Homologs in group_711

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03085 FBDBKF_03085 65.7 Morganella morganii S1 mtgA monofunctional biosynthetic peptidoglycan transglycosylase
EHELCC_07450 EHELCC_07450 65.7 Morganella morganii S2 mtgA monofunctional biosynthetic peptidoglycan transglycosylase
NLDBIP_07775 NLDBIP_07775 65.7 Morganella morganii S4 mtgA monofunctional biosynthetic peptidoglycan transglycosylase
LHKJJB_07310 LHKJJB_07310 65.7 Morganella morganii S3 mtgA monofunctional biosynthetic peptidoglycan transglycosylase
HKOGLL_03620 HKOGLL_03620 65.7 Morganella morganii S5 mtgA monofunctional biosynthetic peptidoglycan transglycosylase
F4V73_RS11835 F4V73_RS11835 65.2 Morganella psychrotolerans mtgA monofunctional biosynthetic peptidoglycan transglycosylase

Distribution of the homologs in the orthogroup group_711

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_711

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N087 4.62e-116 334 70 0 227 3 mtgA Biosynthetic peptidoglycan transglycosylase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DIR2 1.16e-106 310 62 0 230 3 mtgA Biosynthetic peptidoglycan transglycosylase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q3V7N8 3.43e-103 301 59 0 230 3 mtgA Biosynthetic peptidoglycan transglycosylase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9MNZ9 2.63e-101 296 61 0 230 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AQ99 1.37e-100 295 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1IQR5 8.07e-100 293 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A9N776 9.62e-100 293 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TWH8 1.02e-99 293 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella schwarzengrund (strain CVM19633)
Q8Z3G0 1.04e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella typhi
C0PZM1 1.38e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi C (strain RKS4594)
B5RES4 1.38e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0J9 1.38e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella enteritidis PT4 (strain P125109)
Q57JE2 1.38e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella choleraesuis (strain SC-B67)
Q32BC5 1.41e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella dysenteriae serotype 1 (strain Sd197)
B6I1T1 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain SE11)
P46022 1.52e-99 292 60 0 228 1 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12)
A8A523 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O9:H4 (strain HS)
B1XHI3 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12 / DH10B)
C4ZSU7 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0S6 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O8 (strain IAI1)
A7ZSA7 1.52e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LHS1 1.74e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain 55989 / EAEC)
B7NDJ2 1.79e-99 292 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TJQ1 1.81e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella heidelberg (strain SL476)
Q8ZLR7 1.98e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T739 1.98e-99 292 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella newport (strain SL254)
B5F6X7 3.13e-99 291 63 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella agona (strain SL483)
B5BGN2 5.07e-99 291 62 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi A (strain AKU_12601)
Q3V7K4 5.07e-99 291 62 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B1LGH4 5.66e-99 291 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain SMS-3-5 / SECEC)
B7NKS5 5.66e-99 291 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R6C6 8.67e-99 290 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain UTI89 / UPEC)
Q8FD68 8.67e-99 290 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCQ1 8.67e-99 290 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGA9 8.67e-99 290 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O1:K1 / APEC
B7MBX7 8.67e-99 290 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5FIQ6 2.95e-98 289 62 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella dublin (strain CT_02021853)
B7UJU8 2.98e-98 289 59 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31W84 4.42e-98 288 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella boydii serotype 4 (strain Sb227)
B7N364 4.77e-98 288 59 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O81 (strain ED1a)
B5YSU1 7.23e-98 288 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9I1 7.23e-98 288 60 0 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O157:H7
Q3YX33 4.2e-95 281 61 0 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella sonnei (strain Ss046)
A1JR77 7.82e-95 280 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JL77 1.4e-94 280 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4THK0 1.96e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis (strain Pestoides F)
Q1CE18 1.96e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1R0 1.96e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZB72 1.96e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis
Q1C1G0 1.96e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Antiqua)
Q3V7N9 2.14e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3Y6 2.14e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FDY6 2.19e-94 279 61 0 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7MJD8 1.47e-92 274 59 2 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Cronobacter sakazakii (strain ATCC BAA-894)
Q48465 2.54e-92 274 61 0 231 3 mtgA Biosynthetic peptidoglycan transglycosylase Klebsiella oxytoca
Q65S86 2.28e-81 246 54 1 218 3 mtgA Biosynthetic peptidoglycan transglycosylase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44890 1.41e-79 241 58 1 208 3 mtgA Biosynthetic peptidoglycan transglycosylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNV0 4.05e-77 235 60 1 218 3 mtgA Biosynthetic peptidoglycan transglycosylase Pasteurella multocida (strain Pm70)
A5UDP3 1.1e-74 229 57 0 192 3 mtgA Biosynthetic peptidoglycan transglycosylase Haemophilus influenzae (strain PittEE)
Q88AF9 4.15e-66 207 46 3 227 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3K584 9.33e-66 206 45 3 227 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain Pf0-1)
A4VRK8 1.42e-65 206 49 2 203 3 mtgA Biosynthetic peptidoglycan transglycosylase Stutzerimonas stutzeri (strain A1501)
C3K3M0 2.33e-65 205 49 3 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain SBW25)
Q1QYT5 3.36e-65 204 51 2 197 3 mtgA Biosynthetic peptidoglycan transglycosylase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q4K4C2 4.33e-65 204 46 2 227 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZM52 4.47e-64 202 46 3 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas syringae pv. syringae (strain B728a)
Q8P6V1 1.5e-63 201 45 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RQA5 1.5e-63 201 45 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain B100)
Q4UXB0 1.5e-63 201 45 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain 8004)
Q3V7R3 2.74e-63 200 46 2 210 3 mtgA Biosynthetic peptidoglycan transglycosylase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8PI51 5.9e-63 199 44 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas axonopodis pv. citri (strain 306)
Q88CS3 1.22e-62 198 44 2 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WAE0 1.43e-62 198 44 2 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A4Y001 2.37e-62 197 49 2 203 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas mendocina (strain ymp)
Q48CL6 3.94e-62 197 45 3 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5H1V9 5.26e-62 197 44 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P4R3 5.26e-62 197 44 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9PCR3 6.78e-62 196 44 1 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain 9a5c)
Q8EB02 8.4e-62 196 47 4 234 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0KN61 1.36e-61 196 43 2 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain GB-1)
Q3BQP8 1.5e-61 196 43 1 206 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q87CI7 2.58e-61 195 42 3 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5D0 2.58e-61 195 42 3 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain M23)
B1J2G5 7.43e-61 194 44 2 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain W619)
B0U2V1 1.38e-60 193 42 3 225 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain M12)
Q1IGD6 2e-60 192 44 3 210 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas entomophila (strain L48)
A6VRW7 8.74e-60 191 49 2 196 3 mtgA Biosynthetic peptidoglycan transglycosylase Marinomonas sp. (strain MWYL1)
Q8A8H2 2.6e-58 187 43 2 230 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A0KK53 2.63e-58 187 50 3 201 3 mtgA Biosynthetic peptidoglycan transglycosylase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q07X68 4e-55 179 47 3 196 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella frigidimarina (strain NCIMB 400)
Q9I6B7 1.37e-54 177 40 3 226 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q28VR9 2.39e-54 177 43 3 208 3 mtgA Biosynthetic peptidoglycan transglycosylase Jannaschia sp. (strain CCS1)
Q12Q34 3.83e-54 176 47 2 196 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B8GYX9 2.11e-53 174 45 3 193 3 mtgA Biosynthetic peptidoglycan transglycosylase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9ABA6 2.11e-53 174 45 3 193 3 mtgA Biosynthetic peptidoglycan transglycosylase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3V815 5.35e-52 171 41 2 217 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides fragilis (strain YCH46)
Q3V7G2 5.35e-52 171 41 2 217 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B6IWJ6 7.49e-52 171 44 2 194 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q2RYG3 1.02e-51 170 43 2 212 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q87FR1 2.71e-49 164 41 3 224 3 mtgA Biosynthetic peptidoglycan transglycosylase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q11VI0 7.3e-48 160 43 4 221 3 mtgA Biosynthetic peptidoglycan transglycosylase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A1S3J2 6.24e-47 158 45 4 214 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8UBX8 8.43e-46 155 45 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Agrobacterium fabrum (strain C58 / ATCC 33970)
O24849 3.86e-45 153 41 3 209 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A4G8N2 4.14e-45 153 42 0 188 3 mtgA Biosynthetic peptidoglycan transglycosylase Herminiimonas arsenicoxydans
Q2KUU2 1.69e-44 152 40 4 229 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella avium (strain 197N)
A6T2A4 2e-44 151 42 0 188 3 mtgA Biosynthetic peptidoglycan transglycosylase Janthinobacterium sp. (strain Marseille)
Q8FYT4 8.56e-44 149 40 4 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Brucella suis biovar 1 (strain 1330)
C1D8R6 1.06e-43 149 42 0 166 3 mtgA Biosynthetic peptidoglycan transglycosylase Laribacter hongkongensis (strain HLHK9)
Q8YJ15 1.9e-43 149 40 4 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q7W039 4.49e-42 145 37 2 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3V2 4.49e-42 145 37 2 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF82 4.49e-42 145 37 2 216 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q13ED9 5.5e-42 145 47 2 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain BisB5)
Q7NS41 9.27e-42 144 39 0 188 3 mtgA Biosynthetic peptidoglycan transglycosylase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3SFZ8 1.12e-41 144 38 0 194 3 mtgA Biosynthetic peptidoglycan transglycosylase Thiobacillus denitrificans (strain ATCC 25259)
B0VSQ2 1.53e-41 144 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain SDF)
B0V9M4 1.65e-41 144 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AYE)
B7I8R1 1.65e-41 144 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AB0057)
B7GXW9 1.65e-41 144 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AB307-0294)
B2HVP6 2.02e-41 144 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain ACICU)
A3M3C7 2.43e-41 143 40 3 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q2YBM4 2.64e-41 143 38 0 188 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q11CS6 5.19e-41 143 36 4 214 3 mtgA Biosynthetic peptidoglycan transglycosylase Chelativorans sp. (strain BNC1)
A1K3B8 2.12e-40 141 48 0 141 3 mtgA Biosynthetic peptidoglycan transglycosylase Azoarcus sp. (strain BH72)
B3PR74 2.31e-40 141 37 5 207 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium etli (strain CIAT 652)
Q1MAC8 2.75e-40 141 38 5 210 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B5ZU97 6.71e-40 140 37 4 209 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q92L23 7.6e-40 140 40 3 179 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium meliloti (strain 1021)
Q2J2T4 2.44e-39 138 44 1 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain HaA2)
Q2K330 2.69e-39 138 38 4 191 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q478U7 7.15e-39 137 42 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Dechloromonas aromatica (strain RCB)
B3QBD2 7.58e-39 137 45 2 150 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain TIE-1)
Q6NCE7 7.58e-39 137 45 2 150 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1GYH8 7.96e-39 137 36 0 203 3 mtgA Biosynthetic peptidoglycan transglycosylase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5P6J8 8.63e-39 137 47 0 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2SZD0 1.33e-38 137 42 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0VLR6 1.43e-38 137 35 2 228 3 mtgA Biosynthetic peptidoglycan transglycosylase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1QQI5 2.08e-38 136 42 4 175 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0AIQ0 2.14e-38 136 37 0 188 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82U73 3.66e-38 135 43 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q51005 8.54e-38 134 35 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae
Q5F6F6 8.54e-38 134 35 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q13U46 1.1e-37 134 41 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia xenovorans (strain LB400)
B2SYS3 1.12e-37 134 41 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q98FG8 1.45e-37 134 38 5 204 3 mtgA Biosynthetic peptidoglycan transglycosylase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q63QP9 2.07e-37 134 41 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia pseudomallei (strain K96243)
Q3V7M0 2.64e-37 134 41 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia mallei (strain ATCC 23344)
Q3SVC8 8.94e-37 132 44 2 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B4RJ59 1.15e-36 131 35 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae (strain NCCP11945)
B2JH09 1.47e-36 132 41 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1KVS7 1.69e-36 131 36 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q89VU8 3.53e-36 130 46 1 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A9M2N3 7.89e-36 129 35 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup C (strain 053442)
P0A0Z3 3.01e-35 128 35 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9AI31 6.97e-35 127 37 2 197 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia multivorans (strain ATCC 17616 / 249)
P69345 7.95e-35 125 40 1 159 3 mtgA Biosynthetic peptidoglycan transglycosylase (Fragment) Neisseria meningitidis
Q0BIE9 8.01e-35 127 37 3 199 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YSX5 8.27e-35 127 37 3 199 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia ambifaria (strain MC40-6)
Q39JR9 1.13e-34 127 36 3 204 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P0A0Z4 1.16e-34 126 34 4 219 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A4JBE7 3.28e-34 125 37 3 199 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1JVD0 3.32e-34 125 39 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia orbicola (strain MC0-3)
Q1BZB0 4.02e-34 125 39 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia orbicola (strain AU 1054)
A0K4E0 4.02e-34 125 39 0 162 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia cenocepacia (strain HI2424)
Q1LIV1 2.16e-32 120 42 1 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8XVQ4 4.72e-31 117 46 0 125 3 mtgA Biosynthetic peptidoglycan transglycosylase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q46XB8 3.77e-29 112 44 0 124 3 mtgA Biosynthetic peptidoglycan transglycosylase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P70997 5.42e-29 117 37 5 213 2 pbpG Penicillin-binding protein 2D Bacillus subtilis (strain 168)
P40750 9.24e-26 108 35 0 162 1 pbpD Penicillin-binding protein 4 Bacillus subtilis (strain 168)
P38050 6.13e-25 105 35 2 179 2 pbpF Penicillin-binding protein 1F Bacillus subtilis (strain 168)
P71707 2.37e-24 104 37 5 169 1 ponA1 Penicillin-binding protein 1A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0R7G2 2.04e-23 101 35 1 178 3 ponA1 Penicillin-binding protein 1A Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q1RKC5 1.91e-22 98 36 2 161 3 mrcA Penicillin-binding protein 1A Rickettsia bellii (strain RML369-C)
O87579 3.7e-22 97 38 2 151 3 mrcA Penicillin-binding protein 1A Neisseria lactamica
O87626 8.65e-22 97 39 2 151 3 mrcA Penicillin-binding protein 1A Neisseria flavescens
P0A0Z6 2.14e-21 95 37 2 151 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0A0Z5 2.14e-21 95 37 2 151 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
O05131 2.5e-21 95 37 2 151 1 mrcA Penicillin-binding protein 1A Neisseria gonorrhoeae
Q5FAC7 2.5e-21 95 37 2 151 3 mrcA Penicillin-binding protein 1A Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
O86088 2.72e-21 95 37 2 151 3 mrcA Penicillin-binding protein 1A Neisseria cinerea
Q92G78 3.04e-21 95 34 2 161 3 mrcA Penicillin-binding protein 1A Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4UK08 5.34e-21 94 35 2 162 3 mrcA Penicillin-binding protein 1A Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9ZCE9 1.26e-20 93 34 2 162 3 mrcA Penicillin-binding protein 1A Rickettsia prowazekii (strain Madrid E)
Q8CNQ3 1.46e-20 90 33 2 157 3 mgt Monofunctional glycosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN60 1.46e-20 90 33 2 157 3 mgt Monofunctional glycosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A5IU40 2.39e-20 90 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain JH9)
A6U2X8 2.39e-20 90 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain JH1)
Q68VU2 3.23e-20 92 33 2 162 3 mrcA Penicillin-binding protein 1A Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7A0I6 3.76e-20 89 30 2 172 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MW2)
A8YY46 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G860 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GFI3 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MRSA252)
Q7A4S6 3.76e-20 89 30 2 172 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain N315)
Q99T05 3.76e-20 89 30 2 172 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QI56 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Newman)
Q5HEQ0 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain COL)
Q2YU13 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q93Q23 3.76e-20 89 30 2 172 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFM1 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain USA300)
A7X3Z2 3.76e-20 89 30 2 172 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
O66874 4.46e-20 92 32 4 199 1 mrcA Penicillin-binding protein 1A Aquifex aeolicus (strain VF5)
Q07806 1.72e-19 90 32 1 159 1 mrcA Penicillin-binding protein 1A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L7I0 2.96e-19 87 27 4 212 3 mgt Monofunctional glycosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q49YR9 5.87e-19 86 32 3 160 3 mgt Monofunctional glycosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KNU5 3.82e-18 86 30 5 227 3 mrcA Penicillin-binding protein 1A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q07259 4.39e-18 83 31 3 172 3 H16_A0665 Putative transglycosylase H16_A0665 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P57296 5.08e-18 85 32 4 176 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8DNB6 6.19e-18 85 32 2 175 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZMF9 6.19e-18 85 32 2 175 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P02919 7.84e-18 85 36 1 133 1 mrcB Penicillin-binding protein 1B Escherichia coli (strain K12)
P02918 9.59e-18 85 33 0 161 1 mrcA Penicillin-binding protein 1A Escherichia coli (strain K12)
Q0SRL7 2.26e-17 84 34 4 178 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain SM101 / Type A)
Q0TNZ8 5.47e-17 82 34 4 178 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q97GR5 6.1e-17 82 36 5 165 3 pbpA Penicillin-binding protein 1A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q891X1 7.9e-17 82 29 2 175 3 pbpA Penicillin-binding protein 1A Clostridium tetani (strain Massachusetts / E88)
Q9KUC0 8.18e-17 82 36 1 130 3 mrcB Penicillin-binding protein 1B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8XJ01 1.16e-16 82 34 4 175 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain 13 / Type A)
Q89AR2 1.35e-16 81 36 2 142 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P45345 1.7e-16 81 32 1 153 3 mrcB Penicillin-binding protein 1B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31776 1.54e-15 78 34 1 147 1 mrcA Penicillin-binding protein 1A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5I6G4 9.75e-15 76 33 3 159 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY32 9.75e-15 76 33 3 159 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain ATCC 19397 / Type A)
A7GHV1 1.13e-14 76 33 3 159 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
P39793 1.63e-13 72 30 1 171 1 ponA Penicillin-binding protein 1A/1B Bacillus subtilis (strain 168)
Q9PGD4 7.52e-13 70 29 2 159 3 mrcA Penicillin-binding protein 1A Xylella fastidiosa (strain 9a5c)
Q87AW7 7.66e-13 70 29 2 159 3 mrcA Penicillin-binding protein 1A Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q00573 1.24e-12 70 29 3 167 3 ponA Penicillin-binding protein 1A (Fragment) Streptococcus oralis
Q04707 1.32e-12 70 30 4 170 1 ponA Penicillin-binding protein 1A Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0PZT1 7.94e-12 67 29 6 188 3 pbpA Penicillin-binding protein 1A Clostridium novyi (strain NT)
Q8DR59 2.2e-11 66 29 4 167 1 pbpA Penicillin-binding protein 1A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P76577 2.67e-09 60 29 2 167 1 pbpC Penicillin-binding protein 1C Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18310
Feature type CDS
Gene mtgA
Product monofunctional biosynthetic peptidoglycan transglycosylase
Location 4021815 - 4022516 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_711
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00912 Transglycosylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0744 Cell wall/membrane/envelope biogenesis (M) M Penicillin-binding protein 1B/1F, peptidoglycan transglycosylase/transpeptidase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03814 monofunctional glycosyltransferase [EC:2.4.99.28] Peptidoglycan biosynthesis
Metabolic pathways		 -

Protein Sequence

MVLVRKLKKLLIILIALWLGIVVLFSFLPVPFSAVMLQRQISSWSKFDFSYVSHSTWVNENEISPQIYLAVIASEDQNFPKHWGFDFDAIEKVFQNSLQSSKTIRGASTISQQTVKNLFLWDGRSWIRKGLEAGMTPVVELIWSKKRILTVYLNIVEFGDGIFGVEQASQHYFRKPAKQLTAHEAALLAAVLPNPHILHVNKPSAYLLKRQQWILNQMRLMGGTSFLSKNALL

Flanking regions ( +/- flanking 50bp)

CTGGTTAAAAAAGTACTAGAAATGGCATAACAATAGAGTGAATACAGCAGATGGTACTAGTGAGAAAGTTAAAGAAACTATTAATTATTCTAATTGCTTTATGGTTAGGGATAGTTGTCCTGTTTTCTTTTTTACCGGTGCCTTTTTCTGCTGTAATGCTACAAAGACAAATTTCTTCGTGGAGTAAGTTTGATTTTTCTTATGTATCCCATTCTACATGGGTTAATGAAAATGAGATATCCCCACAGATCTATTTAGCGGTAATAGCCTCTGAAGATCAAAATTTTCCAAAACATTGGGGATTTGATTTCGATGCGATTGAAAAAGTTTTCCAAAATAGCCTGCAAAGCTCAAAAACGATACGAGGTGCCTCTACTATTTCACAACAAACGGTCAAAAACTTATTTTTGTGGGATGGGCGTAGTTGGATAAGAAAAGGACTTGAAGCCGGAATGACGCCAGTGGTGGAGCTAATTTGGTCTAAAAAACGTATTTTAACCGTTTATCTGAATATCGTAGAGTTTGGCGACGGTATTTTTGGGGTTGAGCAGGCTTCTCAGCACTATTTTCGCAAGCCTGCTAAACAACTCACCGCCCATGAGGCGGCTTTATTAGCCGCTGTTTTACCTAATCCACATATTCTTCATGTTAATAAGCCTTCCGCGTATTTGCTAAAACGTCAGCAGTGGATCTTAAATCAAATGCGGTTAATGGGAGGAACTTCGTTTTTAAGCAAAAATGCGTTGTTATAACCGTTAAAATACTTTTTTTATTGATTCGTCATTTTGTGACGCCATTGTTG