Homologs in group_811

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03275 FBDBKF_03275 76.5 Morganella morganii S1 rnk nucleoside diphosphate kinase regulator
EHELCC_07260 EHELCC_07260 76.5 Morganella morganii S2 rnk nucleoside diphosphate kinase regulator
NLDBIP_07585 NLDBIP_07585 76.5 Morganella morganii S4 rnk nucleoside diphosphate kinase regulator
LHKJJB_07120 LHKJJB_07120 76.5 Morganella morganii S3 rnk nucleoside diphosphate kinase regulator
HKOGLL_03810 HKOGLL_03810 76.5 Morganella morganii S5 rnk nucleoside diphosphate kinase regulator
F4V73_RS11645 F4V73_RS11645 77.2 Morganella psychrotolerans rnk nucleoside diphosphate kinase regulator

Distribution of the homologs in the orthogroup group_811

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_811

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFW7 3.45e-58 179 62 0 133 3 rnk Regulator of nucleoside diphosphate kinase Shigella flexneri
P0AFW4 3.45e-58 179 62 0 133 1 rnk Regulator of nucleoside diphosphate kinase Escherichia coli (strain K12)
P0AFW5 3.45e-58 179 62 0 133 3 rnk Regulator of nucleoside diphosphate kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFW6 3.45e-58 179 62 0 133 3 rnk Regulator of nucleoside diphosphate kinase Escherichia coli O157:H7
Q7VJT9 2.32e-12 63 35 2 107 3 greA Transcription elongation factor GreA Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9KDD7 2.17e-08 53 31 2 109 3 greA Transcription elongation factor GreA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3A452 3.69e-08 52 26 2 110 3 greA Transcription elongation factor GreA Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5WHM1 4.18e-08 52 32 2 108 3 greA Transcription elongation factor GreA Shouchella clausii (strain KSM-K16)
B2USW4 5.13e-08 52 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain Shi470)
B5YJG9 7.1e-08 51 30 1 92 3 greA Transcription elongation factor GreA Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5HWI0 8.41e-08 51 32 2 108 3 greA Transcription elongation factor GreA Campylobacter jejuni (strain RM1221)
Q9PIK9 8.41e-08 51 32 2 108 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FK75 8.41e-08 51 32 2 108 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
P64275 1.33e-07 51 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain ATCC 700392 / 26695)
P64276 1.33e-07 51 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain J99 / ATCC 700824)
A6Q4L2 1.61e-07 50 32 2 108 3 greA Transcription elongation factor GreA Nitratiruptor sp. (strain SB155-2)
Q1CT06 2.07e-07 50 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain HPAG1)
B5Z7M6 2.07e-07 50 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain G27)
B6JM90 2.07e-07 50 28 2 107 3 greA Transcription elongation factor GreA Helicobacter pylori (strain P12)
Q8CSB3 2.7e-07 50 35 0 73 3 greA Transcription elongation factor GreA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNU0 2.7e-07 50 35 0 73 3 greA Transcription elongation factor GreA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3DJG6 4.27e-07 49 30 4 129 3 greA Transcription elongation factor GreA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A1VY10 4.67e-07 49 31 2 108 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H585 5.45e-07 49 31 2 108 3 greA Transcription elongation factor GreA Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B2UXU9 6.21e-07 49 31 2 101 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Alaska E43 / Type E3)
Q17WJ3 7.34e-07 48 28 2 107 3 greA Transcription elongation factor GreA Helicobacter acinonychis (strain Sheeba)
B2IHJ7 1.46e-06 48 25 2 133 3 greA Transcription elongation factor GreA Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B0K5B9 1.54e-06 48 33 2 103 3 greA Transcription elongation factor GreA Thermoanaerobacter sp. (strain X514)
B0KCE3 1.54e-06 48 33 2 103 3 greA Transcription elongation factor GreA Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q97EB6 1.73e-06 48 30 2 101 3 greA Transcription elongation factor GreA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B3EPH3 2.32e-06 47 30 3 111 3 greA Transcription elongation factor GreA Chlorobium phaeobacteroides (strain BS1)
Q7M9N2 2.48e-06 47 34 4 108 3 greA Transcription elongation factor GreA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8R7N0 3.16e-06 47 33 2 103 3 greA Transcription elongation factor GreA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B9DNJ3 3.28e-06 47 31 0 76 3 greA Transcription elongation factor GreA Staphylococcus carnosus (strain TM300)
Q65GT4 3.51e-06 47 30 2 108 3 greA Transcription elongation factor GreA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B4S9B2 4.8e-06 46 30 3 107 3 greA Transcription elongation factor GreA Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A7I2X0 5.5e-06 46 25 2 108 3 greA Transcription elongation factor GreA Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P64284 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MW2)
A8Z4E8 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8V9 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MSSA476)
Q6GG93 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain MRSA252)
P99156 6.97e-06 46 34 0 73 1 greA Transcription elongation factor GreA Staphylococcus aureus (strain N315)
P64283 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHF1 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Newman)
Q5HFF2 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain COL)
Q2YT68 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITD5 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain JH9)
Q2FXW7 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGB6 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain USA300)
A6U279 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain JH1)
A7X319 6.97e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus aureus (strain Mu3 / ATCC 700698)
B9E6Y8 7.26e-06 46 31 0 85 3 greA Transcription elongation factor GreA Macrococcus caseolyticus (strain JCSC5402)
Q4L6V7 7.72e-06 46 34 0 73 3 greA Transcription elongation factor GreA Staphylococcus haemolyticus (strain JCSC1435)
B9L822 7.86e-06 46 31 2 104 3 greA Transcription elongation factor GreA Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A8ESG0 8.26e-06 46 28 2 107 3 greA Transcription elongation factor GreA Aliarcobacter butzleri (strain RM4018)
Q8ZJH2 1.22e-05 45 33 2 86 3 greB Transcription elongation factor GreB Yersinia pestis
A7Z726 1.39e-05 45 29 2 108 3 greA Transcription elongation factor GreA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q181F4 1.49e-05 45 34 1 85 3 greA Transcription elongation factor GreA Clostridioides difficile (strain 630)
B2GD90 1.9e-05 45 27 2 108 3 greA Transcription elongation factor GreA Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q0SQ85 1.92e-05 45 31 2 103 3 greA Transcription elongation factor GreA Clostridium perfringens (strain SM101 / Type A)
Q8XHL7 1.92e-05 45 31 2 103 3 greA Transcription elongation factor GreA Clostridium perfringens (strain 13 / Type A)
Q0TMI6 1.92e-05 45 31 2 103 3 greA Transcription elongation factor GreA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B9KDP9 1.93e-05 45 28 2 107 3 greA Transcription elongation factor GreA Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A6Q9U9 2.01e-05 45 28 2 107 3 greA Transcription elongation factor GreA Sulfurovum sp. (strain NBC37-1)
A6LPL4 2.5e-05 44 30 2 101 3 greA Transcription elongation factor GreA Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A8MLU4 6.44e-05 43 31 4 129 3 greA Transcription elongation factor GreA Alkaliphilus oremlandii (strain OhILAs)
Q3Z8E7 6.68e-05 43 29 1 94 3 greA Transcription elongation factor GreA Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A4SFN0 6.7e-05 43 29 2 99 3 greA Transcription elongation factor GreA Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B1KTC2 8.55e-05 43 28 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Loch Maree / Type A3)
A7GJB4 8.55e-05 43 28 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGJ3 8.55e-05 43 28 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Okra / Type B1)
C3KVU0 8.55e-05 43 28 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain 657 / Type Ba4)
A8FFL6 8.97e-05 43 29 3 108 3 greA Transcription elongation factor GreA Bacillus pumilus (strain SAFR-032)
C1FNC6 9.09e-05 43 28 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Kyoto / Type A2)
Q04EK0 9.38e-05 43 24 1 107 3 greA Transcription elongation factor GreA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q0B0N4 0.000127 42 25 2 103 3 greA Transcription elongation factor GreA Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P80240 0.000136 42 27 2 108 1 greA Transcription elongation factor GreA Bacillus subtilis (strain 168)
A1BHJ3 0.000167 42 28 3 110 3 greA Transcription elongation factor GreA Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q6AL57 0.000196 42 27 0 81 3 greA Transcription elongation factor GreA Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q3ATA7 0.000204 42 30 2 96 3 greA Transcription elongation factor GreA Chlorobium chlorochromatii (strain CaD3)
B4SBF9 0.000233 42 29 3 110 3 greA Transcription elongation factor GreA Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B8IBN8 0.000296 42 23 1 120 3 greA Transcription elongation factor GreA Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A0LK20 0.000302 42 30 1 91 3 greA Transcription elongation factor GreA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2RQB1 0.000315 42 28 3 96 3 greA Transcription elongation factor GreA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q6HDE6 0.000331 41 26 2 108 3 greA Transcription elongation factor GreA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634G5 0.000331 41 26 2 108 3 greA Transcription elongation factor GreA Bacillus cereus (strain ZK / E33L)
Q81LK9 0.000331 41 26 2 108 3 greA Transcription elongation factor GreA Bacillus anthracis
C3L5Y5 0.000331 41 26 2 108 3 greA Transcription elongation factor GreA Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P968 0.000331 41 26 2 108 3 greA Transcription elongation factor GreA Bacillus anthracis (strain A0248)
A0AIU5 0.000426 41 27 1 98 3 greA Transcription elongation factor GreA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A5N4L0 0.000457 41 30 2 108 3 greA Transcription elongation factor GreA Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DY72 0.000457 41 30 2 108 3 greA Transcription elongation factor GreA Clostridium kluyveri (strain NBRC 12016)
P64277 0.000475 41 27 1 98 3 greA Transcription elongation factor GreA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE15 0.000475 41 27 1 98 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZH4 0.000475 41 27 1 98 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4b (strain F2365)
C1KVE3 0.000475 41 27 1 98 3 greA Transcription elongation factor GreA Listeria monocytogenes serotype 4b (strain CLIP80459)
P64278 0.000475 41 27 1 98 3 greA Transcription elongation factor GreA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5KWV4 0.000476 41 27 1 98 3 greA Transcription elongation factor GreA Geobacillus kaustophilus (strain HTA426)
A1AS07 0.00051 41 25 2 112 3 greA Transcription elongation factor GreA Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B3QPT8 0.000637 40 27 3 110 3 greA Transcription elongation factor GreA Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A5V3E1 0.00065 40 24 2 82 3 greA Transcription elongation factor GreA Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B0U8M0 0.00069 40 23 1 120 3 greA Transcription elongation factor GreA Methylobacterium sp. (strain 4-46)
Q03YY4 0.000747 40 25 1 107 3 greA Transcription elongation factor GreA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A5I7P5 0.00077 40 27 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZA6 0.00077 40 27 2 109 3 greA Transcription elongation factor GreA Clostridium botulinum (strain ATCC 19397 / Type A)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18125
Feature type CDS
Gene rnk
Product nucleoside diphosphate kinase regulator
Location 3982559 - 3982969 (strand: -1)
Length 411 (nucleotides) / 136 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_811
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01272 Transcription elongation factor, GreA/GreB, C-term
PF14760 Rnk N-terminus

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0782 Transcription (K) K Transcription elongation factor, GreA/GreB family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06140 regulator of nucleoside diphosphate kinase - -

Protein Sequence

MTKPTIIINELDAERLDSLLEQPAFADSPIAEALNEELDRADIVTPADIPANIVTMNSKVRFMDLKNNEERIRTLVYPASLKDSATELSVMAPMGAALLGLAINDEISWQLPNGLETKVKVLEILYQPEAAGELHR

Flanking regions ( +/- flanking 50bp)

ACCTAATCCGTGGGGGTGTTGTTTTGCATTGGAACAAATTGGAGTGTGGTATGACAAAGCCAACAATTATCATCAATGAACTTGATGCAGAACGTTTAGATTCATTACTAGAGCAACCTGCCTTTGCAGACAGCCCAATTGCAGAAGCTTTAAATGAAGAGTTAGATCGTGCTGACATTGTTACACCAGCTGATATCCCTGCTAACATCGTCACCATGAACAGCAAAGTCCGTTTTATGGACTTAAAAAATAATGAAGAGCGTATTCGTACTTTAGTTTACCCTGCTTCATTAAAAGATAGTGCGACTGAATTATCAGTCATGGCGCCAATGGGGGCTGCACTATTAGGTTTAGCTATCAATGATGAGATCAGTTGGCAGCTTCCTAATGGCCTTGAAACTAAGGTCAAAGTATTAGAAATTCTCTACCAACCTGAAGCTGCTGGTGAATTACACCGTTAAGCAATGCTGAAGGTTCGCGTGTTATTTTTTATCTTATTAACGTAATAAAA