Homologs in group_1393

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08605 FBDBKF_08605 81.6 Morganella morganii S1 obgE GTPase ObgE
EHELCC_12920 EHELCC_12920 81.6 Morganella morganii S2 obgE GTPase ObgE
NLDBIP_13260 NLDBIP_13260 81.6 Morganella morganii S4 obgE GTPase ObgE
LHKJJB_13295 LHKJJB_13295 81.6 Morganella morganii S3 obgE GTPase ObgE
HKOGLL_11735 HKOGLL_11735 81.6 Morganella morganii S5 obgE GTPase ObgE
F4V73_RS09830 F4V73_RS09830 78.9 Morganella psychrotolerans obgE GTPase ObgE

Distribution of the homologs in the orthogroup group_1393

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1393

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2A8 0.0 796 100 0 389 3 obg GTPase Obg Proteus mirabilis (strain HI4320)
Q7MYX6 0.0 578 78 1 391 3 obg GTPase Obg Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NW34 0.0 574 75 3 390 3 obg GTPase Obg Sodalis glossinidius (strain morsitans)
B2VGT5 0.0 572 76 2 394 3 obg GTPase Obg Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AQ74 0.0 566 79 1 363 3 obg GTPase Obg Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1JIV6 0.0 560 77 2 392 3 obg GTPase Obg Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JMI3 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F73 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRJ6 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pestis (strain Pestoides F)
Q1CEK0 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Nepal516)
A9R591 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Angola)
Q7CKJ6 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pestis
B2K2P2 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBZ4 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMT5 0.0 556 77 1 363 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5REP9 0.0 553 77 2 392 3 obg GTPase Obg Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8ZLS5 0.0 551 79 1 363 1 obg GTPase Obg Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3H1 0.0 551 79 1 363 3 obg GTPase Obg Salmonella typhi
B4TWF3 0.0 551 79 1 363 3 obg GTPase Obg Salmonella schwarzengrund (strain CVM19633)
B5BGK7 0.0 551 79 1 363 3 obg GTPase Obg Salmonella paratyphi A (strain AKU_12601)
C0PZJ5 0.0 551 79 1 363 3 obg GTPase Obg Salmonella paratyphi C (strain RKS4594)
A9N750 0.0 551 79 1 363 3 obg GTPase Obg Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLB7 0.0 551 79 1 363 3 obg GTPase Obg Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T714 0.0 551 79 1 363 3 obg GTPase Obg Salmonella newport (strain SL254)
B4TJ21 0.0 551 79 1 363 3 obg GTPase Obg Salmonella heidelberg (strain SL476)
B5R0H4 0.0 551 79 1 363 3 obg GTPase Obg Salmonella enteritidis PT4 (strain P125109)
B5FIN3 0.0 551 79 1 363 3 obg GTPase Obg Salmonella dublin (strain CT_02021853)
Q57JG7 0.0 551 79 1 363 3 obg GTPase Obg Salmonella choleraesuis (strain SC-B67)
B5F6V2 0.0 551 79 1 363 3 obg GTPase Obg Salmonella agona (strain SL483)
A6TEK2 0.0 551 77 2 394 3 obg GTPase Obg Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MP23 0.0 551 76 2 393 3 obg GTPase Obg Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P42641 0.0 548 77 2 392 1 obgE GTPase ObgE/CgtA Escherichia coli (strain K12)
B1XHF9 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli (strain K12 / DH10B)
Q8FD82 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCS7 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG86 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O1:K1 / APEC
B5YS72 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9K7 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O157:H7
B7MBV2 0.0 548 77 2 392 3 obg GTPase Obg Escherichia coli O45:K1 (strain S88 / ExPEC)
B5XSV8 0.0 546 76 2 394 3 obg GTPase Obg Klebsiella pneumoniae (strain 342)
A4WEZ6 0.0 545 77 1 363 3 obg GTPase Obg Enterobacter sp. (strain 638)
Q1R6F4 0.0 544 79 1 363 3 obg GTPase Obg Escherichia coli (strain UTI89 / UPEC)
A7MJF1 0.0 543 76 2 392 3 obg GTPase Obg Cronobacter sakazakii (strain ATCC BAA-894)
A8G8Z4 0.0 540 77 1 363 3 obg GTPase Obg Serratia proteamaculans (strain 568)
Q6D9C3 0.0 537 77 1 363 3 obg GTPase Obg Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YX58 0.0 530 77 2 392 3 obg GTPase Obg Shigella sonnei (strain Ss046)
Q83Q14 0.0 530 77 2 392 3 obg GTPase Obg Shigella flexneri
Q0T0A1 0.0 530 77 2 392 3 obg GTPase Obg Shigella flexneri serotype 5b (strain 8401)
Q32BF0 0.0 530 77 2 392 3 obg GTPase Obg Shigella dysenteriae serotype 1 (strain Sd197)
Q31W60 0.0 530 77 2 392 3 obg GTPase Obg Shigella boydii serotype 4 (strain Sb227)
B2U1Z4 0.0 530 77 2 392 3 obg GTPase Obg Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LR50 0.0 530 77 2 392 3 obg GTPase Obg Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LFT3 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli (strain SMS-3-5 / SECEC)
B6I1Q6 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli (strain SE11)
B7NDG7 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IQU0 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A4Z8 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O9:H4 (strain HS)
B7M089 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O8 (strain IAI1)
B7N0W5 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O81 (strain ED1a)
B7LHP6 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli (strain 55989 / EAEC)
B7UJ76 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZS79 0.0 530 77 2 392 3 obg GTPase Obg Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NKQ0 0.0 528 77 2 392 3 obg GTPase Obg Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q9CNS4 0.0 514 73 1 363 3 obg GTPase Obg Pasteurella multocida (strain Pm70)
A6VMU1 0.0 512 69 2 391 3 obg GTPase Obg Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A3MYB2 5.16e-179 506 68 3 396 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F871 6.49e-179 505 69 2 393 3 obg GTPase Obg Glaesserella parasuis serovar 5 (strain SH0165)
Q4QM31 7.71e-179 505 73 1 363 3 obg GTPase Obg Haemophilus influenzae (strain 86-028NP)
Q65S59 5.96e-178 503 71 2 391 3 obg GTPase Obg Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UDJ7 9.26e-178 503 73 1 363 3 obg GTPase Obg Haemophilus influenzae (strain PittEE)
B0UVI2 1e-177 503 71 2 363 3 obg GTPase Obg Histophilus somni (strain 2336)
A5UI23 1.93e-177 502 72 1 363 3 obg GTPase Obg Haemophilus influenzae (strain PittGG)
B0BRJ9 1.06e-176 500 70 2 392 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZN0 1.06e-176 500 70 2 392 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q0I1P5 1.68e-176 499 70 2 363 3 obg GTPase Obg Histophilus somni (strain 129Pt)
Q15PF0 2.42e-176 499 69 1 365 3 obg GTPase Obg Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7VP37 1.19e-172 489 67 3 396 3 obg GTPase Obg Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0KGS9 1.64e-172 489 71 1 363 3 obg GTPase Obg Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7VID5 2.53e-172 489 71 1 368 3 obg GTPase Obg Vibrio atlanticus (strain LGP32)
P44915 4.32e-172 488 71 2 391 3 obg GTPase Obg Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5R039 2.45e-171 486 68 1 359 3 obg GTPase Obg Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4SR17 2.63e-171 486 71 1 360 3 obg GTPase Obg Aeromonas salmonicida (strain A449)
Q5E871 3.68e-171 486 70 1 368 3 obg GTPase Obg Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGF9 9.64e-171 485 70 1 368 3 obg GTPase Obg Aliivibrio fischeri (strain MJ11)
B4RZH3 1.79e-170 484 68 1 367 3 obg GTPase Obg Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B1KGH1 5.41e-170 483 66 3 393 3 obg GTPase Obg Shewanella woodyi (strain ATCC 51908 / MS32)
Q87SU2 8.49e-170 482 71 1 368 3 obg GTPase Obg Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6E0U3 6.72e-169 480 70 1 368 1 cgtA GTPase Obg/CgtA Vibrio harveyi
A7N0G2 6.72e-169 480 70 1 368 3 obg GTPase Obg Vibrio campbellii (strain ATCC BAA-1116)
Q6LV46 1.28e-167 477 69 1 364 3 obg GTPase Obg Photobacterium profundum (strain SS9)
Q9KUS8 1.44e-166 474 69 1 363 1 cgtA GTPase Obg/CgtA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1SSB6 1.59e-165 471 69 1 363 3 obg GTPase Obg Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7MP92 2.45e-165 471 71 2 359 3 obg GTPase Obg Vibrio vulnificus (strain YJ016)
B6EL43 4.32e-165 471 68 1 368 3 obg GTPase Obg Aliivibrio salmonicida (strain LFI1238)
Q8DEC6 2.31e-164 469 71 2 359 3 obg GTPase Obg Vibrio vulnificus (strain CMCP6)
A3QB95 7.18e-163 464 65 2 391 3 obg GTPase Obg Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8CSY3 5.56e-161 460 63 2 392 3 obg GTPase Obg Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0HRZ8 5.83e-160 457 66 2 391 3 obg GTPase Obg Shewanella sp. (strain MR-7)
Q0HLU0 5.83e-160 457 66 2 391 3 obg GTPase Obg Shewanella sp. (strain MR-4)
A0L072 5.83e-160 457 66 2 391 3 obg GTPase Obg Shewanella sp. (strain ANA-3)
Q8EB83 8.09e-160 457 66 2 391 3 obg GTPase Obg Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9L430 4.86e-159 455 66 1 365 3 obg GTPase Obg Shewanella baltica (strain OS195)
A6WK51 4.86e-159 455 66 1 365 3 obg GTPase Obg Shewanella baltica (strain OS185)
A3D180 4.86e-159 455 66 1 365 3 obg GTPase Obg Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EC04 4.86e-159 455 66 1 365 3 obg GTPase Obg Shewanella baltica (strain OS223)
A8FRU4 5.69e-159 455 64 2 390 3 obg GTPase Obg Shewanella sediminis (strain HAW-EB3)
A1RMV6 8.49e-158 452 65 2 391 3 obg GTPase Obg Shewanella sp. (strain W3-18-1)
A4Y427 8.49e-158 452 65 2 391 3 obg GTPase Obg Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S9H3 3.09e-157 451 68 3 392 3 obg GTPase Obg Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q07YJ0 6.48e-157 449 66 1 367 3 obg GTPase Obg Shewanella frigidimarina (strain NCIMB 400)
Q3IFF6 1.6e-155 446 66 1 361 3 obg GTPase Obg Pseudoalteromonas translucida (strain TAC 125)
Q1LSJ9 2.23e-155 444 65 0 332 3 obg GTPase Obg Baumannia cicadellinicola subsp. Homalodisca coagulata
Q12K23 9.14e-154 442 65 1 365 3 obg GTPase Obg Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8H0U4 2.93e-153 440 66 1 360 3 obg GTPase Obg Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TUI2 2.26e-152 438 64 2 391 3 obg GTPase Obg Shewanella halifaxensis (strain HAW-EB4)
Q47VL4 2.14e-151 436 65 1 363 3 obg GTPase Obg Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q21M07 2.13e-149 431 60 1 364 3 obg GTPase Obg Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B1JF57 4.37e-148 428 64 0 333 3 obg GTPase Obg Pseudomonas putida (strain W619)
Q88Q08 5.8e-148 427 63 0 333 3 obg GTPase Obg Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYC6 5.8e-148 427 63 0 333 3 obg GTPase Obg Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KMF6 1.93e-147 426 63 0 333 3 obg GTPase Obg Pseudomonas putida (strain GB-1)
Q1IF13 2.39e-147 426 64 0 333 3 obg GTPase Obg Pseudomonas entomophila (strain L48)
A4XYL2 2.67e-147 426 64 0 334 3 obg GTPase Obg Pseudomonas mendocina (strain ymp)
A1TYY4 4.03e-147 425 63 0 333 3 obg GTPase Obg Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B3PIU9 1.46e-145 421 60 1 353 3 obg GTPase Obg Cellvibrio japonicus (strain Ueda107)
C1DEA4 1.94e-145 421 60 2 371 3 obg GTPase Obg Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9HVL8 6.04e-145 420 64 1 333 3 obg GTPase Obg Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02GB1 6.04e-145 420 64 1 333 1 obg GTPase Obg Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0A9 6.04e-145 420 64 1 333 3 obg GTPase Obg Pseudomonas aeruginosa (strain LESB58)
A6VBV3 1.3e-144 419 64 1 333 3 obg GTPase Obg Pseudomonas aeruginosa (strain PA7)
Q3K6K9 2.5e-144 418 59 2 373 3 obg GTPase Obg Pseudomonas fluorescens (strain Pf0-1)
Q4ZYK1 3.24e-144 418 60 3 370 3 obg GTPase Obg Pseudomonas syringae pv. syringae (strain B728a)
Q48NL2 3.24e-144 418 60 3 370 3 obg GTPase Obg Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4K5T8 4.35e-144 418 62 1 348 3 obg GTPase Obg Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5WTF1 7.18e-142 410 62 1 333 3 obg GTPase Obg Legionella pneumophila (strain Lens)
Q2S9T3 1.89e-141 410 62 0 339 3 obg GTPase Obg Hahella chejuensis (strain KCTC 2396)
Q5X1P1 5.72e-141 407 61 1 333 3 obg GTPase Obg Legionella pneumophila (strain Paris)
A6W352 1.26e-140 409 63 0 332 3 obg GTPase Obg Marinomonas sp. (strain MWYL1)
Q5ZS70 3.39e-140 405 61 1 333 3 obg GTPase Obg Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IAS7 1.84e-139 404 61 1 333 3 obg GTPase Obg Legionella pneumophila (strain Corby)
Q605N2 2.93e-139 403 61 1 341 3 obg GTPase Obg Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1GZ53 4.76e-139 403 61 2 338 3 obg GTPase Obg Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4VI54 2.02e-138 403 62 0 332 3 obg GTPase Obg Stutzerimonas stutzeri (strain A1501)
B8GQQ3 2.85e-138 400 61 2 346 3 obg GTPase Obg Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q5P7Z4 5.7e-138 402 63 1 333 3 obg GTPase Obg Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B6J9K2 1.38e-137 399 61 0 337 3 obg GTPase Obg Coxiella burnetii (strain CbuK_Q154)
Q83ED8 1.46e-137 399 61 0 337 3 obg GTPase Obg Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KEJ7 1.46e-137 399 61 0 337 3 obg GTPase Obg Coxiella burnetii (strain Dugway 5J108-111)
B6J1S8 1.46e-137 399 61 0 337 3 obg GTPase Obg Coxiella burnetii (strain CbuG_Q212)
B8D7S4 1.68e-137 398 57 0 333 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57469 1.68e-137 398 57 0 333 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9H2 1.68e-137 398 57 0 333 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A9NBL5 1.05e-136 396 60 0 337 3 obg GTPase Obg Coxiella burnetii (strain RSA 331 / Henzerling II)
Q8K9G1 9.75e-136 394 58 1 333 3 obg GTPase Obg Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1KAD0 1.53e-135 396 63 1 333 3 obg GTPase Obg Azoarcus sp. (strain BH72)
A4JBB8 3.37e-135 394 60 1 333 3 obg GTPase Obg Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3J6S0 2.84e-134 390 58 2 342 3 obg GTPase Obg Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q2SZG0 1.27e-133 390 60 1 333 3 obg GTPase Obg Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B0VCR5 1.49e-133 391 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain AYE)
A3M7M2 1.49e-133 391 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWM9 1.49e-133 391 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain ACICU)
B7I557 1.49e-133 391 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain AB0057)
B7GYV1 1.49e-133 391 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain AB307-0294)
Q13U15 3.44e-133 389 59 1 333 3 obg GTPase Obg Paraburkholderia xenovorans (strain LB400)
A6T2D5 5.36e-133 388 58 0 334 3 obg GTPase Obg Janthinobacterium sp. (strain Marseille)
Q6F9D8 1.02e-132 389 60 0 330 3 obg GTPase Obg Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0VTQ1 1.13e-132 389 57 2 364 3 obg GTPase Obg Acinetobacter baumannii (strain SDF)
Q7NZS1 1.64e-132 387 59 2 350 3 obg GTPase Obg Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2Y807 1.84e-132 386 57 1 349 3 obg GTPase Obg Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A3NDS7 2.06e-132 387 60 1 333 3 obg GTPase Obg Burkholderia pseudomallei (strain 668)
B2JHD7 4.12e-132 386 59 1 333 3 obg GTPase Obg Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q63QM0 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia pseudomallei (strain K96243)
Q3JNG0 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia pseudomallei (strain 1710b)
A3NZJ0 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia pseudomallei (strain 1106a)
A1V0P1 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia mallei (strain SAVP1)
Q62GV4 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia mallei (strain ATCC 23344)
A2S5R8 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10229)
A3MR90 5.19e-132 386 60 1 333 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10247)
Q39JU7 5.47e-132 385 59 1 333 3 obg GTPase Obg Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B2SYV2 5.73e-132 385 59 1 333 3 obg GTPase Obg Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q1R0C0 2.67e-131 385 55 2 365 3 obg GTPase Obg Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4G8R4 3.72e-131 384 58 0 334 3 obg GTPase Obg Herminiimonas arsenicoxydans
Q3SKG2 2.56e-130 380 60 2 341 3 obg GTPase Obg Thiobacillus denitrificans (strain ATCC 25259)
Q82V20 4.92e-130 380 60 1 334 3 obg GTPase Obg Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q31IT4 1.25e-129 379 61 0 328 3 obg GTPase Obg Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B3R898 2.87e-129 379 58 1 334 3 obg GTPase Obg Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A5WFV1 1.11e-128 378 59 1 330 3 obg GTPase Obg Psychrobacter sp. (strain PRwf-1)
Q0VSE6 1.56e-128 377 59 0 333 3 obg GTPase Obg Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0K6P6 2.92e-128 376 58 1 334 3 obg GTPase Obg Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q47AD0 2.97e-127 373 61 2 344 3 obg GTPase Obg Dechloromonas aromatica (strain RCB)
B1YSU7 3.93e-127 373 58 2 350 3 obg GTPase Obg Burkholderia ambifaria (strain MC40-6)
B4SP14 4.24e-127 372 61 1 336 3 obg GTPase Obg Stenotrophomonas maltophilia (strain R551-3)
B2FTD3 7.08e-127 372 61 1 336 3 obg GTPase Obg Stenotrophomonas maltophilia (strain K279a)
Q5NEB0 8.24e-127 371 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FR3 8.24e-127 371 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain FSC 198)
Q1QA43 1.05e-126 374 58 0 329 3 obg GTPase Obg Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0BIH8 1.19e-126 372 57 2 350 3 obg GTPase Obg Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2UCV3 1.3e-126 372 59 1 333 3 obg GTPase Obg Ralstonia pickettii (strain 12J)
B2SEA8 1.45e-126 370 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. mediasiatica (strain FSC147)
Q46X17 1.56e-126 372 58 1 329 3 obg GTPase Obg Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LIQ0 1.63e-126 372 59 1 329 3 obg GTPase Obg Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A0Q8K2 1.75e-126 370 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. novicida (strain U112)
Q0AAD6 2.13e-126 371 56 1 351 3 obg GTPase Obg Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1BZE0 2.15e-126 371 59 1 333 3 obg GTPase Obg Burkholderia orbicola (strain AU 1054)
B4E5X0 2.15e-126 371 59 1 333 3 obg GTPase Obg Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1JVA1 2.56e-126 371 59 1 333 3 obg GTPase Obg Burkholderia orbicola (strain MC0-3)
A0K4B0 2.56e-126 371 59 1 333 3 obg GTPase Obg Burkholderia cenocepacia (strain HI2424)
A4IVW3 2.65e-126 370 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain WY96-3418)
Q4FRK6 2.74e-126 372 58 0 329 3 obg GTPase Obg Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8XVL0 3.78e-126 370 58 1 333 3 obg GTPase Obg Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8PN23 5.41e-126 370 59 1 341 3 obg GTPase Obg Xanthomonas axonopodis pv. citri (strain 306)
Q0AHG5 5.57e-126 369 60 1 334 3 obg GTPase Obg Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B0TWK7 8.32e-126 369 58 2 332 3 obg GTPase Obg Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q3BW46 1.52e-125 369 58 1 341 3 obg GTPase Obg Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5H2E5 4.75e-125 367 59 1 336 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STC0 4.75e-125 367 59 1 336 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P5B4 4.75e-125 367 59 1 336 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q87BL2 1.11e-124 367 54 3 362 3 obg GTPase Obg Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6V6 1.11e-124 367 54 3 362 3 obg GTPase Obg Xylella fastidiosa (strain M23)
A9BP68 1.27e-124 367 59 1 333 3 obg GTPase Obg Delftia acidovorans (strain DSM 14801 / SPH-1)
Q9PAS3 1.75e-124 366 56 2 340 3 obg GTPase Obg Xylella fastidiosa (strain 9a5c)
Q0BK24 1.86e-124 365 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1B4 1.86e-124 365 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain LVS)
A7NEQ3 1.86e-124 365 58 2 333 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A1W4B0 1.93e-124 366 56 1 341 3 obg GTPase Obg Acidovorax sp. (strain JS42)
A4SVA3 4.45e-124 365 55 1 351 3 obg GTPase Obg Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A2SD36 4.83e-124 365 56 0 332 3 obg GTPase Obg Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XT35 4.99e-124 365 56 1 343 3 obg GTPase Obg Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A9AI60 5.87e-124 365 60 1 333 3 obg GTPase Obg Burkholderia multivorans (strain ATCC 17616 / 249)
A1WY48 9.79e-124 363 58 1 346 3 obg GTPase Obg Halorhodospira halophila (strain DSM 244 / SL1)
B9MDZ7 1.76e-123 363 56 1 341 3 obg GTPase Obg Acidovorax ebreus (strain TPSY)
A9IFF9 1.8e-123 364 56 4 348 3 obg GTPase Obg Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0U3R3 1.8e-123 363 55 2 340 3 obg GTPase Obg Xylella fastidiosa (strain M12)
A1TTD3 2.05e-122 361 57 1 334 3 obg GTPase Obg Paracidovorax citrulli (strain AAC00-1)
B5ELU2 3.88e-121 358 53 1 378 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J427 3.88e-121 358 53 1 378 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q2L062 6.61e-121 357 55 3 348 3 obg GTPase Obg Bordetella avium (strain 197N)
Q12F99 1.23e-120 356 53 3 368 3 obg GTPase Obg Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9JXE5 1.97e-120 357 57 3 349 3 obg GTPase Obg Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1VK90 3.92e-120 355 54 2 353 3 obg GTPase Obg Polaromonas naphthalenivorans (strain CJ2)
B4RQP4 5.61e-120 355 57 3 349 3 obg GTPase Obg Neisseria gonorrhoeae (strain NCCP11945)
Q5F5D9 5.61e-120 355 57 3 349 1 obg GTPase Obg Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1IPH6 6.46e-120 355 57 3 349 3 obg GTPase Obg Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KWG2 7.69e-120 355 57 3 349 3 obg GTPase Obg Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B1Y280 7.89e-120 355 56 1 329 3 obg GTPase Obg Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A5EVP4 1.45e-119 353 57 1 340 3 obg GTPase Obg Dichelobacter nodosus (strain VCS1703A)
A9M061 1.96e-119 354 57 3 349 3 obg GTPase Obg Neisseria meningitidis serogroup C (strain 053442)
Q493U5 4.43e-118 349 51 2 336 3 obg GTPase Obg Blochmanniella pennsylvanica (strain BPEN)
Q89AE7 1.39e-117 348 54 0 333 3 obg GTPase Obg Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1WPR5 1.56e-117 348 56 1 337 3 obg GTPase Obg Verminephrobacter eiseniae (strain EF01-2)
Q21YZ9 1.13e-116 346 53 1 346 3 obg GTPase Obg Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8PBH0 2.51e-116 345 60 1 336 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RY32 2.51e-116 345 60 1 336 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain B100)
Q4US36 2.51e-116 345 60 1 336 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain 8004)
A1AW67 4.16e-115 341 55 2 334 3 obg GTPase Obg Ruthia magnifica subsp. Calyptogena magnifica
Q7VZX6 1.55e-114 342 56 4 344 3 obg GTPase Obg Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1P2 1.55e-114 342 56 4 344 3 obg GTPase Obg Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQL8 1.55e-114 342 56 4 344 3 obg GTPase Obg Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A5CX17 2.36e-113 337 53 2 333 3 obg GTPase Obg Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A0LCZ3 7.54e-107 322 54 1 334 3 obg GTPase Obg Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B8CXZ0 8.68e-106 321 47 3 381 3 obg GTPase Obg Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A9FJF8 9.08e-104 313 48 3 347 3 obg GTPase Obg Sorangium cellulosum (strain So ce56)
C0QUB5 1.3e-102 310 50 2 339 3 obg GTPase Obg Persephonella marina (strain DSM 14350 / EX-H1)
Q3AF51 1.93e-102 312 53 1 336 3 obg GTPase Obg Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7HIF8 7.79e-102 308 52 2 325 3 obg GTPase Obg Anaeromyxobacter sp. (strain Fw109-5)
A4J7I9 2.42e-101 309 48 2 358 3 obg GTPase Obg Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A8FFS8 8.48e-101 308 49 1 334 3 obg GTPase Obg Bacillus pumilus (strain SAFR-032)
Q2LR77 9.8e-101 305 52 2 334 3 obg GTPase Obg Syntrophus aciditrophicus (strain SB)
B5YJ65 1.34e-100 305 51 1 330 3 obg GTPase Obg Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B2V968 2.05e-100 304 50 1 328 3 obg GTPase Obg Sulfurihydrogenibium sp. (strain YO3AOP1)
B7GIR2 2.73e-100 307 51 1 334 3 obg GTPase Obg Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q057J0 3.94e-100 303 51 2 332 3 obg GTPase Obg Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A7Z781 1.06e-99 305 47 1 355 3 obg GTPase Obg Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3QVU6 2.24e-99 301 50 4 332 3 obg GTPase Obg Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q2IH84 3.08e-99 301 52 2 325 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-C)
B4S5P1 3.49e-99 300 55 1 289 3 obg GTPase Obg Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B8JBP2 3.51e-99 301 52 2 325 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UIU2 3.7e-99 301 52 2 325 3 obg GTPase Obg Anaeromyxobacter sp. (strain K)
B9IZ16 5.65e-99 303 48 1 334 3 obg GTPase Obg Bacillus cereus (strain Q1)
Q0AWJ4 7.15e-99 303 50 2 336 3 obg GTPase Obg Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B1HVB2 8.06e-99 303 47 1 334 3 obg GTPase Obg Lysinibacillus sphaericus (strain C3-41)
B7HE73 8.44e-99 303 48 1 334 3 obg GTPase Obg Bacillus cereus (strain B4264)
A0Q1T4 9.79e-99 303 47 1 334 3 obg GTPase Obg Clostridium novyi (strain NT)
B7HQJ8 1.34e-98 303 48 1 334 3 obg GTPase Obg Bacillus cereus (strain AH187)
Q817U6 1.72e-98 302 48 1 334 3 obg GTPase Obg Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5D410 1.84e-98 302 49 1 343 3 obg GTPase Obg Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3A1D8 1.9e-98 300 50 2 350 3 obg GTPase Obg Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B3E609 2.14e-98 299 50 1 339 3 obg GTPase Obg Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A4IRC7 2.31e-98 302 48 2 361 3 obg GTPase Obg Geobacillus thermodenitrificans (strain NG80-2)
Q3APF4 2.38e-98 299 51 3 342 3 obg GTPase Obg Chlorobium chlorochromatii (strain CaD3)
Q6HD85 2.9e-98 301 47 1 334 3 obg GTPase Obg Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634A3 2.9e-98 301 47 1 334 3 obg GTPase Obg Bacillus cereus (strain ZK / E33L)
C1ETN7 2.9e-98 301 47 1 334 3 obg GTPase Obg Bacillus cereus (strain 03BB102)
A0RJ47 2.9e-98 301 47 1 334 3 obg GTPase Obg Bacillus thuringiensis (strain Al Hakam)
B7JQ26 3.26e-98 301 47 1 334 3 obg GTPase Obg Bacillus cereus (strain AH820)
Q5WHS8 4.14e-98 301 48 1 334 3 obg GTPase Obg Shouchella clausii (strain KSM-K16)
Q81LF0 5.08e-98 301 47 1 334 3 obg GTPase Obg Bacillus anthracis
Q72ZY5 6.38e-98 301 48 1 334 3 obg GTPase Obg Bacillus cereus (strain ATCC 10987 / NRS 248)
B2IYX1 8.29e-98 298 48 4 338 3 obg GTPase Obg Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8KAF0 1.7e-97 296 48 3 342 3 obg GTPase Obg Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1BJ56 1.96e-97 296 48 2 340 3 obg GTPase Obg Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A9VIR5 2.58e-97 299 48 1 334 3 obg GTPase Obg Bacillus mycoides (strain KBAB4)
A0LPF9 3.35e-97 296 51 1 332 3 obg GTPase Obg Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B9MRB8 3.94e-97 299 50 1 331 3 obg GTPase Obg Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q8Y6Z3 5.42e-97 298 45 3 367 3 obg GTPase Obg Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZD3 5.42e-97 298 45 3 367 3 obg GTPase Obg Listeria monocytogenes serotype 4b (strain F2365)
Q5KWP5 8.47e-97 298 50 1 334 3 obg GTPase Obg Geobacillus kaustophilus (strain HTA426)
Q5FUL2 9.15e-97 295 49 2 339 3 obg GTPase Obg Gluconobacter oxydans (strain 621H)
Q1DC95 9.46e-97 300 52 3 334 3 obg GTPase Obg Myxococcus xanthus (strain DK1622)
B8DHL1 9.61e-97 298 47 1 334 3 obg GTPase Obg Listeria monocytogenes serotype 4a (strain HCC23)
Q92BH7 1.3e-96 297 45 4 368 3 obg GTPase Obg Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AIY6 1.36e-96 297 45 4 368 3 obg GTPase Obg Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B2TK70 1.62e-96 297 46 3 372 3 obg GTPase Obg Clostridium botulinum (strain Eklund 17B / Type B)
B7IIV2 1.8e-96 297 47 1 334 3 obg GTPase Obg Bacillus cereus (strain G9842)
A4XJS8 1.97e-96 297 48 1 339 3 obg GTPase Obg Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q0BRE9 2.42e-96 294 49 2 344 3 obg GTPase Obg Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q65GM7 3.13e-96 296 48 2 345 3 obg GTPase Obg Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A4SCP4 3.51e-96 293 53 1 291 3 obg GTPase Obg Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q03F34 6.71e-96 296 48 1 351 3 obg GTPase Obg Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B3QRD8 7.76e-96 292 50 2 324 3 obg GTPase Obg Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A6LJZ0 7.82e-96 296 49 2 331 3 obg GTPase Obg Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A1B9C8 1.12e-95 292 52 3 325 3 obg GTPase Obg Paracoccus denitrificans (strain Pd 1222)
A5E965 1.8e-95 292 48 5 356 3 obg GTPase Obg Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A8F478 1.9e-95 295 52 0 298 3 obg GTPase Obg Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q0BZ39 2.78e-95 291 50 2 332 3 obg GTPase Obg Hyphomonas neptunium (strain ATCC 15444)
Q6AK07 2.86e-95 292 51 3 325 3 obg GTPase Obg Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B7IGK8 4.65e-95 293 48 2 331 3 obg GTPase Obg Thermosipho africanus (strain TCF52B)
B0TBW1 4.8e-95 294 50 1 331 3 obg GTPase Obg Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q1RGV9 6.24e-95 290 49 4 335 3 obg GTPase Obg Rickettsia bellii (strain RML369-C)
A8GUG0 6.24e-95 290 49 4 335 3 obg GTPase Obg Rickettsia bellii (strain OSU 85-389)
B3EP74 1.47e-94 288 50 2 324 3 obg GTPase Obg Chlorobium phaeobacteroides (strain BS1)
A7HT67 1.73e-94 289 51 3 324 3 obg GTPase Obg Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A8MHK8 2.35e-94 291 45 2 362 3 obg GTPase Obg Alkaliphilus oremlandii (strain OhILAs)
Q3B6H6 2.57e-94 288 49 2 324 3 obg GTPase Obg Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A7HJZ8 2.91e-94 292 51 4 335 3 obg GTPase Obg Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q92G19 3.01e-94 288 49 3 333 3 obg GTPase Obg Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GTZ9 4.64e-94 288 49 3 333 3 obg GTPase Obg Rickettsia rickettsii (strain Sheila Smith)
B0BVJ1 4.64e-94 288 49 3 333 3 obg GTPase Obg Rickettsia rickettsii (strain Iowa)
Q2J3J8 4.72e-94 288 51 4 325 3 obg GTPase Obg Rhodopseudomonas palustris (strain HaA2)
Q9KDK0 4.89e-94 291 46 3 360 3 obg GTPase Obg Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q98EZ3 5.54e-94 288 49 3 332 3 obg GTPase Obg Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3SVI2 6.09e-94 288 49 4 337 3 obg GTPase Obg Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q97JL4 6.18e-94 290 45 2 357 3 obg GTPase Obg Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P20964 7.35e-94 290 48 1 334 1 obg GTPase Obg Bacillus subtilis (strain 168)
B8I179 7.4e-94 290 47 1 334 3 obg GTPase Obg Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B3Q731 8.03e-94 288 48 5 349 3 obg GTPase Obg Rhodopseudomonas palustris (strain TIE-1)
Q13DL7 8.21e-94 288 54 3 300 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB5)
A8F2Y3 9.5e-94 286 49 3 333 3 obg GTPase Obg Rickettsia massiliae (strain Mtu5)
Q39QR4 1.09e-93 287 50 2 333 3 obg GTPase Obg Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q6NDE6 1.62e-93 287 54 3 300 3 obg GTPase Obg Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8RBA5 1.65e-93 289 49 2 339 3 obg GTPase Obg Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A4YKF3 1.65e-93 287 48 5 356 3 obg GTPase Obg Bradyrhizobium sp. (strain ORS 278)
Q0AKX2 1.77e-93 287 50 3 332 3 obg GTPase Obg Maricaulis maris (strain MCS10)
A5FV29 2.05e-93 286 49 2 333 3 obg GTPase Obg Acidiphilium cryptum (strain JF-5)
Q88VG4 2.24e-93 289 46 1 338 3 obg GTPase Obg Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1F9K2 3.24e-93 286 46 3 343 3 obg GTPase Obg Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q38WT4 3.32e-93 289 47 0 333 3 obg GTPase Obg Latilactobacillus sakei subsp. sakei (strain 23K)
A9IMA6 6.09e-93 285 47 3 339 3 obg GTPase Obg Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q8RHS8 8.62e-93 288 48 1 336 3 obg GTPase Obg Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1URN4 9.31e-93 285 47 3 334 3 obg GTPase Obg Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q21D04 9.85e-93 285 47 3 348 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB18)
B9L101 1.25e-92 288 45 5 399 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q8EPQ0 1.54e-92 287 46 2 360 3 obg GTPase Obg Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1X0M2 1.7e-92 284 46 3 346 3 obg GTPase Obg Crocosphaera subtropica (strain ATCC 51142 / BH68)
A9VYM4 1.78e-92 284 50 4 324 3 obg GTPase Obg Methylorubrum extorquens (strain PA1)
B7KSH0 1.78e-92 284 50 4 324 3 obg GTPase Obg Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A3DBS5 2.07e-92 286 49 1 334 3 obg GTPase Obg Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2NCX8 2.1e-92 284 50 3 332 3 obg GTPase Obg Erythrobacter litoralis (strain HTCC2594)
A5VD74 2.11e-92 284 50 3 336 3 obg GTPase Obg Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B1M697 2.84e-92 283 51 2 305 3 obg GTPase Obg Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q89X89 3.02e-92 283 48 3 336 3 obg GTPase Obg Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B3CQ33 3.26e-92 283 48 4 336 3 obg GTPase Obg Orientia tsutsugamushi (strain Ikeda)
A5CDM6 3.26e-92 283 48 4 336 3 obg GTPase Obg Orientia tsutsugamushi (strain Boryong)
A8AWM9 3.36e-92 286 44 4 380 3 obg GTPase Obg Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
O67849 3.56e-92 283 49 1 323 3 obg GTPase Obg Aquifex aeolicus (strain VF5)
A3CM33 3.58e-92 286 44 4 380 3 obg GTPase Obg Streptococcus sanguinis (strain SK36)
B2KAW2 5.36e-92 286 49 3 336 3 obg GTPase Obg Elusimicrobium minutum (strain Pei191)
A8GQ55 5.54e-92 282 48 3 333 3 obg GTPase Obg Rickettsia akari (strain Hartford)
B1ILY5 6.29e-92 285 47 1 334 3 obg GTPase Obg Clostridium botulinum (strain Okra / Type B1)
Q6G4Z2 6.33e-92 282 49 3 325 3 obg GTPase Obg Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P72931 6.41e-92 283 52 1 291 3 obg GTPase Obg Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B4SBR3 6.63e-92 282 50 2 324 3 obg GTPase Obg Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q4UJV1 6.88e-92 282 49 3 324 3 obg GTPase Obg Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q747Q2 7.88e-92 282 49 2 333 3 obg GTPase Obg Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A4WZ45 9.04e-92 282 50 4 353 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A9H0F1 1.07e-91 282 52 1 305 3 obg GTPase Obg Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A7GHK2 1.54e-91 284 47 1 334 3 obg GTPase Obg Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1LA53 1.65e-91 285 47 3 348 3 obg GTPase Obg Thermotoga sp. (strain RQ2)
Q5LRY4 1.66e-91 281 51 3 325 3 obg GTPase Obg Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q2VZU2 1.66e-91 284 52 2 307 3 obg GTPase Obg Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3WE52 1.83e-91 284 47 1 336 3 obg GTPase Obg Lacticaseibacillus casei (strain BL23)
Q039J3 1.98e-91 284 47 1 336 3 obg GTPase Obg Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B7KIC1 2.04e-91 281 46 2 342 3 obg GTPase Obg Gloeothece citriformis (strain PCC 7424)
B8FUR9 2.32e-91 284 52 1 337 3 obg GTPase Obg Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q3AM97 2.34e-91 281 50 1 305 3 obg GTPase Obg Synechococcus sp. (strain CC9605)
Q18B27 2.55e-91 284 45 1 331 3 obg GTPase Obg Clostridioides difficile (strain 630)
Q5N4J6 2.58e-91 281 51 2 299 3 obg GTPase Obg Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PN0 2.58e-91 281 51 2 299 3 obg GTPase Obg Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B6JD21 2.72e-91 281 47 4 340 3 obg GTPase Obg Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B1ZL15 2.78e-91 281 50 4 324 3 obg GTPase Obg Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q2JJ90 3.06e-91 281 48 2 332 3 obg GTPase Obg Synechococcus sp. (strain JA-2-3B'a(2-13))
B4RD64 3.38e-91 281 50 3 325 3 obg GTPase Obg Phenylobacterium zucineum (strain HLK1)
B9E021 4.95e-91 283 50 1 334 3 obg GTPase Obg Clostridium kluyveri (strain NBRC 12016)
A9BK05 5.49e-91 283 49 1 323 3 obg GTPase Obg Petrotoga mobilis (strain DSM 10674 / SJ95)
C0QLE9 6.13e-91 280 49 2 325 3 obg GTPase Obg Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B1KZR3 8.4e-91 282 47 1 334 3 obg GTPase Obg Clostridium botulinum (strain Loch Maree / Type A3)
Q24SP0 8.49e-91 282 52 1 337 3 obg GTPase Obg Desulfitobacterium hafniense (strain Y51)
Q07U75 9.12e-91 280 52 3 300 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisA53)
A5IKX2 9.46e-91 283 48 2 331 3 obg GTPase Obg Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A8F063 9.79e-91 279 48 3 333 3 obg GTPase Obg Rickettsia canadensis (strain McKiel)
B8IEL9 1.08e-90 279 48 5 341 3 obg GTPase Obg Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A8YV14 1.24e-90 282 47 2 328 3 obg GTPase Obg Lactobacillus helveticus (strain DPC 4571)
A5I666 1.41e-90 282 47 1 330 3 obg GTPase Obg Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXU6 1.41e-90 282 47 1 330 3 obg GTPase Obg Clostridium botulinum (strain ATCC 19397 / Type A)
B9DNE7 1.56e-90 282 48 1 330 3 obg GTPase Obg Staphylococcus carnosus (strain TM300)
B0K414 1.74e-90 281 48 2 337 3 obg GTPase Obg Thermoanaerobacter sp. (strain X514)
B0KAB8 1.74e-90 281 48 2 337 3 obg GTPase Obg Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q2RKZ8 1.79e-90 281 49 3 354 3 obg GTPase Obg Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q67SC6 2.24e-90 281 49 1 323 3 obg GTPase Obg Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q46HF4 3.84e-90 277 49 3 328 3 obg GTPase Obg Prochlorococcus marinus (strain NATL2A)
B0UMS4 4.23e-90 278 50 5 323 3 obg GTPase Obg Methylobacterium sp. (strain 4-46)
A2C050 4.47e-90 277 49 3 328 3 obg GTPase Obg Prochlorococcus marinus (strain NATL1A)
B0CDA2 5.68e-90 278 46 3 338 3 obg GTPase Obg Acaryochloris marina (strain MBIC 11017)
A9AXD9 6.07e-90 281 44 6 384 3 obg GTPase Obg Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q4FP46 6.54e-90 277 51 3 296 3 obg GTPase Obg Pelagibacter ubique (strain HTCC1062)
B4U3Q7 8.27e-90 280 46 2 340 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q892N8 8.44e-90 280 48 2 339 3 obg GTPase Obg Clostridium tetani (strain Massachusetts / E88)
B5YEQ1 9.72e-90 280 50 5 329 3 obg GTPase Obg Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B8ZPS8 1.1e-89 280 45 1 338 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q8DPV8 1.31e-89 280 43 4 382 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KK7 1.31e-89 280 43 4 382 3 obg GTPase Obg Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A6LQR9 1.5e-89 279 45 4 365 3 obg GTPase Obg Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C0MBS1 1.64e-89 280 46 2 340 3 obg GTPase Obg Streptococcus equi subsp. equi (strain 4047)
Q1GHD0 2.35e-89 276 50 4 322 3 obg GTPase Obg Ruegeria sp. (strain TM1040)
Q0SR54 2.51e-89 279 45 2 368 3 obg GTPase Obg Clostridium perfringens (strain SM101 / Type A)
Q8XIJ2 2.51e-89 279 45 2 368 3 obg GTPase Obg Clostridium perfringens (strain 13 / Type A)
Q0TNI5 2.51e-89 279 45 2 368 3 obg GTPase Obg Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q10XA1 2.61e-89 276 49 3 336 3 obg GTPase Obg Trichodesmium erythraeum (strain IMS101)
B9KW04 2.75e-89 276 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B2IQ29 3.07e-89 279 45 1 338 3 obg GTPase Obg Streptococcus pneumoniae (strain CGSP14)
Q5NR23 3.22e-89 276 51 2 305 3 obg GTPase Obg Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B1IBL9 3.26e-89 279 45 1 338 3 obg GTPase Obg Streptococcus pneumoniae (strain Hungary19A-6)
Q97QW8 3.37e-89 278 45 1 338 3 obg GTPase Obg Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E4J4 3.37e-89 278 45 1 338 3 obg GTPase Obg Streptococcus pneumoniae serotype 19F (strain G54)
A4W0M2 3.56e-89 279 46 1 338 3 obg GTPase Obg Streptococcus suis (strain 98HAH33)
Q3IXX9 3.77e-89 275 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PQJ0 3.77e-89 275 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A9BDI4 3.78e-89 275 49 3 334 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9211)
C1A1L5 4.99e-89 280 42 5 342 3 obg GTPase Obg Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A4VUC8 6.04e-89 278 46 1 338 3 obg GTPase Obg Streptococcus suis (strain 05ZYH33)
B1X580 6.42e-89 274 50 1 300 3 obg Putative GTPase Obg Paulinella chromatophora
A8ZRY1 7.69e-89 274 47 2 332 3 obg GTPase Obg Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B2GBD0 8.87e-89 278 44 4 379 3 obg GTPase Obg Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A9KMF5 1.13e-88 277 45 1 334 3 obg GTPase Obg Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q7VDW9 1.2e-88 274 49 2 334 3 obg GTPase Obg Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q5FKH5 1.21e-88 277 46 0 325 3 obg GTPase Obg Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1QQU0 1.59e-88 274 52 3 300 3 obg GTPase Obg Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q03QP2 1.73e-88 276 44 2 349 3 obg GTPase Obg Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B1H0I4 2.03e-88 276 51 2 284 3 obg GTPase Obg Endomicrobium trichonymphae
Q2JS78 2.16e-88 275 47 3 349 3 obg GTPase Obg Synechococcus sp. (strain JA-3-3Ab)
Q5HFB9 2.25e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q8FYM2 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella suis biovar 1 (strain 1330)
A9WWW9 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VSI5 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YJ80 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M882 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57B45 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella abortus biovar 1 (strain 9-941)
Q2YLM2 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella abortus (strain 2308)
B2S806 2.71e-88 273 47 4 348 3 obg GTPase Obg Brucella abortus (strain S19)
Q7A0Q3 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 3.22e-88 276 44 2 349 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 3.22e-88 276 44 2 349 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5XBM1 4.49e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DB53 4.78e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1JLA1 4.78e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBB7 4.78e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DB52 4.78e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
C0MDB4 4.89e-88 276 46 2 340 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain H70)
Q04B11 4.94e-88 276 46 1 324 3 obg GTPase Obg Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q165Y6 5e-88 273 51 3 321 3 obg GTPase Obg Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q1GAM3 5.05e-88 276 46 1 324 3 obg GTPase Obg Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8P0I6 5.5e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99Z94 5.5e-88 276 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M1
B9K736 6.04e-88 275 50 2 320 3 obg GTPase Obg Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q022G3 6.13e-88 272 55 0 285 3 obg GTPase Obg Solibacter usitatus (strain Ellin6076)
Q1JGD5 6.76e-88 275 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M2 (strain MGAS10270)
B6IQZ9 7.16e-88 272 47 4 333 3 obg GTPase Obg Rhodospirillum centenum (strain ATCC 51521 / SW)
Q9WXV3 7.18e-88 275 47 3 348 3 obg GTPase Obg Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1J652 7.61e-88 275 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M4 (strain MGAS10750)
A2RE30 7.77e-88 275 46 2 340 3 obg GTPase Obg Streptococcus pyogenes serotype M5 (strain Manfredo)
A8LK09 8.77e-88 272 50 3 322 3 obg GTPase Obg Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q6G0S8 9.01e-88 272 48 3 324 3 obg GTPase Obg Bartonella quintana (strain Toulouse)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16960
Feature type CDS
Gene cgtA
Product Obg family GTPase CgtA
Location 3732646 - 3733815 (strand: 1)
Length 1170 (nucleotides) / 389 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1393
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01018 GTP1/OBG
PF01926 50S ribosome-binding GTPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0536 Cell cycle control, cell division, chromosome partitioning (D)
Replication, recombination and repair (L)		 DL GTPase involved in cell partioning and DNA repair

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03979 GTPase [EC:3.6.5.-] - -

Protein Sequence

MKFVDEAKILIVAGDGGNGCVSFRREKYIPKGGPDGGDGGDGGDVYMVADENLNTLIDYRFTKSYRAERGENGQSRDCTGKRGQDITINVPVGTRARDLATGEIIADLTVHGQKQMVAKGGFHGLGNTRFKSSVNRAPRQRTMGTPGESREVLLELMLLADVGMLGMPNAGKSTFIRAVSAAKPKVADYPFTTLVPSLGVVRMDSHQSFVVADIPGLIEGAADGAGLGIQFLKHLERCRVLLHLIDIDPIDGSDPVENAKIIISELEKYSDKLAQKPRWLVFNKVDLLDADEAKQKAQAIVEALGWEGDYYMIAAINQEGVKKLCWDIMEFLKVTPREQDIATALAAEEKVDFMWDDYHKEQLENPDLEDDDEDWDEEDDDGVEFIYQR

Flanking regions ( +/- flanking 50bp)

GGTAATTTCGGCCATCCAGCACGTTAATGGCTATCATACGGAGTAAAATCATGAAATTTGTTGATGAGGCCAAGATCCTAATCGTCGCTGGCGACGGTGGTAACGGCTGTGTAAGCTTTCGTCGAGAAAAATATATCCCGAAAGGGGGACCAGACGGTGGTGATGGCGGTGATGGTGGTGATGTCTACATGGTTGCAGACGAAAACCTCAACACCCTTATCGATTACCGTTTTACTAAATCTTATCGCGCTGAGCGTGGTGAAAATGGCCAAAGCCGTGATTGTACGGGAAAACGTGGTCAAGATATTACTATTAATGTCCCTGTGGGGACGCGTGCCCGTGATCTTGCTACAGGTGAGATCATTGCTGACTTAACGGTACATGGTCAAAAACAAATGGTCGCTAAAGGTGGCTTCCATGGTTTAGGGAATACGCGTTTTAAATCATCAGTCAATCGTGCACCACGTCAACGCACAATGGGTACACCGGGTGAATCACGTGAAGTACTGTTAGAGCTGATGCTACTTGCGGATGTAGGTATGTTAGGTATGCCGAATGCCGGTAAATCTACCTTTATTCGAGCCGTCTCGGCAGCCAAACCAAAAGTGGCAGATTATCCATTTACTACACTAGTACCTAGCTTAGGTGTTGTGCGTATGGACAGCCATCAAAGCTTTGTCGTTGCAGATATACCGGGGCTGATCGAAGGGGCTGCTGATGGCGCGGGTCTTGGGATCCAGTTCCTGAAACATTTAGAACGTTGCCGTGTATTATTGCATTTGATCGACATCGATCCTATTGATGGTTCTGATCCCGTTGAAAATGCCAAAATCATTATTTCTGAATTAGAAAAATACAGCGATAAACTGGCACAAAAACCACGTTGGTTAGTTTTCAATAAAGTGGATCTGCTTGATGCCGATGAAGCAAAACAGAAAGCACAAGCGATAGTTGAAGCGTTGGGTTGGGAAGGTGATTATTATATGATTGCTGCTATCAACCAAGAAGGGGTGAAAAAACTTTGTTGGGATATTATGGAATTCCTGAAAGTAACCCCACGTGAGCAAGATATTGCTACCGCTTTAGCCGCTGAAGAAAAAGTTGATTTTATGTGGGATGACTACCATAAAGAACAACTTGAAAATCCTGACCTTGAAGACGATGACGAAGATTGGGATGAAGAAGATGATGATGGTGTAGAGTTTATCTACCAACGCTAATCTCTCTTTTTATCGGTATTGTTGTCTCGGTATCGTATAGACATACAGAT