28 5 198 3 pstB Phosphate import ATP-binding protein PstB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q5YTW4 1.2e-11 68 35 9 209 3 phnC Phosphonates import ATP-binding protein PhnC Nocardia farcinica (strain IFM 10152)
Q67SV5 1.21e-11 69 32 4 207 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9QYM0 1.22e-11 71 29 5 188 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 2.48e-11 70 27 11 283 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q48IB9 1.24e-11 68 33 7 193 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q82MV1 1.24e-11 68 32 4 173 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q4ZV73 1.28e-11 68 31 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q54VJ0 1.28e-11 71 29 6 192 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 2.86e-06 54 23 4 184 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q5PKZ8 1.28e-11 70 30 8 194 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9SYI3 1.33e-11 71 28 7 230 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 2.3e-08 60 24 8 295 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q83RS0 1.33e-11 68 32 6 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q4ZZS2 1.33e-11 68 31 9 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q83F44 1.39e-11 69 29 6 198 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q4WSI1 1.4e-11 71 30 7 200 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 3.29e-05 50 25 8 213 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P61482 1.42e-11 68 33 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.42e-11 68 33 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.42e-11 68 33 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P9WQI3 1.43e-11 70 29 5 198 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 1.43e-11 70 29 5 198 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q63VX7 1.44e-11 70 28 4 201 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 1.44e-11 70 28 4 201 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 1.44e-11 70 28 4 201 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
A0A1U9YI12 1.5e-11 71 29 5 206 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 5.74e-11 69 27 5 204 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q9C8G9 1.55e-11 71 27 6 185 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q98DT6 1.57e-11 68 30 6 197 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1GZI0 1.6e-11 70 26 13 334 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P06795 1.65e-11 71 27 4 201 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 3.05e-08 60 28 5 192 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q1QX69 1.66e-11 70 28 4 203 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8A883 1.7e-11 70 28 8 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6LPK6 1.72e-11 70 30 5 197 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q03P57 1.73e-11 69 29 6 184 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q6MU19 1.74e-11 69 27 8 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q08D64 1.75e-11 70 25 8 283 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q1M589 1.75e-11 69 29 6 196 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9R1X5 1.76e-11 71 29 5 188 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 5.44e-11 69 27 11 283 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
O34814 1.79e-11 67 26 6 206 1 ftsE Cell division ATP-binding protein FtsE Bacillus subtilis (strain 168)
Q87R16 1.88e-11 70 28 6 207 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2NIT5 1.89e-11 68 25 4 198 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Aster yellows witches'-broom phytoplasma (strain AYWB)
Q57SD6 1.91e-11 69 30 5 184 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q1MQ44 1.96e-11 69 31 10 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q9HT73 1.96e-11 68 31 7 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.96e-11 68 31 7 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q39E73 1.96e-11 70 30 4 198 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1BE50 1.97e-11 70 28 5 195 3 macB Macrolide export ATP-binding/permease protein MacB Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
P21447 1.98e-11 70 27 4 199 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 3.39e-08 60 28 5 192 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
Q01937 1.99e-11 69 30 6 191 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q884I3 2.01e-11 67 30 4 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3Z542 2.03e-11 68 30 5 182 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 2.03e-11 68 30 5 182 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q2SSS4 2.08e-11 69 27 8 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8NR42 2.17e-11 67 34 3 143 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8Z8W8 2.18e-11 69 30 5 184 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q9HYG4 2.21e-11 68 34 6 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1B9Q7 2.21e-11 69 30 6 210 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
A3PRY1 2.23e-11 68 32 7 199 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q7DM58 2.23e-11 70 26 4 187 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 2.83e-07 57 23 6 217 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q18KE1 2.26e-11 68 33 8 204 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q5PFQ7 2.32e-11 69 30 5 184 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6Q876 2.32e-11 70 29 5 217 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 8.63e-10 65 30 7 208 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q66FK0 2.34e-11 68 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 2.34e-11 68 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 2.34e-11 68 35 6 168 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 2.34e-11 68 35 6 168 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q2SE49 2.36e-11 67 29 4 194 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Hahella chejuensis (strain KCTC 2396)
Q04CG8 2.37e-11 67 29 7 208 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q5LBT4 2.37e-11 69 28 8 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q7CJG3 2.41e-11 70 29 7 201 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q1C5W7 2.41e-11 70 29 7 201 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CJW8 2.41e-11 70 29 7 201 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q57QD7 2.45e-11 67 32 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q981Y8 2.46e-11 67 36 5 177 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q63SP4 2.52e-11 67 31 6 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 2.52e-11 67 31 6 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
Q64SQ6 2.52e-11 69 28 8 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q668L6 2.52e-11 70 29 7 201 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q751N2 2.53e-11 70 24 9 322 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A0R6H7 2.53e-11 70 31 4 195 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0VQP5 2.53e-11 70 24 10 349 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2SJY7 2.55e-11 68 32 6 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q92WD6 2.6e-11 68 32 8 195 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q54BU4 2.62e-11 70 26 4 197 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q7NZU6 2.65e-11 70 23 15 514 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q59R09 2.66e-11 70 30 6 203 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q1GC08 2.75e-11 67 29 7 208 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q32IZ6 2.76e-11 67 30 5 182 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q035E0 2.89e-11 67 27 6 232 3 phnC Phosphonates import ATP-binding protein PhnC Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q881U6 2.91e-11 67 33 7 193 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HLN4 2.92e-11 67 28 7 205 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6N9W0 2.98e-11 68 30 10 252 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q92887 3.03e-11 70 27 5 192 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q8PVG9 3.06e-11 69 26 6 202 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1GB17 3.07e-11 68 30 6 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q07LQ4 3.13e-11 67 34 5 176 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
B2KWH4 3.15e-11 70 28 4 195 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 6.03e-07 56 36 0 72 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q9LZB8 3.23e-11 69 27 9 304 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_09760
Feature type CDS
Gene yddA
Product ABC-type uncharacterized transport system, permease and ATPase components
Location 185016 - 186716 (strand: 1)
Length 1701 (nucleotides) / 566 (amino acids)
In genomic island -

Contig

Accession ZDB_218
Length 215957 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2342
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF06472 ABC transporter transmembrane region 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4178 General function prediction only (R) R ABC-type uncharacterized transport system, permease and ATPase components

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02471 vitamin B12/bleomycin/antimicrobial peptide transport system ATP-binding/permease protein ABC transporters -

Protein Sequence

MKTIKQFFWLVKPFWGRRAALFCWFLLLLSLGLTLSSVWFNIRMNQWNGDFYNALQKLDGAALYQLIKFFVVLVSGLILVVVLGTYFRQKLAIRWREGMTEQILSRWLSPQSRHYLLRLTAREPDNPDQRIAEDVRLLVESTLSLLITFLHSLLTLISFAAILWQLSGSILLSVAGTDWRIDGYMFWACIAYTLVGIALTQLIGGPLRKLNMEKQQREADYRAALITRRQHGDAIAGQRGELQDKQQLLARFARVAANWNQLIRCERNLSFYTVGYQQVTALAPILFALPKFLAGELMLGGLMQLRQAFSSVATSLGWFIFAYKEIAAWQATVTRLYHFVRLLENDAVSDVTETRQSAVRLDVCADILLPDNRPLLENVSLSLHAGEFAIISGRSGLGKSTLLRTLSGHWPYYRGNISREQDVMWVPQSLYLPSGTLKSLLAYPHTAAQFTPEAYREVLDATGLAALTPQLDTDADWRQRLSGGEQQRLLIARLLLSQPKLMLLDEITSALDDDNAVRMIRLLRQRLPDSTLLLVSHQRFLQQEADRVIALSAPAATCTSGVRYAL

Flanking regions ( +/- flanking 50bp)

ATTTTTAATCTGAGCATGTGAGCAATGCTTCTTAACGTTATGAATAATCAATGAAAACAATAAAACAATTTTTCTGGCTGGTGAAGCCGTTCTGGGGGCGGCGTGCCGCCCTGTTTTGCTGGTTCTTACTGTTGTTGTCTCTCGGGCTGACACTCTCCTCCGTCTGGTTCAATATCCGCATGAACCAGTGGAACGGGGATTTTTATAATGCACTGCAAAAGCTGGACGGCGCGGCGCTGTATCAGCTGATCAAATTTTTCGTCGTGCTGGTCAGCGGGCTGATTCTGGTGGTGGTGCTCGGCACGTATTTCCGGCAGAAACTGGCTATCCGCTGGCGGGAGGGGATGACAGAACAGATCCTCAGCCGCTGGCTGTCGCCGCAGAGCCGCCATTACCTGCTGCGCCTGACCGCCCGCGAGCCGGATAACCCGGATCAGCGGATTGCCGAGGATGTCCGCCTGCTGGTGGAATCCACCCTCAGTCTGCTGATCACCTTCCTGCATTCACTGCTGACCCTGATTTCCTTTGCCGCCATCCTCTGGCAGCTTTCCGGCAGTATTCTGCTCTCTGTCGCCGGTACTGACTGGCGCATCGACGGCTATATGTTCTGGGCCTGTATCGCCTACACCCTCGTGGGTATCGCGCTGACACAGCTTATCGGCGGGCCGCTGCGCAAACTGAATATGGAAAAACAGCAGCGTGAGGCGGATTACCGTGCGGCACTGATCACCCGCAGACAGCACGGCGATGCCATTGCCGGACAGCGGGGGGAGTTACAGGATAAACAGCAATTGCTGGCCCGCTTTGCCCGGGTGGCGGCCAACTGGAATCAGCTGATCCGCTGCGAGCGGAATTTATCCTTTTATACCGTGGGTTATCAGCAGGTGACCGCACTGGCACCGATCCTGTTTGCTCTGCCGAAATTCCTCGCCGGGGAACTGATGCTGGGCGGATTAATGCAGCTGCGTCAGGCCTTCAGCAGTGTTGCGACGTCACTCGGCTGGTTTATTTTTGCCTATAAAGAGATAGCCGCCTGGCAGGCGACGGTAACCCGTCTGTACCATTTCGTCCGTCTGCTGGAAAATGACGCGGTGTCTGATGTCACCGAAACCCGTCAGTCGGCAGTGCGCCTGGATGTTTGCGCCGATATTCTGCTGCCGGATAATCGTCCTCTGCTGGAGAATGTCTCACTCTCTCTGCACGCCGGAGAATTTGCCATTATCAGCGGCCGCTCCGGACTGGGTAAATCCACTCTGCTGCGCACACTCAGCGGTCACTGGCCTTATTACCGGGGCAATATCAGCCGTGAACAGGATGTAATGTGGGTGCCGCAGTCACTTTATCTGCCGTCCGGGACACTGAAATCCCTGCTCGCCTATCCGCATACCGCCGCACAGTTCACGCCGGAGGCTTACCGCGAAGTGCTGGACGCCACCGGGCTTGCTGCACTGACACCACAACTGGATACCGATGCCGACTGGCGTCAGCGCCTGTCCGGCGGTGAACAGCAGCGGTTGCTGATCGCCCGTCTGCTGCTCAGTCAGCCAAAGCTGATGCTGCTCGATGAAATTACCTCCGCACTGGATGATGACAATGCGGTCCGCATGATCCGTCTGCTCCGTCAGCGTCTGCCGGACAGCACGCTTCTGCTGGTCAGCCACCAGCGTTTTCTTCAGCAGGAGGCAGATCGCGTGATCGCCCTGTCCGCCCCTGCCGCCACCTGCACATCAGGAGTCCGATATGCATTATAAACTGACCTTTGCCGGTGTGGTGCTGATCCTCACCGGCTGTACCGCTGTCA