Homologs in group_1410

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08710 FBDBKF_08710 82.9 Morganella morganii S1 srmB DEAD/DEAH family ATP-dependent RNA helicase
EHELCC_12815 EHELCC_12815 82.9 Morganella morganii S2 srmB DEAD/DEAH family ATP-dependent RNA helicase
NLDBIP_13155 NLDBIP_13155 82.9 Morganella morganii S4 srmB DEAD/DEAH family ATP-dependent RNA helicase
LHKJJB_13400 LHKJJB_13400 82.9 Morganella morganii S3 srmB DEAD/DEAH family ATP-dependent RNA helicase
HKOGLL_11630 HKOGLL_11630 82.9 Morganella morganii S5 srmB DEAD/DEAH family ATP-dependent RNA helicase
F4V73_RS09925 F4V73_RS09925 81.7 Morganella psychrotolerans - DEAD/DEAH family ATP-dependent RNA helicase

Distribution of the homologs in the orthogroup group_1410

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1410

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P33906 0.0 931 81 3 567 3 deaD ATP-dependent RNA helicase DeaD Klebsiella pneumoniae
P0A9P8 0.0 915 83 2 565 3 deaD ATP-dependent RNA helicase DeaD Shigella flexneri
P0A9P6 0.0 915 83 2 565 1 deaD ATP-dependent RNA helicase DeaD Escherichia coli (strain K12)
P0A9P7 0.0 915 83 2 565 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA87 0.0 914 80 3 589 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O157:H7
P57453 0.0 827 70 6 596 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9H6 0.0 796 68 4 579 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AF9 0.0 792 69 5 554 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P44586 0.0 736 62 8 612 3 deaD ATP-dependent RNA helicase DeaD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WH05 3.42e-163 481 46 5 560 1 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH04 3.42e-163 481 46 5 560 3 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q73EU1 1.14e-127 389 45 2 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPE6 1.2e-127 389 45 2 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VG0 1.2e-127 389 45 2 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus anthracis
A0R8U6 1.2e-127 389 45 2 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis (strain Al Hakam)
Q63GX5 1.45e-127 388 45 2 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ZK / E33L)
Q81IT9 2.32e-127 388 45 2 428 2 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5L3G9 7.54e-125 379 46 2 424 3 cshA DEAD-box ATP-dependent RNA helicase CshA Geobacillus kaustophilus (strain HTA426)
Q8Y8N0 9.1e-122 373 45 3 429 2 cshA ATP-dependent RNA helicase CshA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q65N62 3.39e-120 368 42 5 470 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P96614 5.34e-120 368 43 4 441 1 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus subtilis (strain 168)
Q55804 1.81e-117 361 45 3 413 1 crhR RNA helicase CrhR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9Z6C9 6.07e-113 350 43 3 426 3 cshA ATP-dependent RNA helicase CshA Limosilactobacillus reuteri
Q5HME0 4.27e-110 343 47 3 355 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49Z29 6.06e-110 342 44 3 393 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L7W0 1.41e-109 341 42 4 423 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus haemolyticus (strain JCSC1435)
Q8CRP6 2.45e-109 341 47 3 355 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7A0D2 1.48e-107 336 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MW2)
Q6G7M9 1.48e-107 336 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MSSA476)
Q7A4G0 1.48e-107 336 40 4 427 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain N315)
Q99SH6 1.48e-107 336 40 4 427 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEB9 1.48e-107 336 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain COL)
Q2FWH5 1.48e-107 336 40 4 427 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF45 1.48e-107 336 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain USA300)
Q2YUH3 1.5e-107 336 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GEZ3 2.07e-107 335 40 4 427 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MRSA252)
P0A4D8 5.97e-104 327 42 3 416 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4D7 5.97e-104 327 42 3 416 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q81DF9 1.63e-102 321 45 0 361 2 cshE DEAD-box ATP-dependent RNA helicase CshE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P42305 3.53e-101 318 43 3 384 1 dbpA ATP-dependent RNA helicase DbpA Bacillus subtilis (strain 168)
O25029 1.39e-99 315 42 2 369 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain ATCC 700392 / 26695)
B9XXL6 2.2e-99 314 42 2 369 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain B128)
Q58083 8.75e-99 308 43 6 369 1 MJ0669 Probable ATP-dependent RNA helicase MJ0669 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q814I2 2.52e-98 311 42 1 377 2 dbpA ATP-dependent RNA helicase DbpA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P25888 9e-96 304 41 2 378 1 rhlE ATP-dependent RNA helicase RhlE Escherichia coli (strain K12)
Q8Y7M8 1.33e-92 296 42 5 367 2 dbpA ATP-dependent RNA helicase DbpA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P21693 1.89e-89 287 44 2 347 1 dbpA ATP-dependent RNA helicase DbpA Escherichia coli (strain K12)
Q6CH58 2.79e-87 282 41 2 360 3 RRP3 ATP-dependent rRNA helicase RRP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q5B5E7 3.22e-86 279 40 4 377 3 rrp3 ATP-dependent rRNA helicase rrp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A3LS22 5.77e-85 276 40 2 365 3 RRP3 ATP-dependent rRNA helicase RRP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q9P6N8 2.83e-84 274 40 3 400 3 rrp3 ATP-dependent rRNA helicase rrp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P34580 4.36e-84 274 39 3 382 3 T26G10.1 Putative ATP-dependent RNA helicase T26G10.1 Caenorhabditis elegans
Q7Y183 6.58e-84 273 39 4 390 2 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. japonica
A2XKG2 6.58e-84 273 39 4 390 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. indica
O02494 9.65e-84 271 39 4 380 2 EIF4-A Eukaryotic initiation factor 4A Cryptosporidium parvum
A5DQF1 1.16e-83 273 40 2 365 3 RRP3 ATP-dependent rRNA helicase RRP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
P0CR00 2.43e-83 272 42 2 356 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CR01 2.43e-83 272 42 2 356 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q0DM51 2.43e-83 280 37 7 440 2 Os03g0827700 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Oryza sativa subsp. japonica
Q9CWX9 2.45e-83 271 38 2 391 2 Ddx47 Probable ATP-dependent RNA helicase DDX47 Mus musculus
P44701 3.6e-83 270 42 6 364 3 srmB ATP-dependent RNA helicase SrmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q29S22 3.76e-83 271 40 2 369 2 DDX47 Probable ATP-dependent RNA helicase DDX47 Bos taurus
Q0UK12 7.07e-83 273 40 5 392 3 RRP3 ATP-dependent rRNA helicase RRP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q9H0S4 1.37e-82 270 39 2 368 1 DDX47 Probable ATP-dependent RNA helicase DDX47 Homo sapiens
Q54VT4 1.85e-82 272 41 4 365 3 ddx47 Probable ATP-dependent RNA helicase ddx47 Dictyostelium discoideum
A1D405 2.6e-82 269 38 5 417 3 rrp3 ATP-dependent rRNA helicase rrp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P38712 2.61e-82 270 40 3 366 1 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7EML8 2.85e-82 270 39 6 403 3 rrp3 ATP-dependent rRNA helicase rrp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q2H1Q8 3.53e-82 270 41 3 389 3 RRP3 ATP-dependent rRNA helicase RRP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q9LUW6 3.79e-82 273 41 5 366 1 RH9 DEAD-box ATP-dependent RNA helicase 9, mitochondrial Arabidopsis thaliana
A6ZSX1 4.06e-82 270 40 3 366 3 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain YJM789)
Q9VIF6 6.01e-82 269 37 3 403 1 pths ATP-dependent RNA helicase DDX47 Drosophila melanogaster
Q4WJE9 6.66e-82 268 38 5 417 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6FNK8 9.24e-82 268 40 3 366 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B1KQF6 1.29e-81 266 39 4 379 3 rhlB ATP-dependent RNA helicase RhlB Shewanella woodyi (strain ATCC 51908 / MS32)
Q3B8Q2 1.43e-81 265 38 3 380 1 Eif4a3 Eukaryotic initiation factor 4A-III Rattus norvegicus
A6M931 1.43e-81 265 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Sus scrofa
Q2NL22 1.43e-81 265 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Bos taurus
P38919 1.49e-81 265 38 3 380 1 EIF4A3 Eukaryotic initiation factor 4A-III Homo sapiens
Q8GY84 1.81e-81 266 38 3 391 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Arabidopsis thaliana
Q91VC3 1.83e-81 265 38 3 380 1 Eif4a3 Eukaryotic initiation factor 4A-III Mus musculus
Q9LUW5 1.86e-81 271 39 5 380 1 RH53 DEAD-box ATP-dependent RNA helicase 53, mitochondrial Arabidopsis thaliana
B5FZY7 1.87e-81 265 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Taeniopygia guttata
Q5ZM36 1.92e-81 265 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Gallus gallus
A3Q9R3 1.97e-81 266 39 4 379 3 rhlB ATP-dependent RNA helicase RhlB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q6BQ61 4.37e-81 266 38 2 374 3 RRP3 ATP-dependent rRNA helicase RRP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A6VKC3 5.36e-81 264 40 4 379 3 rhlB ATP-dependent RNA helicase RhlB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4R3Q1 6.39e-81 263 38 3 380 2 EIF4A3 Eukaryotic initiation factor 4A-III Macaca fascicularis
Q6CT85 6.44e-81 266 39 3 363 3 RRP3 ATP-dependent rRNA helicase RRP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A8G0U0 6.52e-81 264 38 4 379 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sediminis (strain HAW-EB3)
Q8SR63 1.01e-80 263 35 4 392 3 RRP3 ATP-dependent rRNA helicase RRP3 Encephalitozoon cuniculi (strain GB-M1)
Q4IFI0 1.04e-80 265 39 5 391 3 RRP3 ATP-dependent rRNA helicase RRP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q75EW9 1.12e-80 265 38 3 378 3 RRP3 ATP-dependent rRNA helicase RRP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7TS37 1.26e-80 266 39 3 366 3 RRP3 ATP-dependent rRNA helicase RRP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P27639 1.45e-80 262 38 2 374 2 inf-1 Eukaryotic initiation factor 4A Caenorhabditis elegans
A6RW56 2.03e-80 265 40 6 376 3 rrp3 ATP-dependent rRNA helicase rrp3 Botryotinia fuckeliana (strain B05.10)
Q7ZVA6 3.02e-80 261 38 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Danio rerio
Q5ACU6 3.43e-80 265 38 2 374 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A1D6LAB7 3.56e-80 271 38 5 405 2 RH3B DEAD-box ATP-dependent RNA helicase 3B, chloroplastic Zea mays
Q0CIQ3 4.91e-80 262 38 3 393 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A6QRQ7 6.1e-80 263 39 3 375 3 RRP3 ATP-dependent rRNA helicase RRP3 Ajellomyces capsulatus (strain NAm1 / WU24)
B7ZTW1 6.11e-80 261 38 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Xenopus tropicalis
Q55D61 6.84e-80 261 36 3 385 3 tifA Eukaryotic initiation factor 4A Dictyostelium discoideum
A8GZJ0 7.83e-80 261 38 5 381 3 rhlB ATP-dependent RNA helicase RhlB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9VHS8 8.07e-80 260 37 3 380 1 CG7483 Eukaryotic initiation factor 4A-III Drosophila melanogaster
Q8EJQ5 8.34e-80 261 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q088J2 1.06e-79 261 39 5 372 3 rhlB ATP-dependent RNA helicase RhlB Shewanella frigidimarina (strain NCIMB 400)
B0TJ29 1.09e-79 261 38 4 372 3 rhlB ATP-dependent RNA helicase RhlB Shewanella halifaxensis (strain HAW-EB4)
A5E1W4 1.1e-79 264 39 8 381 3 DBP3 ATP-dependent RNA helicase DBP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
O42226 1.29e-79 260 37 3 380 2 eif4a3-b Eukaryotic initiation factor 4A-III-B Xenopus laevis
A2RB17 1.48e-79 262 40 3 375 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4P3U9 1.97e-79 264 39 2 364 3 RRP3 ATP-dependent rRNA helicase RRP3 Ustilago maydis (strain 521 / FGSC 9021)
B5DG42 2.19e-79 259 37 3 380 2 eif4a3 Eukaryotic initiation factor 4A-III Salmo salar
A0A1D6GDY8 3.09e-79 268 38 4 394 3 RH3A DEAD-box ATP-dependent RNA helicase 3A, chloroplastic Zea mays
A1RFB3 3.13e-79 260 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain W3-18-1)
A4YB09 3.13e-79 260 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q0HQL1 3.2e-79 260 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-7)
Q0HN76 3.2e-79 260 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-4)
A1SAL1 3.71e-79 260 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12S35 4.01e-79 259 38 4 372 3 rhlB ATP-dependent RNA helicase RhlB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0KS84 4.68e-79 259 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain ANA-3)
Q88NB7 5.18e-79 258 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1CR32 6.46e-79 260 37 5 417 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
B8CHZ1 9.38e-79 259 37 5 381 3 rhlB ATP-dependent RNA helicase RhlB Shewanella piezotolerans (strain WP3 / JCM 13877)
A9L5D5 1.03e-78 259 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS195)
A6WTD3 1.03e-78 259 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS185)
A3D9I5 1.03e-78 259 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E670 1.03e-78 259 38 4 380 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS223)
Q5U526 1.04e-78 258 37 3 380 2 eif4a3-a Eukaryotic initiation factor 4A-III-A Xenopus laevis
Q8PFZ3 1.31e-78 262 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas axonopodis pv. citri (strain 306)
Q3BNH8 1.31e-78 262 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GUR8 1.32e-78 263 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q6C347 1.72e-78 257 36 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Yarrowia lipolytica (strain CLIB 122 / E 150)
A4RGD1 1.9e-78 261 41 3 358 3 RRP3 ATP-dependent rRNA helicase RRP3 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q8P4D4 2.06e-78 262 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWT6 2.06e-78 262 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain B100)
Q4UPY5 2.06e-78 262 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain 8004)
Q1E1N5 3.23e-78 258 39 3 378 3 RRP3 ATP-dependent rRNA helicase RRP3 Coccidioides immitis (strain RS)
Q2UNB7 4.2e-78 258 38 4 400 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q6CXT4 1.04e-77 254 39 2 374 3 TIF1 ATP-dependent RNA helicase eIF4A Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q7RY59 1.34e-77 258 39 3 375 3 rrp-3 ATP-dependent rRNA helicase rrp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5VNM3 1.64e-77 254 37 4 388 1 EIF4A3A Eukaryotic initiation factor 4A-III homolog A Oryza sativa subsp. japonica
Q9BUQ8 2.14e-77 265 40 5 379 1 DDX23 Probable ATP-dependent RNA helicase DDX23 Homo sapiens
Q0I1X0 2.22e-77 254 39 3 379 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 129Pt)
Q887N8 2.73e-77 254 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q10I26 2.85e-77 254 37 4 388 1 EIF4A3B Eukaryotic initiation factor 4A-III homolog B Oryza sativa subsp. japonica
Q40470 3.21e-77 254 39 3 380 2 None Eukaryotic initiation factor 4A-7 Nicotiana tabacum
Q6CX73 3.54e-77 253 37 4 371 3 FAL1 ATP-dependent RNA helicase FAL1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6Z2Z4 3.63e-77 254 39 3 380 1 Os02g0146600 Eukaryotic initiation factor 4A-3 Oryza sativa subsp. japonica
P41382 4.46e-77 254 39 3 380 2 None Eukaryotic initiation factor 4A-10 Nicotiana tabacum
P35683 5.85e-77 253 38 3 384 2 Os06g0701100 Eukaryotic initiation factor 4A-1 Oryza sativa subsp. japonica
A6ZRX0 6.2e-77 257 38 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain YJM789)
P24783 6.27e-77 257 38 6 375 1 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0INC5 6.6e-77 263 40 5 363 2 Os12g0481100 DEAD-box ATP-dependent RNA helicase 28 Oryza sativa subsp. japonica
Q8SRB2 7.06e-77 256 40 4 338 3 DBP2 ATP-dependent RNA helicase DBP2 Encephalitozoon cuniculi (strain GB-M1)
Q9Y6V7 7.15e-77 255 37 6 409 1 DDX49 Probable ATP-dependent RNA helicase DDX49 Homo sapiens
Q755N4 9e-77 257 39 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6FLF3 9.17e-77 257 39 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4FZF3 9.75e-77 255 36 6 409 2 Ddx49 Probable ATP-dependent RNA helicase DDX49 Mus musculus
Q0ILZ4 1.02e-76 259 39 6 381 2 Os12g0611200 DEAD-box ATP-dependent RNA helicase 9 Oryza sativa subsp. japonica
Q59LU0 1.12e-76 257 38 5 375 3 DBP2 ATP-dependent RNA helicase DBP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P41380 1.32e-76 251 36 3 380 2 None Eukaryotic initiation factor 4A-3 Nicotiana plumbaginifolia
C4LB49 1.92e-76 252 38 4 378 3 rhlB ATP-dependent RNA helicase RhlB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B5FF87 2.01e-76 253 36 3 388 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain MJ11)
Q9HXE5 2.13e-76 251 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S21 2.13e-76 251 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UUT0 2.13e-76 251 37 5 382 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain LESB58)
Q2HFP1 2.15e-76 251 39 4 387 3 TIF1 ATP-dependent RNA helicase eIF4A Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q5RC67 2.24e-76 262 40 5 379 2 DDX23 Probable ATP-dependent RNA helicase DDX23 Pongo abelii
Q4P184 2.24e-76 251 36 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Ustilago maydis (strain 521 / FGSC 9021)
Q5E8U5 2.41e-76 252 36 3 388 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q40471 3.05e-76 251 38 3 384 2 None Eukaryotic initiation factor 4A-9 Nicotiana tabacum
Q40467 3.47e-76 251 38 3 380 2 None Eukaryotic initiation factor 4A-14 Nicotiana tabacum
B0UUZ9 3.62e-76 251 38 3 379 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 2336)
Q94A52 3.83e-76 251 35 3 380 1 EIF4A3 Eukaryotic initiation factor 4A-III homolog Arabidopsis thaliana
Q10202 5.15e-76 256 40 9 383 3 dbp3 ATP-dependent RNA helicase dbp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1SZG4 5.96e-76 251 36 3 381 3 rhlB ATP-dependent RNA helicase RhlB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q5APT8 7.09e-76 255 39 9 379 3 DBP3 ATP-dependent RNA helicase DBP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9CJS1 7.31e-76 251 40 4 384 3 rhlB ATP-dependent RNA helicase RhlB Pasteurella multocida (strain Pm70)
P41378 9.33e-76 250 38 3 384 2 None Eukaryotic initiation factor 4A Triticum aestivum
Q0UU86 9.38e-76 249 40 4 387 3 TIF1 ATP-dependent RNA helicase eIF4A Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q41741 9.76e-76 250 38 3 380 2 None Eukaryotic initiation factor 4A Zea mays
Q9ZRZ8 1.06e-75 260 37 7 408 2 RH28 DEAD-box ATP-dependent RNA helicase 28 Arabidopsis thaliana
Q84UQ1 1.33e-75 264 38 7 379 2 Os08g0159900 DEAD-box ATP-dependent RNA helicase 42 Oryza sativa subsp. japonica
A5DAC8 1.42e-75 253 39 7 363 3 DBP3 ATP-dependent RNA helicase DBP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q40465 1.6e-75 249 38 3 380 2 None Eukaryotic initiation factor 4A-11 Nicotiana tabacum
P0CQ72 1.83e-75 249 36 3 379 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ73 1.83e-75 249 36 3 379 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q0CXD0 2.56e-75 248 40 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P41379 2.75e-75 249 38 3 380 2 None Eukaryotic initiation factor 4A-2 Nicotiana plumbaginifolia
Q40468 2.75e-75 249 38 3 380 2 None Eukaryotic initiation factor 4A-15 Nicotiana tabacum
P41381 3.12e-75 249 38 3 380 2 None Eukaryotic initiation factor 4A-8 Nicotiana tabacum
A1C6C4 3.16e-75 253 38 6 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q2U070 3.24e-75 253 38 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P41376 3.41e-75 249 38 3 380 1 EIF4A1 Eukaryotic initiation factor 4A-1 Arabidopsis thaliana
Q7RV88 3.54e-75 248 40 3 381 3 tif-1 ATP-dependent RNA helicase eIF4A Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A5DE68 3.98e-75 248 36 2 366 3 FAL1 ATP-dependent RNA helicase FAL1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q2U6P7 4.5e-75 249 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P09052 4.52e-75 255 40 5 358 1 vas ATP-dependent RNA helicase vasa Drosophila melanogaster
Q7MYL2 5.05e-75 249 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
O22907 5.37e-75 257 42 6 358 1 RH24 DEAD-box ATP-dependent RNA helicase 24 Arabidopsis thaliana
P0CQ76 6.44e-75 252 39 6 374 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ77 6.44e-75 252 39 6 374 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P20447 6.87e-75 251 39 8 378 1 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6CZD9 8.5e-75 248 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6ZUA1 9.82e-75 251 39 8 378 3 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain YJM789)
Q0D8N0 1.04e-74 253 40 8 382 2 Os07g0143700 DEAD-box ATP-dependent RNA helicase 53 Oryza sativa subsp. japonica
Q8W4R3 1.07e-74 253 40 4 365 1 RH30 DEAD-box ATP-dependent RNA helicase 30 Arabidopsis thaliana
A1DGZ7 1.48e-74 251 37 5 381 3 dbp2 ATP-dependent RNA helicase dbp2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
B6EPA4 1.59e-74 248 36 3 388 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio salmonicida (strain LFI1238)
Q5B948 1.65e-74 246 39 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9CAI7 1.68e-74 247 37 3 380 1 TIF4A-3 Eukaryotic initiation factor 4A-3 Arabidopsis thaliana
Q5B0J9 1.7e-74 251 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A2QC74 1.87e-74 251 37 5 382 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A4QVP2 1.91e-74 246 39 3 381 3 TIF1 ATP-dependent RNA helicase eIF4A Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
C6DHF5 1.97e-74 247 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A5UI36 1.99e-74 247 39 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittGG)
A5UDI1 2.03e-74 247 39 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittEE)
A1D7N3 2.04e-74 246 40 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A7EGL7 2.08e-74 246 39 4 387 3 tif1 ATP-dependent RNA helicase eIF4A Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q6CDV4 2.22e-74 246 38 2 378 3 TIF1 ATP-dependent RNA helicase eIF4A Yarrowia lipolytica (strain CLIB 122 / E 150)
A6R603 2.22e-74 248 37 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Ajellomyces capsulatus (strain NAm1 / WU24)
Q18212 2.39e-74 247 36 4 368 1 hel-1 Spliceosome RNA helicase DDX39B homolog Caenorhabditis elegans
Q6BY27 2.4e-74 250 38 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A1CJT5 2.47e-74 246 40 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A8G828 2.65e-74 247 38 3 389 3 rhlB ATP-dependent RNA helicase RhlB Serratia proteamaculans (strain 568)
A1C595 3.04e-74 246 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q7MGP7 3.04e-74 247 36 3 388 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain YJ016)
Q15N18 3.12e-74 246 38 3 378 3 rhlB ATP-dependent RNA helicase RhlB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7SH33 3.71e-74 261 39 6 372 3 prp-5 Pre-mRNA-processing ATP-dependent RNA helicase prp-5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1CMQ7 3.9e-74 247 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A6RJ45 3.93e-74 245 39 4 387 3 tif1 ATP-dependent RNA helicase eIF4A Botryotinia fuckeliana (strain B05.10)
Q8DDN6 3.96e-74 246 36 3 388 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain CMCP6)
Q4X195 4.03e-74 250 38 5 362 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q87KH5 4.27e-74 246 36 4 390 3 rhlB ATP-dependent RNA helicase RhlB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9P735 4.29e-74 245 35 3 381 3 fal-1 ATP-dependent RNA helicase fal-1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A2R0B5 4.31e-74 246 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A5AAE5 5.04e-74 245 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QEN5 5.39e-74 245 39 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q6FJG1 5.49e-74 245 35 5 372 3 FAL1 ATP-dependent RNA helicase FAL1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A7E449 5.53e-74 250 40 7 359 3 dbp2 ATP-dependent RNA helicase dbp2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A7TEF4 5.84e-74 245 35 5 375 3 FAL1 ATP-dependent RNA helicase FAL1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A1D071 5.91e-74 245 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q2UAK1 6.18e-74 245 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A1DL85 6.2e-74 246 37 5 369 3 sub2 ATP-dependent RNA helicase sub2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q12099 7.07e-74 245 36 5 377 1 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXY5 7.07e-74 245 36 5 377 3 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain YJM789)
Q1DQ20 8.48e-74 244 40 3 377 3 TIF1 ATP-dependent RNA helicase eIF4A Coccidioides immitis (strain RS)
A5DL80 9.19e-74 249 38 6 375 3 DBP2 ATP-dependent RNA helicase DBP2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
P0CQ70 9.34e-74 244 38 3 379 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ71 9.34e-74 244 38 3 379 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q6CIV2 9.49e-74 249 38 7 376 3 DBP2 ATP-dependent RNA helicase DBP2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P87206 9.97e-74 244 40 2 365 3 TIF1 ATP-dependent RNA helicase eIF4A Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5QMN3 1.02e-73 247 38 5 360 3 Os01g0197200 DEAD-box ATP-dependent RNA helicase 20 Oryza sativa subsp. japonica
Q4WEB4 1.13e-73 244 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q99MJ9 1.16e-73 253 38 9 387 2 Ddx50 ATP-dependent RNA helicase DDX50 Mus musculus
A5E6W6 1.21e-73 247 38 7 375 3 RRP3 ATP-dependent rRNA helicase RRP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q6C4D4 1.24e-73 249 38 8 378 3 DBP2 ATP-dependent RNA helicase DBP2 Yarrowia lipolytica (strain CLIB 122 / E 150)
A4QU31 1.41e-73 244 34 3 381 3 FAL1 ATP-dependent RNA helicase FAL1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P41377 1.41e-73 244 37 3 384 1 TIF4A-2 Eukaryotic initiation factor 4A-2 Arabidopsis thaliana
Q879Y6 1.58e-73 248 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A5DB98 1.61e-73 244 39 2 375 3 TIF1 ATP-dependent RNA helicase eIF4A Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q0CAS8 1.61e-73 244 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A6S4N4 1.63e-73 244 34 4 392 3 fal1 ATP-dependent RNA helicase fal1 Botryotinia fuckeliana (strain B05.10)
A7EM88 1.72e-73 244 34 4 392 3 fal1 ATP-dependent RNA helicase fal1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q9BQ39 1.9e-73 253 39 9 387 1 DDX50 ATP-dependent RNA helicase DDX50 Homo sapiens
Q5AUL4 2.1e-73 243 35 3 381 3 fal1 ATP-dependent RNA helicase fal1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2UPY3 2.34e-73 244 39 3 377 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q8VDW0 2.56e-73 244 35 5 382 1 Ddx39a ATP-dependent RNA helicase DDX39A Mus musculus
A4WG30 2.8e-73 244 36 3 390 3 rhlB ATP-dependent RNA helicase RhlB Enterobacter sp. (strain 638)
O00148 2.85e-73 244 35 5 382 1 DDX39A ATP-dependent RNA helicase DDX39A Homo sapiens
A6SFW7 2.98e-73 248 39 7 359 3 dbp2 ATP-dependent RNA helicase dbp2 Botryotinia fuckeliana (strain B05.10)
A1A4H6 3.26e-73 253 37 6 378 2 DDX27 Probable ATP-dependent RNA helicase DDX27 Bos taurus
Q5WR10 3.35e-73 244 35 5 382 3 DDX39B Spliceosome RNA helicase DDX39B Canis lupus familiaris
A3GFI4 3.36e-73 243 39 2 365 3 TIF1 ATP-dependent RNA helicase eIF4A Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5U216 3.74e-73 244 35 5 382 2 Ddx39a ATP-dependent RNA helicase DDX39A Rattus norvegicus
Q3T147 3.77e-73 244 35 5 382 2 DDX39B Spliceosome RNA helicase DDX39B Bos taurus
Q5ZHZ0 3.93e-73 244 35 5 382 2 DDX39B Spliceosome RNA helicase DDX39B Gallus gallus
Q5RE47 3.97e-73 244 35 5 382 2 DDX39B Spliceosome RNA helicase DDX39B Pongo abelii
Q29024 3.97e-73 244 35 5 382 3 DDX39B Spliceosome RNA helicase DDX39B Sus scrofa
P60024 3.97e-73 244 35 5 382 3 DDX39B Spliceosome RNA helicase DDX39B Pan troglodytes
Q5TM17 3.97e-73 244 35 5 382 3 DDX39B Spliceosome RNA helicase DDX39B Macaca mulatta
Q13838 3.97e-73 244 35 5 382 1 DDX39B Spliceosome RNA helicase DDX39B Homo sapiens
Q6BT27 4.03e-73 243 35 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q63413 4.14e-73 244 35 5 382 2 Ddx39b Spliceosome RNA helicase Ddx39b Rattus norvegicus
Q9Z1N5 4.14e-73 244 35 5 382 1 Ddx39b Spliceosome RNA helicase Ddx39b Mus musculus
Q4P331 4.34e-73 243 38 3 379 3 TIF1 ATP-dependent RNA helicase eIF4A Ustilago maydis (strain 521 / FGSC 9021)
A5DWJ1 4.53e-73 243 35 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q4IAA0 4.64e-73 243 34 3 381 3 FAL1 ATP-dependent RNA helicase FAL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A2QFL3 4.65e-73 246 37 8 380 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4R8K5 5.57e-73 243 38 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Macaca fascicularis
G0SFM2 6.58e-73 247 38 5 370 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q8Y755 7.02e-73 243 35 2 374 2 cshB DEAD-box ATP-dependent RNA helicase CshB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A5DDF4 7.96e-73 253 38 13 412 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q4WX43 9.54e-73 242 40 3 369 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0JM17 1.07e-72 243 36 4 368 1 AIP1 DEAD-box ATP-dependent RNA helicase 56 Oryza sativa subsp. japonica
P60843 1.23e-72 242 38 4 381 1 Eif4a1 Eukaryotic initiation factor 4A-I Mus musculus
P60842 1.23e-72 242 38 4 381 1 EIF4A1 Eukaryotic initiation factor 4A-I Homo sapiens
Q3SZ54 1.23e-72 242 38 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Bos taurus
P29562 1.24e-72 241 38 4 381 1 EIF4A1 Eukaryotic initiation factor 4A-I (Fragment) Oryctolagus cuniculus
Q329V8 1.27e-72 242 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shigella dysenteriae serotype 1 (strain Sd197)
A4STJ7 1.36e-72 242 38 5 379 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas salmonicida (strain A449)
Q10055 1.42e-72 241 33 4 391 1 tif412 ATP-dependent RNA helicase fal1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5JK84 1.44e-72 242 36 4 368 1 AIP2 DEAD-box ATP-dependent RNA helicase 15 Oryza sativa subsp. japonica
P21507 1.5e-72 243 38 6 398 1 srmB ATP-dependent RNA helicase SrmB Escherichia coli (strain K12)
Q5A9Z6 1.62e-72 241 34 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q96GQ7 1.74e-72 251 35 9 432 1 DDX27 Probable ATP-dependent RNA helicase DDX27 Homo sapiens
A4QSS5 1.89e-72 245 37 5 383 3 DBP2 ATP-dependent RNA helicase DBP2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q1DP69 1.89e-72 245 39 8 374 3 DBP2 ATP-dependent RNA helicase DBP2 Coccidioides immitis (strain RS)
Q6C9P3 2.02e-72 245 40 11 377 3 DBP3 ATP-dependent RNA helicase DBP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4WCW2 2.06e-72 243 36 6 376 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0KEG9 2.47e-72 242 38 4 371 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q02748 2.54e-72 241 37 3 379 1 eIF4A Eukaryotic initiation factor 4A Drosophila melanogaster
A6TGG9 2.69e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4F1V3 2.74e-72 241 36 3 378 3 rhlB ATP-dependent RNA helicase RhlB Proteus mirabilis (strain HI4320)
B1LLV3 3.29e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SMS-3-5 / SECEC)
Q4PHU9 3.39e-72 245 38 7 378 3 DBP2 ATP-dependent RNA helicase DBP2 Ustilago maydis (strain 521 / FGSC 9021)
Q6BRN4 3.68e-72 240 39 2 366 3 TIF1 ATP-dependent RNA helicase eIF4A Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A6RGE3 3.74e-72 244 37 5 387 3 DBP2 ATP-dependent RNA helicase DBP2 Ajellomyces capsulatus (strain NAm1 / WU24)
B7LU75 3.81e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q2NQB2 3.82e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Sodalis glossinidius (strain morsitans)
A7MXT4 3.95e-72 241 36 5 393 3 rhlB ATP-dependent RNA helicase RhlB Vibrio campbellii (strain ATCC BAA-1116)
Q9PA24 4.03e-72 244 38 5 387 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain 9a5c)
B7NTG2 4.1e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q5R5F5 4.22e-72 240 38 4 378 2 EIF4A1 Eukaryotic initiation factor 4A-I Pongo abelii
Q6BLU9 4.38e-72 245 35 8 400 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
B5YY28 4.42e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3YVI4 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shigella sonnei (strain Ss046)
P0A8K0 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri
Q1R4F9 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain UTI89 / UPEC)
B6I4B6 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SE11)
P0A8J8 4.46e-72 241 37 3 378 1 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12)
B1IWC0 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8J9 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU3 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHV0 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O1:K1 / APEC
A8A6N4 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O9:H4 (strain HS)
B1X9Z4 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / DH10B)
C4ZZ48 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5C7 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O8 (strain IAI1)
B7MR01 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O81 (strain ED1a)
B7L8B6 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain 55989 / EAEC)
B7MGJ1 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN5 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTY2 4.46e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q65RG7 4.78e-72 241 40 3 377 3 rhlB ATP-dependent RNA helicase RhlB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C3LQR1 4.8e-72 241 35 3 389 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain M66-2)
Q9KV52 4.8e-72 241 35 3 389 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R4 4.8e-72 241 35 3 389 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7NF85 4.85e-72 241 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A5A6N4 5.66e-72 240 38 4 381 2 EIF4A1 Eukaryotic initiation factor 4A-I Pan troglodytes
A5DVM3 5.91e-72 239 38 3 366 3 TIF1 ATP-dependent RNA helicase eIF4A Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A1CX72 5.92e-72 250 35 7 420 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q755W0 6.01e-72 239 35 5 373 3 FAL1 ATP-dependent RNA helicase FAL1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q921N6 6.53e-72 249 35 8 431 1 Ddx27 Probable ATP-dependent RNA helicase DDX27 Mus musculus
Q9C718 6.69e-72 243 36 5 366 2 RH20 DEAD-box ATP-dependent RNA helicase 20 Arabidopsis thaliana
Q1DTB3 6.73e-72 239 35 3 380 3 FAL1 ATP-dependent RNA helicase FAL1 Coccidioides immitis (strain RS)
Q2H720 6.91e-72 244 36 5 384 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A8ACT3 8.04e-72 240 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5AWA6 8.32e-72 242 38 9 379 3 dbp3 ATP-dependent RNA helicase dbp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1C5V3 8.58e-72 243 36 8 381 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
B5XYY9 9.03e-72 240 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae (strain 342)
A9MJ29 9.22e-72 240 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9C8J1 9.76e-72 239 35 3 372 2 RH34 DEAD-box ATP-dependent RNA helicase 34 Arabidopsis thaliana
Q8XAT4 9.93e-72 240 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7
Q755A5 1.05e-71 243 37 8 379 3 DBP3 ATP-dependent RNA helicase DBP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
B5BIS9 1.11e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi A (strain AKU_12601)
Q2GWJ5 1.12e-71 239 35 3 362 3 FAL1 ATP-dependent RNA helicase FAL1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q10MH8 1.14e-71 248 39 6 358 2 Os03g0308500 DEAD-box ATP-dependent RNA helicase 24 Oryza sativa subsp. japonica
Q75BL8 1.2e-71 239 38 2 373 3 TIF1 ATP-dependent RNA helicase eIF4A Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P44922 1.37e-71 239 39 4 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2HAD8 1.41e-71 253 38 9 384 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q4WPE9 1.5e-71 249 36 6 400 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q31UK5 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 4 (strain Sb227)
B2TU12 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P0A2P0 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P1 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhi
B4TNT3 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella schwarzengrund (strain CVM19633)
C0Q2V9 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi C (strain RKS4594)
A9MXF3 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ26 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella newport (strain SL254)
B4TB13 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella heidelberg (strain SL476)
B5RFS3 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVH2 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella enteritidis PT4 (strain P125109)
Q57HT6 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella choleraesuis (strain SC-B67)
B5EZ40 1.73e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella agona (strain SL483)
Q1DI07 1.78e-71 240 37 5 369 3 SUB2 ATP-dependent RNA helicase SUB2 Coccidioides immitis (strain RS)
A5DIP0 1.91e-71 243 34 2 369 3 DHH1 ATP-dependent RNA helicase DHH1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A7MQI2 2.03e-71 239 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Cronobacter sakazakii (strain ATCC BAA-894)
Q6YS30 2.23e-71 241 37 8 378 2 Os07g0301200 DEAD-box ATP-dependent RNA helicase 5 Oryza sativa subsp. japonica
P93008 2.34e-71 247 36 3 386 2 RH21 DEAD-box ATP-dependent RNA helicase 21 Arabidopsis thaliana
A1DG51 2.63e-71 241 37 8 381 3 dbp3 ATP-dependent RNA helicase dbp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4E162 2.83e-71 238 37 1 378 3 Tc00.1047053511585.190 Probable eukaryotic initiation factor 4A Trypanosoma cruzi (strain CL Brener)
A6QSQ0 2.85e-71 239 35 3 374 3 FAL1 ATP-dependent RNA helicase FAL1 Ajellomyces capsulatus (strain NAm1 / WU24)
Q0D1K3 3.09e-71 253 36 8 435 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B2VG58 3.34e-71 239 37 3 377 3 rhlB ATP-dependent RNA helicase RhlB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A3GFV3 3.48e-71 238 33 3 372 3 FAL1 ATP-dependent RNA helicase FAL1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q7SBC6 3.93e-71 242 38 5 353 3 drh-1 ATP-dependent RNA helicase dbp2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5BCU6 4.51e-71 247 35 6 405 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q53RK8 4.56e-71 246 37 3 367 2 Os03g0708600 DEAD-box ATP-dependent RNA helicase 21 Oryza sativa subsp. japonica
Q9NR30 4.63e-71 247 37 9 390 1 DDX21 Nucleolar RNA helicase 2 Homo sapiens
A4R715 4.68e-71 241 34 2 369 3 DHH1 ATP-dependent RNA helicase DHH1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B1JQ11 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G19 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRC8 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis (strain Pestoides F)
Q1CNK3 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAD8 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis
B2K046 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBQ4 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD47 4.86e-71 238 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P24782 5.23e-71 242 37 8 379 2 dbp2 ATP-dependent RNA helicase dbp2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5QYF8 5.83e-71 238 36 3 385 3 rhlB ATP-dependent RNA helicase RhlB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A7TJ36 5.86e-71 241 37 9 382 3 DBP3 ATP-dependent RNA helicase DBP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q0SYX0 6e-71 238 37 3 377 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri serotype 5b (strain 8401)
Q6LLL5 6.01e-71 238 36 4 380 3 rhlB ATP-dependent RNA helicase RhlB Photobacterium profundum (strain SS9)
Q3MSQ8 6.3e-71 246 38 6 383 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Pelophylax lessonae
Q5RKI1 6.35e-71 237 38 4 380 1 Eif4a2 Eukaryotic initiation factor 4A-II Rattus norvegicus
Q5R4X1 6.35e-71 237 38 4 380 2 EIF4A2 Eukaryotic initiation factor 4A-II Pongo abelii
P10630 6.35e-71 237 38 4 380 1 Eif4a2 Eukaryotic initiation factor 4A-II Mus musculus
Q14240 6.35e-71 237 38 4 380 1 EIF4A2 Eukaryotic initiation factor 4A-II Homo sapiens
Q3SZ65 6.35e-71 237 38 4 380 2 EIF4A2 Eukaryotic initiation factor 4A-II Bos taurus
Q9JIK5 7.62e-71 248 38 9 390 1 Ddx21 Nucleolar RNA helicase 2 Mus musculus
Q3B8Q1 8.14e-71 246 37 9 390 2 Ddx21 Nucleolar RNA helicase 2 Rattus norvegicus
P47943 9.01e-71 236 38 3 380 1 tif1 ATP-dependent RNA helicase eIF4A Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6BZ77 1.04e-70 240 38 7 357 3 DBP3 ATP-dependent RNA helicase DBP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q501J6 1.14e-70 243 36 5 379 1 Ddx17 Probable ATP-dependent RNA helicase DDX17 Mus musculus
Q8JFP1 1.18e-70 236 38 4 380 2 EIF4A2 Eukaryotic initiation factor 4A-II Gallus gallus
B7VME9 1.18e-70 238 35 3 378 3 rhlB ATP-dependent RNA helicase RhlB Vibrio atlanticus (strain LGP32)
Q54CE0 1.28e-70 246 36 9 395 3 ddx17 Probable ATP-dependent RNA helicase ddx17 Dictyostelium discoideum
A1CHL3 1.52e-70 246 36 6 400 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q6FS54 1.52e-70 240 38 7 359 3 DBP3 ATP-dependent RNA helicase DBP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q54TJ4 1.67e-70 246 35 5 362 3 ddx27 Probable ATP-dependent RNA helicase ddx27 Dictyostelium discoideum
A6R3R5 2.17e-70 235 40 4 353 3 TIF1 ATP-dependent RNA helicase eIF4A Ajellomyces capsulatus (strain NAm1 / WU24)
Q4IF76 2.22e-70 240 38 7 374 3 DBP2 ATP-dependent RNA helicase DBP2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4TVV3 2.23e-70 249 36 6 392 2 ddx46 Probable ATP-dependent RNA helicase DDX46 Danio rerio
Q2UH00 2.32e-70 246 35 9 425 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q1DMX8 2.41e-70 246 37 8 403 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Coccidioides immitis (strain RS)
Q8H136 3.1e-70 241 38 5 357 1 RH14 DEAD-box ATP-dependent RNA helicase 14 Arabidopsis thaliana
Q6FQQ6 3.46e-70 235 37 3 365 3 TIF1 ATP-dependent RNA helicase eIF4A Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O62591 3.51e-70 235 37 1 377 3 LmjF.01.0770 Probable eukaryotic initiation factor 4A Leishmania major
A4HRK0 3.51e-70 235 37 1 377 3 LinJ01.0780 Probable eukaryotic initiation factor 4A Leishmania infantum
B5FN74 3.77e-70 236 37 3 378 3 rhlB ATP-dependent RNA helicase RhlB Salmonella dublin (strain CT_02021853)
A2QIL2 3.78e-70 245 36 6 396 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9LYJ9 3.99e-70 242 37 6 377 2 RH46 DEAD-box ATP-dependent RNA helicase 46 Arabidopsis thaliana
Q2R1M8 4.14e-70 241 37 4 388 3 Os11g0599500 DEAD-box ATP-dependent RNA helicase 52C Oryza sativa subsp. japonica
A6QXC1 4.15e-70 238 36 7 381 3 DBP3 ATP-dependent RNA helicase DBP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q0CGJ9 4.83e-70 236 36 6 369 3 sub2 ATP-dependent RNA helicase sub2 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P10081 4.86e-70 234 38 3 365 1 TIF1 ATP-dependent RNA helicase eIF4A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZQJ1 4.86e-70 234 38 3 365 3 TIF1 ATP-dependent RNA helicase eIF4A Saccharomyces cerevisiae (strain YJM789)
Q4WH83 5.06e-70 238 36 8 381 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5VQL1 5.66e-70 243 37 6 370 2 Os01g0172200 DEAD-box ATP-dependent RNA helicase 14 Oryza sativa subsp. japonica
Q4IJH1 5.74e-70 239 38 6 366 3 DBP3 ATP-dependent RNA helicase DBP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8H0U8 5.91e-70 249 37 4 369 1 RH42 DEAD-box ATP-dependent RNA helicase 42 Arabidopsis thaliana
Q38F76 6.5e-70 234 37 1 378 3 Tb09.160.3270 Probable eukaryotic initiation factor 4A Trypanosoma brucei brucei (strain 927/4 GUTat10.1)
Q2GQ93 6.5e-70 238 34 2 369 3 DHH1 ATP-dependent RNA helicase DHH1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
C4K8M8 7.06e-70 235 35 4 395 3 rhlB ATP-dependent RNA helicase RhlB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q92841 7.31e-70 243 36 5 368 1 DDX17 Probable ATP-dependent RNA helicase DDX17 Homo sapiens
Q4R4Y9 8.23e-70 234 37 4 380 2 EIF4A2 Eukaryotic initiation factor 4A-II Macaca fascicularis
Q26696 8.72e-70 239 37 6 358 3 HEL64 Putative DEAD-box RNA helicase HEL64 Trypanosoma brucei brucei
Q25225 8.85e-70 234 37 1 377 3 LbrM01_V2.0740 Probable eukaryotic initiation factor 4A Leishmania braziliensis
P46942 9.75e-70 240 38 7 357 2 None ATP-dependent RNA helicase-like protein DB10 Nicotiana sylvestris
A4QYM6 1.12e-69 243 32 8 474 3 DRS1 ATP-dependent RNA helicase DRS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A7EYW0 1.3e-69 239 37 8 381 3 dbp3 ATP-dependent RNA helicase dbp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q9DBN9 1.71e-69 239 36 5 387 1 Ddx59 Probable ATP-dependent RNA helicase DDX59 Mus musculus
Q6Z4K6 1.77e-69 240 37 4 386 2 PL10B DEAD-box ATP-dependent RNA helicase 52B Oryza sativa subsp. japonica
Q8L7S8 1.82e-69 242 36 5 385 1 RH3 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Arabidopsis thaliana
A6SCT6 1.85e-69 239 37 8 381 3 dbp3 ATP-dependent RNA helicase dbp3 Botryotinia fuckeliana (strain B05.10)
Q62780 1.95e-69 246 38 6 370 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Rattus norvegicus
Q5ASK8 1.97e-69 234 36 6 369 3 sub2 ATP-dependent RNA helicase sub2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5R6D8 1.99e-69 246 38 6 370 2 DDX46 Probable ATP-dependent RNA helicase DDX46 Pongo abelii
Q5JKF2 2.03e-69 243 38 5 366 2 Os01g0549400 DEAD-box ATP-dependent RNA helicase 40 Oryza sativa subsp. japonica
Q569Z5 2.09e-69 246 38 6 370 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Mus musculus
Q9P7C7 2.15e-69 246 37 6 374 1 prp11 Pre-mRNA-processing ATP-dependent RNA helicase prp11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P17844 2.23e-69 239 36 4 353 1 DDX5 Probable ATP-dependent RNA helicase DDX5 Homo sapiens
Q39189 2.25e-69 240 36 12 459 1 RH7 DEAD-box ATP-dependent RNA helicase 7 Arabidopsis thaliana
Q5R4I9 2.33e-69 239 36 4 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pongo abelii
Q7L014 2.45e-69 246 38 6 370 1 DDX46 Probable ATP-dependent RNA helicase DDX46 Homo sapiens
Q61656 2.66e-69 239 36 4 353 1 Ddx5 Probable ATP-dependent RNA helicase DDX5 Mus musculus
Q4HW67 2.92e-69 236 33 2 369 3 DHH1 ATP-dependent RNA helicase DHH1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9LFN6 3.03e-69 233 35 4 368 1 RH56 DEAD-box ATP-dependent RNA helicase 56 Arabidopsis thaliana
Q56XG6 3.03e-69 233 35 4 368 1 RH15 DEAD-box ATP-dependent RNA helicase 15 Arabidopsis thaliana
Q59W52 3.15e-69 238 35 8 376 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Candida albicans (strain SC5314 / ATCC MYA-2876)
A6RY31 3.6e-69 236 33 2 372 3 dhh1 ATP-dependent RNA helicase dhh1 Botryotinia fuckeliana (strain B05.10)
Q1DZK8 3.79e-69 236 37 7 380 3 DBP3 ATP-dependent RNA helicase DBP3 Coccidioides immitis (strain RS)
Q09181 4.51e-69 234 34 2 361 3 ste13 Putative ATP-dependent RNA helicase ste13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q27268 4.93e-69 233 35 5 369 1 Hel25E ATP-dependent RNA helicase WM6 Drosophila melanogaster
A1D373 5.36e-69 246 37 6 391 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q55BR9 5.8e-69 235 34 3 393 3 ddx49 Probable ATP-dependent RNA helicase ddx49 Dictyostelium discoideum
Q4WT99 5.8e-69 246 37 6 391 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2U2J6 6.2e-69 246 37 7 389 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q09903 6.83e-69 241 36 9 407 3 drs1 ATP-dependent RNA helicase drs1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4R6M5 7.97e-69 238 36 4 353 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Macaca fascicularis
Q2H4D0 1.04e-68 232 35 4 369 3 SUB2 ATP-dependent RNA helicase SUB2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q8RXK6 1.18e-68 234 32 2 364 2 RH8 DEAD-box ATP-dependent RNA helicase 8 Arabidopsis thaliana
P39517 1.2e-68 234 33 2 365 1 DHH1 ATP-dependent RNA helicase DHH1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXG9 1.2e-68 234 33 2 365 3 DHH1 ATP-dependent RNA helicase DHH1 Saccharomyces cerevisiae (strain YJM789)
Q4JG17 1.3e-68 239 37 5 368 2 vasa Probable ATP-dependent RNA helicase vasa-like Penaeus vannamei
P0C2N8 1.37e-68 241 37 4 359 3 drh-11 ATP-dependent RNA helicase drs1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q0CLX0 1.57e-68 240 34 6 425 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A5DQS0 1.73e-68 237 37 7 390 3 DED1 ATP-dependent RNA helicase DED1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17055
Feature type CDS
Gene -
Product DEAD/DEAH family ATP-dependent RNA helicase
Location 3753090 - 3754925 (strand: 1)
Length 1836 (nucleotides) / 611 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1410
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain
PF03880 DbpA RNA binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0513 Replication, recombination and repair (L) L Superfamily II DNA and RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05592 ATP-dependent RNA helicase DeaD [EC:3.6.4.13] RNA degradation -

Protein Sequence

MTTETDMTFADLGLSAPILTALNDLGYEKPSPIQQQCIPFLLDGNDVLGMAQTGSGKTAAFSLPLLHNLDESLKAPQILVLAPTRELAVQVAEAIEDFSKHLPKVNVVALYGGQRYDVQLRALRQGPQVVVGTPGRLLDHLNRGTLDLSKLKGLVLDEADEMLRMGFIEDVENILSKIPAEHQTALFSATMPEAIRRITRRFMNDPKEVRIQSSVTTRPDISQSYWMTYGARKNEALIRFLEAEDFDAAIIFVRTKNATLEVAETLERNGYNSAALNGDMNQSLREQTLERLKNGRLDILIATDVAARGLDVDRISLVVNYDIPMDSESYVHRIGRTGRAGRAGRAILFVDNRERRLLRNIERTMKMSIPEVELPNAELISQRRQEKFAQQIAQQLETSNLDQYRALLPKLAPQGEEALDMETLAAVLLKMAQGERALILPPDPVRRPRREFNDRDDRRNDRERSPRRERRDAGEMDLYRIEVGRDDGVEVRHIVGAIANEGDISSRYIGNIKLYGSHSTIELPKGMPGDLLSHFTRTRIMNKPLNMQLVGDAQPYRERRNSSRRDGQPQGGRRFSKGDQPPRRGNGERGNFRGRGNNENAPRRRSSSHNQ

Flanking regions ( +/- flanking 50bp)

ATGCGGTATGTTATGTCAACTGGCCGCCATAATGAATGAGGCACAGTGACATGACTACTGAAACCGATATGACTTTTGCTGATCTAGGTTTATCAGCACCTATTTTGACTGCACTGAATGATTTAGGCTACGAGAAGCCTTCTCCAATTCAGCAACAATGTATTCCTTTCCTTTTAGATGGCAATGATGTTCTAGGTATGGCACAAACCGGTAGTGGTAAAACCGCTGCGTTTAGCTTACCGTTATTACACAATCTAGATGAATCATTAAAAGCACCACAAATTTTAGTGTTAGCACCAACCCGTGAACTTGCGGTTCAGGTTGCCGAAGCCATTGAAGATTTTTCTAAACATTTACCAAAAGTGAATGTCGTTGCTCTGTATGGCGGCCAACGCTATGACGTTCAACTACGTGCATTACGCCAAGGGCCACAAGTTGTTGTGGGTACACCGGGTCGTTTATTAGATCACTTAAACCGTGGCACCTTAGATTTATCTAAACTAAAAGGTTTAGTATTAGATGAAGCTGATGAAATGTTACGTATGGGCTTTATTGAAGATGTTGAGAATATCTTAAGTAAGATCCCAGCAGAGCACCAGACCGCATTATTCTCTGCGACGATGCCAGAAGCTATCCGTCGTATTACACGTCGCTTTATGAATGATCCAAAAGAAGTACGTATTCAAAGCAGTGTAACTACACGCCCAGATATTAGCCAAAGCTATTGGATGACTTATGGTGCACGTAAAAATGAAGCATTAATCCGTTTCTTAGAAGCAGAAGATTTCGATGCAGCTATTATTTTCGTTCGTACAAAAAATGCGACCTTAGAAGTAGCAGAAACCTTAGAGCGTAATGGCTATAACAGTGCGGCATTGAATGGTGACATGAATCAGTCTCTGCGTGAGCAAACATTAGAGCGTCTGAAAAACGGCCGTTTAGATATCCTTATCGCAACGGATGTTGCTGCGCGTGGTCTGGATGTTGACCGTATCAGCTTGGTTGTCAACTATGATATCCCTATGGATTCAGAGTCTTATGTACACCGTATTGGACGTACTGGCCGTGCTGGTCGTGCGGGTCGTGCAATTCTATTTGTTGATAATCGTGAGCGCCGTTTACTGCGCAATATCGAGCGCACGATGAAGATGTCTATTCCTGAAGTTGAATTACCAAACGCAGAGCTGATTAGTCAGCGTCGTCAGGAAAAATTTGCTCAGCAAATCGCTCAACAGTTAGAAACAAGTAACCTTGACCAATATCGTGCATTGTTACCAAAATTAGCGCCACAAGGTGAAGAAGCGTTAGATATGGAAACATTGGCGGCGGTATTACTGAAAATGGCTCAAGGTGAGCGTGCACTTATTCTGCCACCTGATCCAGTACGTCGTCCTCGTCGTGAATTTAACGATCGTGACGATCGCCGTAACGATCGCGAACGTTCTCCACGTCGTGAGCGCCGTGATGCGGGTGAAATGGATCTTTATCGTATTGAAGTGGGTCGTGATGATGGGGTTGAGGTTCGTCATATTGTTGGTGCTATTGCCAACGAAGGCGATATCAGTAGCCGTTATATTGGTAATATCAAATTATATGGCTCTCACTCAACCATTGAGTTACCAAAAGGGATGCCAGGCGATTTATTAAGCCACTTCACTCGTACTCGCATTATGAATAAACCATTGAATATGCAGTTAGTGGGTGATGCACAACCTTACCGTGAGCGCCGTAATAGCAGCCGTCGTGATGGTCAGCCACAAGGTGGTCGTCGCTTTAGTAAAGGCGATCAACCACCACGCCGTGGTAATGGCGAGCGTGGTAACTTCCGTGGTCGCGGTAATAACGAAAACGCACCACGTCGCCGTAGTAGCTCTCATAATCAATAAGAAACTTAAAGTTTATTCAATTTTAAGCTGAATTGATAAAAACCAGTCCA