Homologs in group_826

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03370 FBDBKF_03370 81.2 Morganella morganii S1 prmA 50S ribosomal protein L11 methyltransferase
EHELCC_07165 EHELCC_07165 81.2 Morganella morganii S2 prmA 50S ribosomal protein L11 methyltransferase
NLDBIP_07490 NLDBIP_07490 81.2 Morganella morganii S4 prmA 50S ribosomal protein L11 methyltransferase
LHKJJB_07025 LHKJJB_07025 81.2 Morganella morganii S3 prmA 50S ribosomal protein L11 methyltransferase
HKOGLL_03905 HKOGLL_03905 81.2 Morganella morganii S5 prmA 50S ribosomal protein L11 methyltransferase
F4V73_RS11560 F4V73_RS11560 80.2 Morganella psychrotolerans prmA 50S ribosomal protein L11 methyltransferase

Distribution of the homologs in the orthogroup group_826

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_826

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EX23 0.0 598 100 0 293 3 prmA Ribosomal protein L11 methyltransferase Proteus mirabilis (strain HI4320)
A1JRL5 0.0 528 86 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JKF2 0.0 523 85 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q8ZAX6 0.0 523 85 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia pestis
A7FDQ3 0.0 523 85 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q665E3 0.0 519 84 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K467 0.0 519 84 0 293 3 prmA Ribosomal protein L11 methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q6DAJ5 0.0 513 82 0 292 3 prmA Ribosomal protein L11 methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GK75 0.0 511 83 0 293 3 prmA Ribosomal protein L11 methyltransferase Serratia proteamaculans (strain 568)
C6DIJ9 0.0 509 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AQF7 3.11e-174 486 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q2NWP9 1.23e-171 479 77 0 293 3 prmA Ribosomal protein L11 methyltransferase Sodalis glossinidius (strain morsitans)
C5BEW8 3.69e-171 478 79 0 293 3 prmA Ribosomal protein L11 methyltransferase Edwardsiella ictaluri (strain 93-146)
B2VL75 6.24e-170 475 79 0 293 3 prmA Ribosomal protein L11 methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P60092 9.24e-169 472 78 0 292 3 prmA Ribosomal protein L11 methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4WF74 1.39e-168 471 83 0 293 3 prmA Ribosomal protein L11 methyltransferase Enterobacter sp. (strain 638)
A9MNA2 1.19e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TJV7 2.58e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella heidelberg (strain SL476)
P67688 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67689 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella typhi
B4TX91 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella schwarzengrund (strain CVM19633)
B5BGT7 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PJW5 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5REY1 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1C6 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella enteritidis PT4 (strain P125109)
Q57J85 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella choleraesuis (strain SC-B67)
B5F7P3 2.79e-166 466 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella agona (strain SL483)
B4SUN8 4.23e-166 465 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella newport (strain SL254)
B3GYL9 5.5e-166 465 77 0 293 3 prmA Ribosomal protein L11 methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B5FIW1 1.03e-165 464 82 0 293 3 prmA Ribosomal protein L11 methyltransferase Salmonella dublin (strain CT_02021853)
P0A8T4 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella flexneri
Q0T031 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella flexneri serotype 5b (strain 8401)
Q32B79 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q31W09 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U2N5 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R669 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain UTI89 / UPEC)
B6I1X9 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain SE11)
B7NDN7 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8T1 1.54e-165 464 81 0 293 1 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain K12)
B1IQ33 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8T2 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCJ7 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGF9 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O1:K1 / APEC
A8A570 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O9:H4 (strain HS)
B1XHM8 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZSZ5 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B5YSY4 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8T3 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O157:H7
B7MC29 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJZ0 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSF3 1.54e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N0Q3 1.72e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O81 (strain ED1a)
B7LRN4 1.76e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NLI5 1.76e-165 464 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A3N2I5 2.88e-165 463 76 0 293 3 prmA Ribosomal protein L11 methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B1LGM4 2.97e-165 463 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q65V70 4.32e-165 462 74 0 293 3 prmA Ribosomal protein L11 methyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B7LHW6 7.23e-165 462 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli (strain 55989 / EAEC)
B6ENA3 1.41e-164 461 72 1 294 3 prmA Ribosomal protein L11 methyltransferase Aliivibrio salmonicida (strain LFI1238)
B7M0X1 1.64e-164 461 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Escherichia coli O8 (strain IAI1)
Q3YWZ0 2.6e-164 461 81 0 293 3 prmA Ribosomal protein L11 methyltransferase Shigella sonnei (strain Ss046)
Q7VPN5 1.12e-163 459 74 0 293 3 prmA Ribosomal protein L11 methyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6TES6 1.13e-163 459 80 0 293 3 prmA Ribosomal protein L11 methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5FC65 1.18e-163 459 73 1 294 3 prmA Ribosomal protein L11 methyltransferase Aliivibrio fischeri (strain MJ11)
Q5E263 1.18e-163 459 73 1 294 3 prmA Ribosomal protein L11 methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LLY5 1.2e-163 459 72 1 293 3 prmA Ribosomal protein L11 methyltransferase Photobacterium profundum (strain SS9)
B0BRD1 2.84e-163 458 76 0 293 3 prmA Ribosomal protein L11 methyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B5XND9 5.13e-163 457 80 0 293 3 prmA Ribosomal protein L11 methyltransferase Klebsiella pneumoniae (strain 342)
Q9KV64 6.42e-163 457 73 1 293 3 prmA Ribosomal protein L11 methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LQP9 1.43e-162 456 73 1 293 3 prmA Ribosomal protein L11 methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
B8F6T6 3.78e-162 455 73 0 293 3 prmA Ribosomal protein L11 methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
A5F3S3 5.44e-162 455 72 1 293 3 prmA Ribosomal protein L11 methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P60094 1.61e-160 451 71 1 294 3 prmA Ribosomal protein L11 methyltransferase Vibrio vulnificus (strain YJ016)
A6VM22 4.1e-160 450 74 0 290 3 prmA Ribosomal protein L11 methyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q0I1Y6 4.56e-160 450 72 0 290 3 prmA Ribosomal protein L11 methyltransferase Histophilus somni (strain 129Pt)
Q8DD03 6.53e-160 449 71 1 294 3 prmA Ribosomal protein L11 methyltransferase Vibrio vulnificus (strain CMCP6)
B0UV84 9.71e-160 449 72 0 290 3 prmA Ribosomal protein L11 methyltransferase Histophilus somni (strain 2336)
A7MXI3 1.59e-159 449 70 1 294 3 prmA Ribosomal protein L11 methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q87KU2 1.63e-158 446 70 1 294 3 prmA Ribosomal protein L11 methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CLW2 5.36e-158 444 72 0 290 3 prmA Ribosomal protein L11 methyltransferase Pasteurella multocida (strain Pm70)
Q4QLT2 1.69e-157 443 72 0 290 3 prmA Ribosomal protein L11 methyltransferase Haemophilus influenzae (strain 86-028NP)
A5UIB7 7.31e-157 442 72 0 293 3 prmA Ribosomal protein L11 methyltransferase Haemophilus influenzae (strain PittGG)
A5UD93 7.31e-157 442 72 0 293 3 prmA Ribosomal protein L11 methyltransferase Haemophilus influenzae (strain PittEE)
B7VM52 1.41e-156 441 69 1 294 3 prmA Ribosomal protein L11 methyltransferase Vibrio atlanticus (strain LGP32)
P44402 7.1e-149 422 69 1 294 3 prmA Ribosomal protein L11 methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0KNJ1 2.48e-146 415 66 1 292 3 prmA Ribosomal protein L11 methyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6WTE5 5.21e-144 409 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella baltica (strain OS185)
A4SJL7 7.06e-144 409 66 1 293 3 prmA Ribosomal protein L11 methyltransferase Aeromonas salmonicida (strain A449)
B8E680 2.84e-143 407 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella baltica (strain OS223)
A3D9J5 5.54e-143 407 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q0HQK1 6.82e-143 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella sp. (strain MR-7)
Q0HN86 6.82e-143 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella sp. (strain MR-4)
A0KS74 6.82e-143 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella sp. (strain ANA-3)
A1RFA3 8.87e-143 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella sp. (strain W3-18-1)
A4YB19 8.87e-143 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L5E5 1.18e-142 406 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella baltica (strain OS195)
Q8EJR7 1.91e-142 405 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q12S38 2.89e-142 405 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C4LAF1 7.08e-142 404 63 1 293 3 prmA Ribosomal protein L11 methyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B8CHY3 5.05e-139 397 62 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8G0U8 1.8e-138 395 62 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella sediminis (strain HAW-EB3)
B1KQE8 1.9e-138 395 63 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q088J8 2.16e-138 395 63 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella frigidimarina (strain NCIMB 400)
C4K4P6 5.61e-137 392 63 2 300 3 prmA Ribosomal protein L11 methyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A1SAM0 2.18e-134 385 65 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q3IIC0 3.5e-133 382 61 1 293 3 prmA Ribosomal protein L11 methyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q15ZR4 3.53e-133 382 60 1 293 3 prmA Ribosomal protein L11 methyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q489G6 3.26e-132 379 63 2 294 3 prmA Ribosomal protein L11 methyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0TJ37 1.84e-131 377 62 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella halifaxensis (strain HAW-EB4)
A8GZI2 2.47e-131 377 62 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3Q9Q5 1.37e-130 375 63 0 293 3 prmA Ribosomal protein L11 methyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B4S130 3.81e-129 372 61 1 293 3 prmA Ribosomal protein L11 methyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A6VZL5 1.46e-121 352 57 2 295 3 prmA Ribosomal protein L11 methyltransferase Marinomonas sp. (strain MWYL1)
Q5QVT9 4e-115 336 54 1 292 3 prmA Ribosomal protein L11 methyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B3PBH5 5.98e-111 325 55 4 294 3 prmA Ribosomal protein L11 methyltransferase Cellvibrio japonicus (strain Ueda107)
A4XQ64 4.96e-110 323 59 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas mendocina (strain ymp)
A6VCV6 2.92e-109 321 59 3 294 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas aeruginosa (strain PA7)
Q9HUW3 1.81e-108 319 58 3 294 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FH0 1.81e-108 319 58 3 294 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V1R2 1.81e-108 319 58 3 294 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas aeruginosa (strain LESB58)
C1DLJ6 1.29e-107 317 58 3 294 3 prmA Ribosomal protein L11 methyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B1J5U4 4.28e-106 313 58 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas putida (strain W619)
C5BP64 6.31e-106 313 52 3 294 3 prmA Ribosomal protein L11 methyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1I4C5 9.29e-106 312 57 4 295 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas entomophila (strain L48)
B0KJZ2 1.09e-105 312 58 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas putida (strain GB-1)
Q1QV72 1.14e-105 312 56 6 301 3 prmA Ribosomal protein L11 methyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q87VS3 1.47e-105 311 57 4 295 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZN40 1.81e-105 311 57 4 295 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas syringae pv. syringae (strain B728a)
A5W9K3 2.95e-105 311 58 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q48DI0 5.04e-105 310 57 4 295 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q88DK7 5.44e-105 310 58 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4KIX1 1.11e-104 310 57 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KIP5 3.15e-104 308 57 4 295 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas fluorescens (strain Pf0-1)
C3K6W5 9.5e-104 307 56 4 296 3 prmA Ribosomal protein L11 methyltransferase Pseudomonas fluorescens (strain SBW25)
A1U698 9.29e-100 297 52 4 303 3 prmA Ribosomal protein L11 methyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2S9L7 5.19e-99 295 53 2 292 3 prmA Ribosomal protein L11 methyltransferase Hahella chejuensis (strain KCTC 2396)
Q21MK7 3.22e-95 285 49 4 295 3 prmA Ribosomal protein L11 methyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3JC88 2.29e-91 276 46 1 293 3 prmA Ribosomal protein L11 methyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q31II5 4.6e-89 270 48 3 294 3 prmA Ribosomal protein L11 methyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B0VLL0 3.57e-83 255 46 4 300 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baumannii (strain SDF)
B0V7H8 3.99e-83 255 46 4 300 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baumannii (strain AYE)
A3M6R7 3.99e-83 255 46 4 300 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7IC17 3.99e-83 255 46 4 300 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baumannii (strain AB0057)
B7H0I7 3.99e-83 255 46 4 300 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baumannii (strain AB307-0294)
C1DCV9 1.08e-82 254 45 5 303 3 prmA Ribosomal protein L11 methyltransferase Laribacter hongkongensis (strain HLHK9)
Q4FRP0 1.57e-81 251 43 3 305 3 prmA Ribosomal protein L11 methyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P60091 3.64e-81 250 45 5 299 3 prmA Ribosomal protein L11 methyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A5WFX2 1.9e-80 248 42 3 305 3 prmA Ribosomal protein L11 methyltransferase Psychrobacter sp. (strain PRwf-1)
Q1QA78 1.66e-79 246 43 4 304 3 prmA Ribosomal protein L11 methyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q60A25 8.1e-79 244 46 2 292 3 prmA Ribosomal protein L11 methyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9JXW2 1.16e-78 243 44 7 303 3 prmA Ribosomal protein L11 methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q3SMB4 1.53e-77 241 44 4 302 3 prmA Ribosomal protein L11 methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q6F9P9 9.19e-77 239 44 4 306 3 prmA Ribosomal protein L11 methyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1KS36 1.25e-76 238 44 7 303 3 prmA Ribosomal protein L11 methyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JW08 1.28e-76 238 44 7 303 3 prmA Ribosomal protein L11 methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q1LIT8 3.49e-76 237 44 5 302 3 prmA Ribosomal protein L11 methyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5FAH7 6.64e-76 236 43 5 302 3 prmA Ribosomal protein L11 methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5IHD3 4.77e-74 231 44 5 295 3 prmA Ribosomal protein L11 methyltransferase Legionella pneumophila (strain Corby)
Q5X7S8 1.47e-73 230 43 5 295 3 prmA Ribosomal protein L11 methyltransferase Legionella pneumophila (strain Paris)
Q8PQ06 1.53e-73 231 43 4 306 3 prmA Ribosomal protein L11 methyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q0AEV2 3.1e-73 230 42 5 309 3 prmA Ribosomal protein L11 methyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q39JS9 6.82e-73 229 42 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BZC1 1.07e-72 228 41 4 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain AU 1054)
A0K4C9 1.07e-72 228 41 4 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain HI2424)
Q5WZ79 1.36e-72 228 43 5 295 3 prmA Ribosomal protein L11 methyltransferase Legionella pneumophila (strain Lens)
A3NDQ7 1.36e-72 228 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 668)
Q3JNI0 1.36e-72 228 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain 1710b)
B4E5V2 1.44e-72 228 41 4 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q63QN9 1.87e-72 228 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia pseudomallei (strain K96243)
B1JVC0 2.22e-72 228 41 3 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia orbicola (strain MC0-3)
A1V0M1 2.73e-72 227 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain SAVP1)
Q62GX2 2.73e-72 227 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain ATCC 23344)
A2S5P8 2.73e-72 227 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10229)
A3MRB1 2.73e-72 227 44 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia mallei (strain NCTC 10247)
Q5ZYB1 3.32e-72 227 43 5 295 3 prmA Ribosomal protein L11 methyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
B2UCS1 4.28e-72 227 42 5 299 3 prmA Ribosomal protein L11 methyltransferase Ralstonia pickettii (strain 12J)
Q1GX86 7.64e-72 226 44 6 299 3 prmA Ribosomal protein L11 methyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0AB25 1.06e-71 226 42 4 296 3 prmA Ribosomal protein L11 methyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A9AI41 1.33e-71 226 41 3 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
A4JBD7 1.78e-71 225 41 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2SYT3 2.39e-71 225 40 3 300 3 prmA Ribosomal protein L11 methyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13U36 2.41e-71 225 41 3 300 3 prmA Ribosomal protein L11 methyltransferase Paraburkholderia xenovorans (strain LB400)
B1YSW5 3.41e-71 224 40 3 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain MC40-6)
Q0K6X3 4.06e-71 224 43 3 299 3 prmA Ribosomal protein L11 methyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0BIF9 4.1e-71 224 40 3 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2JH19 6.47e-71 224 41 4 300 3 prmA Ribosomal protein L11 methyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2SZE1 9.15e-71 223 43 5 300 3 prmA Ribosomal protein L11 methyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q478R6 1.17e-70 223 42 3 298 3 prmA Ribosomal protein L11 methyltransferase Dechloromonas aromatica (strain RCB)
Q81ZZ9 1.77e-70 223 42 5 309 3 prmA Ribosomal protein L11 methyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B3R6K3 2.03e-70 222 43 3 299 3 prmA Ribosomal protein L11 methyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46XA5 1.4e-69 220 43 4 302 3 prmA Ribosomal protein L11 methyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1WYK5 1.47e-69 220 44 4 294 3 prmA Ribosomal protein L11 methyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
A4G8P4 5.48e-69 219 41 5 305 3 prmA Ribosomal protein L11 methyltransferase Herminiimonas arsenicoxydans
Q2P856 1.21e-68 218 41 4 306 3 prmA Ribosomal protein L11 methyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BY72 6.8e-68 216 44 4 306 3 prmA Ribosomal protein L11 methyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8XVP2 2.78e-67 214 42 5 299 3 prmA Ribosomal protein L11 methyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A6T2B6 4.09e-67 214 41 5 305 3 prmA Ribosomal protein L11 methyltransferase Janthinobacterium sp. (strain Marseille)
B1XT48 1.19e-64 209 41 8 308 3 prmA Ribosomal protein L11 methyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q8PD33 7.34e-64 206 42 4 306 3 prmA Ribosomal protein L11 methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UZB8 7.34e-64 206 42 4 306 3 prmA Ribosomal protein L11 methyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q7WF92 5.51e-63 204 42 7 310 3 prmA Ribosomal protein L11 methyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W3W2 1.23e-62 202 41 7 310 3 prmA Ribosomal protein L11 methyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A5EVX5 2.13e-59 194 38 6 294 3 prmA Ribosomal protein L11 methyltransferase Dichelobacter nodosus (strain VCS1703A)
Q9PBE3 1.25e-57 190 46 7 295 3 prmA Ribosomal protein L11 methyltransferase Xylella fastidiosa (strain 9a5c)
B2FJP0 8.85e-56 185 43 4 306 3 prmA Ribosomal protein L11 methyltransferase Stenotrophomonas maltophilia (strain K279a)
B4SL82 6.19e-55 183 43 4 306 3 prmA Ribosomal protein L11 methyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q87C45 1.98e-54 182 45 7 298 3 prmA Ribosomal protein L11 methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q12EI9 2.76e-48 166 35 5 297 3 prmA Ribosomal protein L11 methyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q67S51 1.63e-46 161 40 6 226 3 prmA Ribosomal protein L11 methyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B0KA79 1.01e-45 159 30 6 313 3 prmA Ribosomal protein L11 methyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K3X8 3.69e-43 152 29 6 313 3 prmA Ribosomal protein L11 methyltransferase Thermoanaerobacter sp. (strain X514)
B1KZN5 5.48e-43 152 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
Q0AWM5 1.15e-42 151 35 4 231 3 prmA Ribosomal protein L11 methyltransferase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A7GHH4 1.78e-42 151 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM1 1.78e-42 151 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Okra / Type B1)
C1FVT8 1.82e-42 151 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5I638 1.82e-42 151 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL3 1.82e-42 151 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
A4J7F1 2.4e-42 150 36 4 202 3 prmA Ribosomal protein L11 methyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C3L3G5 4.59e-42 150 31 8 308 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q8RB66 6.39e-42 149 30 6 314 3 prmA Ribosomal protein L11 methyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P54460 2.35e-41 148 30 7 321 3 prmA Ribosomal protein L11 methyltransferase Bacillus subtilis (strain 168)
Q39Q76 4.24e-41 147 42 4 201 3 prmA Ribosomal protein L11 methyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A0Q1R2 5.98e-40 144 29 5 306 3 prmA Ribosomal protein L11 methyltransferase Clostridium novyi (strain NT)
P45558 7.85e-40 144 31 7 308 2 prmA Ribosomal protein L11 methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7GT06 8.66e-40 144 32 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7GKD0 2.5e-39 142 31 7 319 3 prmA Ribosomal protein L11 methyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A1AT86 3.33e-39 142 41 3 193 3 prmA Ribosomal protein L11 methyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q65H56 6.73e-39 141 29 7 321 3 prmA Ribosomal protein L11 methyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q74G05 9.19e-39 140 39 6 239 3 prmA Ribosomal protein L11 methyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A7Z6V9 1.22e-38 140 29 6 321 3 prmA Ribosomal protein L11 methyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B5YDR3 1.82e-38 140 34 7 244 3 prmA Ribosomal protein L11 methyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A6TSL8 1.84e-38 140 30 8 316 3 prmA Ribosomal protein L11 methyltransferase Alkaliphilus metalliredigens (strain QYMF)
Q49Y20 2.48e-38 140 30 8 311 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A8MG53 2.76e-38 140 30 8 295 3 prmA Ribosomal protein L11 methyltransferase Alkaliphilus oremlandii (strain OhILAs)
A0LQ64 1.27e-37 137 32 5 291 3 prmA Ribosomal protein L11 methyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8DM00 2.27e-37 137 41 5 206 3 prmA Ribosomal protein L11 methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q820A9 3e-37 137 32 8 309 3 prmA Ribosomal protein L11 methyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
A4IR29 3.54e-37 137 30 7 318 3 prmA Ribosomal protein L11 methyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q892R2 3.59e-37 137 29 6 302 3 prmA Ribosomal protein L11 methyltransferase Clostridium tetani (strain Massachusetts / E88)
Q7VAM5 4.14e-37 137 39 5 210 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C4L423 4.96e-37 137 30 9 319 3 prmA Ribosomal protein L11 methyltransferase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q2RKY6 7.46e-37 136 32 7 309 3 prmA Ribosomal protein L11 methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A3DF23 9.35e-37 136 28 6 307 3 prmA Ribosomal protein L11 methyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5KWZ9 1.04e-36 135 31 8 319 3 prmA Ribosomal protein L11 methyltransferase Geobacillus kaustophilus (strain HTA426)
Q5WHF9 1.27e-36 135 30 7 314 3 prmA Ribosomal protein L11 methyltransferase Shouchella clausii (strain KSM-K16)
Q038Q5 1.8e-36 135 31 6 313 3 prmA Ribosomal protein L11 methyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B1YKT1 2.09e-36 135 30 10 320 3 prmA Ribosomal protein L11 methyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q6GGC2 2.82e-36 134 30 11 314 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain MRSA252)
Q6HDK9 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634M9 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain ZK / E33L)
C1ESK6 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain 03BB102)
B7JN37 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain AH820)
Q81LS4 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus anthracis
A0RIT1 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus thuringiensis (strain Al Hakam)
C3L5R5 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P8L8 2.82e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus anthracis (strain A0248)
B7HPL1 3.14e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain AH187)
Q5MZ45 3.72e-36 134 37 3 215 3 prmA Ribosomal protein L11 methyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31N39 3.72e-36 134 37 3 215 3 prmA Ribosomal protein L11 methyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2YT49 4.13e-36 134 34 6 217 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B9IY79 4.78e-36 134 30 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain Q1)
P0A0P5 4.94e-36 134 34 5 208 2 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus
P0A0P4 4.94e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain N315)
P0A0P3 4.94e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITA6 4.94e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain JH9)
A6U250 4.94e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain JH1)
A7X2X9 4.94e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NWB0 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain MW2)
A8Z4B7 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8Y9 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain MSSA476)
A6QHC1 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain Newman)
Q2FXZ4 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FGE5 5.37e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain USA300)
Q5HFI2 6.22e-36 134 34 5 208 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus aureus (strain COL)
B8DE40 7.53e-36 134 29 7 314 3 prmA Ribosomal protein L11 methyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q1DD74 8.13e-36 133 32 10 294 3 prmA Ribosomal protein L11 methyltransferase Myxococcus xanthus (strain DK1622)
B5E9X4 9.82e-36 133 33 7 296 3 prmA Ribosomal protein L11 methyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B3WEN7 1.22e-35 133 31 6 313 3 prmA Ribosomal protein L11 methyltransferase Lacticaseibacillus casei (strain BL23)
B7IYG5 1.46e-35 133 29 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain G9842)
Q818F1 1.64e-35 132 29 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCT8 1.64e-35 132 29 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain B4264)
P0DJO9 1.77e-35 132 30 8 314 3 prmA Ribosomal protein L11 methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
G2K044 1.77e-35 132 30 8 314 3 prmA Ribosomal protein L11 methyltransferase Listeria monocytogenes serotype 1/2a (strain 10403S)
Q71ZJ9 1.88e-35 132 30 8 314 3 prmA Ribosomal protein L11 methyltransferase Listeria monocytogenes serotype 4b (strain F2365)
Q92BP0 1.94e-35 132 29 7 314 3 prmA Ribosomal protein L11 methyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q730M3 2.09e-35 132 29 9 312 3 prmA Ribosomal protein L11 methyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B9LFP4 2.46e-35 132 40 4 196 3 prmA Ribosomal protein L11 methyltransferase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WD89 2.46e-35 132 40 4 196 3 prmA Ribosomal protein L11 methyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q7TU56 3.27e-35 131 36 5 214 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A0AIS2 3.5e-35 132 29 7 314 3 prmA Ribosomal protein L11 methyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A8FFD0 3.53e-35 132 28 7 317 3 prmA Ribosomal protein L11 methyltransferase Bacillus pumilus (strain SAFR-032)
Q4L6S8 3.6e-35 132 29 9 314 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus haemolyticus (strain JCSC1435)
A2BY60 5.54e-35 131 35 4 212 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9515)
C1KVB8 5.55e-35 131 29 7 317 3 prmA Ribosomal protein L11 methyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9KD70 5.97e-35 131 29 8 312 3 prmA Ribosomal protein L11 methyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6LRN8 7.69e-35 131 34 3 209 3 prmA Ribosomal protein L11 methyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C4ZAZ2 8.65e-35 131 34 6 235 3 prmA Ribosomal protein L11 methyltransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
C6DY35 8.86e-35 130 33 7 296 3 prmA Ribosomal protein L11 methyltransferase Geobacter sp. (strain M21)
B1MZ55 1.04e-34 130 30 8 293 3 prmA Ribosomal protein L11 methyltransferase Leuconostoc citreum (strain KM20)
Q0SRE9 1.18e-34 130 31 7 311 3 prmA Ribosomal protein L11 methyltransferase Clostridium perfringens (strain SM101 / Type A)
Q8XIT6 1.18e-34 130 31 7 311 3 prmA Ribosomal protein L11 methyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TNT3 2e-34 130 31 7 311 3 prmA Ribosomal protein L11 methyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B8HPZ1 2.07e-34 129 35 6 213 3 prmA Ribosomal protein L11 methyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A5G9G5 2.47e-34 129 39 6 210 3 prmA Ribosomal protein L11 methyltransferase Geotalea uraniireducens (strain Rf4)
C0ZB50 2.8e-34 129 30 9 294 3 prmA Ribosomal protein L11 methyltransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C4Z0Q0 2.83e-34 129 35 6 228 3 prmA Ribosomal protein L11 methyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q7NIP7 2.86e-34 129 39 4 204 3 prmA Ribosomal protein L11 methyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q38XP2 3.42e-34 129 32 8 278 3 prmA Ribosomal protein L11 methyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
B9DNJ8 3.56e-34 129 29 9 314 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus carnosus (strain TM300)
B0JX03 6.48e-34 128 36 6 215 3 prmA Ribosomal protein L11 methyltransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q99XW8 7.27e-34 128 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M1
B2GBW2 7.73e-34 128 31 7 317 3 prmA Ribosomal protein L11 methyltransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B8I303 1.08e-33 128 27 6 293 3 prmA Ribosomal protein L11 methyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A5N6M4 1.15e-33 128 29 8 309 3 prmA Ribosomal protein L11 methyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E043 1.15e-33 128 29 8 309 3 prmA Ribosomal protein L11 methyltransferase Clostridium kluyveri (strain NBRC 12016)
Q48R70 1.18e-33 128 31 7 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q8EPW5 1.45e-33 127 29 7 317 3 prmA Ribosomal protein L11 methyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C0MF82 1.64e-33 127 32 8 309 3 prmA Ribosomal protein L11 methyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
B9LZ49 1.7e-33 127 30 6 311 3 prmA Ribosomal protein L11 methyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8E1A7 1.72e-33 127 28 9 307 3 prmA Ribosomal protein L11 methyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q9CJ97 1.77e-33 127 32 9 308 3 prmA Ribosomal protein L11 methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
P0DD19 2.23e-33 127 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD18 2.23e-33 127 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8CSC7 2.53e-33 127 34 4 205 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNW8 2.53e-33 127 34 4 205 3 prmA Ribosomal protein L11 methyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0TAD9 3.02e-33 127 30 7 314 3 prmA Ribosomal protein L11 methyltransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q1JET3 3.92e-33 126 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JJU1 6.54e-33 126 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J9P3 6.54e-33 126 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8NZ98 7.58e-33 125 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
B5XIN3 8.41e-33 125 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
B4U5A5 8.68e-33 125 31 9 310 3 prmA Ribosomal protein L11 methyltransferase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M9U4 8.68e-33 125 31 9 310 3 prmA Ribosomal protein L11 methyltransferase Streptococcus equi subsp. equi (strain 4047)
B2G6X4 1.05e-32 125 37 3 200 3 prmA Ribosomal protein L11 methyltransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJF8 1.05e-32 125 37 3 200 3 prmA Ribosomal protein L11 methyltransferase Limosilactobacillus reuteri (strain DSM 20016)
A6QBN7 1.24e-32 124 35 5 207 3 prmA Ribosomal protein L11 methyltransferase Sulfurovum sp. (strain NBC37-1)
Q03SF4 1.68e-32 125 29 7 311 3 prmA Ribosomal protein L11 methyltransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q5X9S8 1.77e-32 125 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
A9B5V4 2.22e-32 124 29 7 305 3 prmA Ribosomal protein L11 methyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A2RGK2 2.25e-32 124 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q033A6 2.37e-32 124 31 9 308 3 prmA Ribosomal protein L11 methyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
Q24SS5 2.4e-32 124 32 9 307 3 prmA Ribosomal protein L11 methyltransferase Desulfitobacterium hafniense (strain Y51)
Q8DS02 2.98e-32 124 31 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B8FUN2 3.08e-32 124 31 9 310 3 prmA Ribosomal protein L11 methyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B9MJY9 3.8e-32 124 29 11 315 3 prmA Ribosomal protein L11 methyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q03F44 3.99e-32 124 29 11 317 3 prmA Ribosomal protein L11 methyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B1WNQ4 4.58e-32 123 37 7 212 3 prmA Ribosomal protein L11 methyltransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5GV37 4.59e-32 123 38 4 214 3 prmA Ribosomal protein L11 methyltransferase Synechococcus sp. (strain RCC307)
B7K2J4 4.82e-32 123 38 5 193 3 prmA Ribosomal protein L11 methyltransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q5M6B7 4.97e-32 124 31 6 298 3 prmA Ribosomal protein L11 methyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1S5 4.97e-32 124 31 6 298 3 prmA Ribosomal protein L11 methyltransferase Streptococcus thermophilus (strain CNRZ 1066)
Q17WN8 7.36e-32 123 34 5 216 3 prmA Ribosomal protein L11 methyltransferase Helicobacter acinonychis (strain Sheeba)
B9DTA9 7.38e-32 123 31 7 301 3 prmA Ribosomal protein L11 methyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q3JYX9 8.54e-32 123 32 8 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A3PEI7 1.19e-31 122 30 8 303 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9301)
A5D3Y3 1.26e-31 122 32 5 286 3 prmA Ribosomal protein L11 methyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
C0QLV7 1.4e-31 122 37 4 205 3 prmA Ribosomal protein L11 methyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q1J4K0 2.66e-31 122 32 10 301 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q97P62 2.66e-31 122 30 6 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A9KKT8 2.89e-31 122 29 12 335 3 prmA Ribosomal protein L11 methyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A2RHI1 3.21e-31 121 31 9 308 3 prmA Ribosomal protein L11 methyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
C1CT24 5.08e-31 121 31 7 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DNP4 5.24e-31 120 31 7 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04J12 5.24e-31 120 31 7 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B7KJ88 5.35e-31 120 35 5 208 3 prmA Ribosomal protein L11 methyltransferase Gloeothece citriformis (strain PCC 7424)
B9E6W9 8.87e-31 120 31 8 281 3 prmA Ribosomal protein L11 methyltransferase Macrococcus caseolyticus (strain JCSC5402)
Q03MQ4 9.38e-31 120 31 6 298 3 prmA Ribosomal protein L11 methyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9ZM65 1.03e-30 120 34 6 217 3 prmA Ribosomal protein L11 methyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q7VHY7 1.2e-30 120 33 5 232 3 prmA Ribosomal protein L11 methyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B2ISD7 1.22e-30 120 30 6 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain CGSP14)
Q6AQF1 1.33e-30 119 30 8 292 3 prmA Ribosomal protein L11 methyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P73820 1.34e-30 119 33 5 217 3 prmA Ribosomal protein L11 methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q88VP9 2.6e-30 119 30 6 284 3 prmA Ribosomal protein L11 methyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1CG04 2.74e-30 119 30 6 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain JJA)
B8ZMW2 3.31e-30 119 30 5 296 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CMA0 3.38e-30 119 30 5 296 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain P1031)
B2USL4 3.51e-30 119 33 6 224 3 prmA Ribosomal protein L11 methyltransferase Helicobacter pylori (strain Shi470)
Q57C92 3.85e-30 118 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella abortus biovar 1 (strain 9-941)
Q2YPS7 3.85e-30 118 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella abortus (strain 2308)
B2S6P1 3.85e-30 118 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella abortus (strain S19)
Q8FZQ6 4.36e-30 117 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella suis biovar 1 (strain 1330)
Q8YI53 4.36e-30 117 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE56 4.36e-30 117 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
A9M676 4.36e-30 117 36 6 220 3 prmA Ribosomal protein L11 methyltransferase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q319D4 5.08e-30 118 30 9 306 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9312)
B1I7P5 5.56e-30 118 30 7 298 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
B8FBE9 6.09e-30 118 37 7 223 3 prmA Ribosomal protein L11 methyltransferase Desulfatibacillum aliphaticivorans
A8ZW25 6.2e-30 117 39 3 174 3 prmA Ribosomal protein L11 methyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B0CHK5 6.77e-30 117 36 5 220 3 prmA Ribosomal protein L11 methyltransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8DX85 8.5e-30 117 30 6 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E307 8.5e-30 117 30 6 300 3 prmA Ribosomal protein L11 methyltransferase Streptococcus agalactiae serotype III (strain NEM316)
B2J397 1.14e-29 117 34 6 223 3 prmA Ribosomal protein L11 methyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B1ZUS4 2.08e-29 116 32 7 282 3 prmA Ribosomal protein L11 methyltransferase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q8YVT3 2.27e-29 116 34 6 218 3 prmA Ribosomal protein L11 methyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1CUC6 3.22e-29 116 33 6 217 3 prmA Ribosomal protein L11 methyltransferase Helicobacter pylori (strain HPAG1)
Q9X0G8 3.63e-29 115 34 3 190 3 prmA Ribosomal protein L11 methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O07678 4.25e-29 116 32 5 216 3 prmA Ribosomal protein L11 methyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q7TUS7 4.92e-29 115 40 3 184 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9313)
A4XKA6 5.86e-29 115 35 6 219 3 prmA Ribosomal protein L11 methyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q10X25 6.67e-29 115 34 7 210 3 prmA Ribosomal protein L11 methyltransferase Trichodesmium erythraeum (strain IMS101)
Q3M6M1 7.72e-29 115 34 6 218 3 prmA Ribosomal protein L11 methyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B1L841 8.91e-29 114 34 3 190 3 prmA Ribosomal protein L11 methyltransferase Thermotoga sp. (strain RQ2)
A7ZES6 9.17e-29 114 35 5 195 3 prmA Ribosomal protein L11 methyltransferase Campylobacter concisus (strain 13826)
C1C922 9.53e-29 115 31 7 297 3 prmA Ribosomal protein L11 methyltransferase Streptococcus pneumoniae (strain 70585)
A5IN97 1e-28 114 33 3 190 3 prmA Ribosomal protein L11 methyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B2V2I9 1.06e-28 114 35 4 217 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
O86951 1.11e-28 113 34 4 196 3 prmA Ribosomal protein L11 methyltransferase Thermotoga neapolitana
A2BSS6 1.16e-28 114 28 8 307 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain AS9601)
B2TM01 1.66e-28 114 35 4 217 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
A8YUZ6 1.72e-28 114 30 8 280 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus helveticus (strain DPC 4571)
O67870 1.9e-28 112 36 9 208 3 prmA Ribosomal protein L11 methyltransferase Aquifex aeolicus (strain VF5)
Q74IX0 2.12e-28 114 34 4 211 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B3E5Z5 3.04e-28 113 34 6 270 3 prmA Ribosomal protein L11 methyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A2C717 3.5e-28 113 39 3 184 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9303)
Q8R6G7 5.08e-28 113 33 3 182 3 prmA Ribosomal protein L11 methyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q043X8 9.48e-28 112 35 4 211 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P60095 1.15e-27 111 35 5 203 3 prmA Ribosomal protein L11 methyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q5FKI8 1.39e-27 112 30 9 280 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B2IH12 1.8e-27 111 32 6 280 3 prmA Ribosomal protein L11 methyltransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A0RQL1 2.68e-27 110 36 7 211 3 prmA Ribosomal protein L11 methyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
Q04AV7 2.81e-27 110 31 5 255 1 prmA Ribosomal protein L11 methyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q39ZZ2 2.86e-27 110 32 6 304 3 prmA Ribosomal protein L11 methyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q92NN5 3.06e-27 110 37 2 193 3 prmA Ribosomal protein L11 methyltransferase Rhizobium meliloti (strain 1021)
Q1GAH2 3.56e-27 110 31 5 255 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B9KDE1 7.25e-27 109 33 5 203 3 prmA Ribosomal protein L11 methyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B9K9N3 1.18e-26 108 33 5 196 3 prmA Ribosomal protein L11 methyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
C3MEL0 1.24e-26 108 32 6 283 3 prmA Ribosomal protein L11 methyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B5ZWH3 1.89e-26 108 35 2 191 3 prmA Ribosomal protein L11 methyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A8G6G4 2.06e-26 108 27 9 308 3 prmA Ribosomal protein L11 methyltransferase Prochlorococcus marinus (strain MIT 9215)
B1XKZ0 2.21e-26 108 35 5 214 3 prmA Ribosomal protein L11 methyltransferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3AF06 8.1e-26 107 40 2 141 3 prmA Ribosomal protein L11 methyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B9JXT0 1.01e-25 106 35 2 191 3 prmA Ribosomal protein L11 methyltransferase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B9JH32 2.76e-25 105 31 7 280 3 prmA Ribosomal protein L11 methyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A6Q4V8 3.09e-25 104 34 5 198 3 prmA Ribosomal protein L11 methyltransferase Nitratiruptor sp. (strain SB155-2)
Q8UDP9 4.76e-25 104 34 3 197 3 prmA Ribosomal protein L11 methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1ME53 1.34e-24 103 34 2 191 3 prmA Ribosomal protein L11 methyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K6E0 1.65e-24 103 34 2 191 3 prmA Ribosomal protein L11 methyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A6LJG3 3.1e-24 101 29 5 216 3 prmA Ribosomal protein L11 methyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q9RU72 5.16e-24 101 36 4 214 3 prmA Ribosomal protein L11 methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B0T1G7 7.02e-24 101 36 4 206 3 prmA Ribosomal protein L11 methyltransferase Caulobacter sp. (strain K31)
Q7TTX0 9.23e-24 101 40 3 185 3 prmA Ribosomal protein L11 methyltransferase Parasynechococcus marenigrum (strain WH8102)
Q5HTY7 1.48e-23 100 31 5 196 3 prmA Ribosomal protein L11 methyltransferase Campylobacter jejuni (strain RM1221)
A1W0A4 1.57e-23 100 31 5 196 3 prmA Ribosomal protein L11 methyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q64VV4 2.3e-23 99 31 5 242 3 prmA Ribosomal protein L11 methyltransferase Bacteroides fragilis (strain YCH46)
Q5LEW2 2.3e-23 99 31 5 242 3 prmA Ribosomal protein L11 methyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A7H2P1 2.96e-23 99 31 5 196 3 prmA Ribosomal protein L11 methyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q9PNH7 3.29e-23 99 31 5 196 3 prmA Ribosomal protein L11 methyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B3PTU0 4.03e-23 99 33 2 191 3 prmA Ribosomal protein L11 methyltransferase Rhizobium etli (strain CIAT 652)
A8FMH0 4.66e-23 99 31 5 196 3 prmA Ribosomal protein L11 methyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9A838 6.81e-23 98 36 6 219 3 prmA Ribosomal protein L11 methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A6L2N4 7.47e-23 98 34 3 176 3 prmA Ribosomal protein L11 methyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B7IFP7 1.04e-22 97 34 4 172 3 prmA Ribosomal protein L11 methyltransferase Thermosipho africanus (strain TCF52B)
Q89FW1 2.12e-22 97 34 3 194 3 prmA Ribosomal protein L11 methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A9ER52 4.06e-22 97 33 6 261 3 prmA Ribosomal protein L11 methyltransferase Sorangium cellulosum (strain So ce56)
A7I0N5 6.08e-22 96 30 9 258 3 prmA Ribosomal protein L11 methyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2S4C3 9.23e-22 95 37 3 161 3 prmA Ribosomal protein L11 methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q133Y8 1.95e-21 94 34 2 194 3 prmA Ribosomal protein L11 methyltransferase Rhodopseudomonas palustris (strain BisB5)
P60093 2.81e-21 94 34 2 194 3 prmA Ribosomal protein L11 methyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q04Z65 3.56e-21 94 28 6 209 3 prmA Ribosomal protein L11 methyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04QV8 3.56e-21 94 28 6 209 3 prmA Ribosomal protein L11 methyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B3QLQ8 3.23e-20 91 33 5 176 3 prmA Ribosomal protein L11 methyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q8F6B7 3.38e-20 91 26 9 276 3 prmA Ribosomal protein L11 methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PX0 3.38e-20 91 26 9 276 3 prmA Ribosomal protein L11 methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q84BQ9 6.67e-20 89 36 4 186 1 prmA Ribosomal protein L11 methyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q11GT9 6.99e-20 90 31 4 211 3 prmA Ribosomal protein L11 methyltransferase Chelativorans sp. (strain BNC1)
Q98KD0 1.02e-19 90 34 4 209 3 prmA Ribosomal protein L11 methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8KG70 5.58e-19 88 30 6 206 3 prmA Ribosomal protein L11 methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8AAZ8 3.39e-18 85 38 1 121 3 prmA Ribosomal protein L11 methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1J043 4.43e-17 82 38 7 216 3 prmA Ribosomal protein L11 methyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
O13648 1.47e-08 58 34 2 107 1 rmt3 Ribosomal protein arginine N-methyltransferase rmt3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q57732 2.3e-08 57 50 0 51 4 MJ0284 Uncharacterized protein MJ0284 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9JWE6 6.16e-08 55 45 1 68 3 ubiG Ubiquinone biosynthesis O-methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JXI7 6.46e-08 55 45 1 68 3 ubiG Ubiquinone biosynthesis O-methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M0C4 9.16e-08 55 45 1 68 3 ubiG Ubiquinone biosynthesis O-methyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q58338 2.51e-07 53 30 2 91 3 MJ0928 Putative protein N5-glutamine methyltransferase MJ0928 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q46Y42 9.69e-06 49 40 3 77 3 ubiG Ubiquinone biosynthesis O-methyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q52892 1.66e-05 49 41 1 60 4 noeA Nodulation protein NoeA Rhizobium meliloti (strain 1021)
P38074 5.59e-05 47 38 1 60 1 HMT1 Protein arginine N-methyltransferase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FFY1 7.36e-05 46 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3SK91 7.89e-05 46 37 3 87 3 ubiG Ubiquinone biosynthesis O-methyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B0VMN8 0.000156 45 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain SDF)
B2T641 0.000159 45 39 3 76 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B0V5X4 0.00016 45 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AYE)
B7IBN2 0.00016 45 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB0057)
B7H2Y9 0.00016 45 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain AB307-0294)
Q8K1A0 0.000174 45 35 1 65 1 Mettl5 rRNA N6-adenosine-methyltransferase METTL5 Mus musculus
Q8ZZA9 0.000191 45 39 2 58 3 cbiT Probable cobalt-precorrin-6B C(15)-methyltransferase (decarboxylating) Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q9NRN9 0.000215 45 35 1 65 1 METTL5 rRNA N6-adenosine-methyltransferase METTL5 Homo sapiens
B2I023 0.000219 45 32 5 127 3 ubiG Ubiquinone biosynthesis O-methyltransferase Acinetobacter baumannii (strain ACICU)
Q9WYV8 0.000238 45 37 0 51 1 prmC Release factor glutamine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A3KP85 0.000253 45 46 0 50 2 etfbkmt Electron transfer flavoprotein beta subunit lysine methyltransferase Danio rerio
A1TSA0 0.000296 45 39 2 68 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paracidovorax citrulli (strain AAC00-1)
O26249 0.000379 44 30 3 101 1 cbiT Probable cobalt-precorrin-6B C(15)-methyltransferase (decarboxylating) Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q13VB4 0.000549 44 38 3 76 3 ubiG Ubiquinone biosynthesis O-methyltransferase Paraburkholderia xenovorans (strain LB400)
A3BMN9 0.000669 44 38 0 49 2 PRMT3 Probable protein arginine N-methyltransferase 3 Oryza sativa subsp. japonica
O60678 0.000701 44 29 2 101 1 PRMT3 Protein arginine N-methyltransferase 3 Homo sapiens
Q8MSW4 0.000704 43 44 0 45 1 Mettl5 rRNA N6-adenosine-methyltransferase Mettl5 Drosophila melanogaster
A3MZ07 0.000712 43 41 1 51 3 ubiG Ubiquinone biosynthesis O-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0V4Z1 0.000766 44 28 9 170 3 rsmC Ribosomal RNA small subunit methyltransferase C Acinetobacter baumannii (strain AYE)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS18030
Feature type CDS
Gene prmA
Product 50S ribosomal protein L11 methyltransferase
Location 3961247 - 3962128 (strand: -1)
Length 882 (nucleotides) / 293 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_826
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06325 Ribosomal protein L11 methyltransferase (PrmA)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2264 Translation, ribosomal structure and biogenesis (J) J Ribosomal protein L11 methylase PrmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02687 ribosomal protein L11 methyltransferase [EC:2.1.1.-] - -

Protein Sequence

MPWIQLRLNATSENAEAIGDELVESGAVSVTFQDSHDTPIFEPLPGETRLWGDTDVIGLYDAETDMSIIVAMLENTAVLGKGFVHKIEQLEDKDWEREWMDNFHPMRFGERLWICPSWREVPDPNAVNVMLDPGLAFGTGTHPTTSLCLQWLDGLDLAGKTVIDFGCGSGILAIAALKLGAAKAIGIDIDPQAIQASRDNAQRNGVADALTLYLAKDQPDNLSADVVVANILAGPLRELAPIISTLPRQGGHLGLSGVLATQADGVAQAYQEQFTLDPVAEKEEWCRITGVKK

Flanking regions ( +/- flanking 50bp)

TGCCTCAATCTGCTCCATTACAGTGAACTTGTTTTTAAAAGAGATTAATTATGCCTTGGATACAATTAAGACTAAATGCCACCTCAGAAAACGCCGAAGCCATTGGTGATGAGTTGGTTGAAAGTGGCGCGGTATCAGTAACCTTTCAAGATAGCCACGATACCCCTATTTTTGAGCCATTACCGGGAGAAACTCGCCTCTGGGGTGATACCGATGTTATTGGCTTATATGATGCAGAAACCGATATGAGTATCATCGTGGCTATGTTAGAAAACACGGCGGTGCTGGGTAAAGGATTTGTACATAAAATCGAACAATTAGAAGATAAAGATTGGGAGCGCGAATGGATGGATAACTTCCACCCTATGCGCTTTGGCGAACGTTTATGGATTTGCCCAAGCTGGCGTGAAGTGCCTGATCCTAACGCTGTAAATGTCATGCTCGATCCAGGTCTGGCATTTGGTACTGGTACTCACCCAACCACCTCTTTATGTCTACAATGGCTCGATGGTTTAGATCTCGCAGGTAAAACCGTTATCGACTTTGGTTGTGGCTCAGGTATTTTAGCCATTGCAGCATTAAAACTGGGGGCTGCGAAAGCGATAGGTATCGATATCGACCCACAAGCTATCCAAGCAAGTCGCGACAATGCGCAACGTAACGGTGTCGCTGATGCACTGACGCTATACCTTGCTAAAGACCAACCAGACAATCTCAGTGCCGATGTAGTGGTAGCAAATATCTTAGCTGGTCCATTACGTGAATTAGCTCCTATTATCAGCACACTGCCACGTCAAGGGGGGCATTTAGGTCTTTCCGGTGTTCTTGCCACACAAGCTGACGGTGTTGCACAAGCTTATCAAGAACAATTTACTTTAGATCCTGTGGCTGAAAAAGAAGAGTGGTGTCGTATTACCGGAGTGAAAAAATAACATAGGTTAAATATTAAACAATTTGCGATAATATTAAACAGTTAAAGTTT