Homologs in group_1393

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08605 FBDBKF_08605 91.5 Morganella morganii S1 obgE GTPase ObgE
EHELCC_12920 EHELCC_12920 91.5 Morganella morganii S2 obgE GTPase ObgE
NLDBIP_13260 NLDBIP_13260 91.5 Morganella morganii S4 obgE GTPase ObgE
LHKJJB_13295 LHKJJB_13295 91.5 Morganella morganii S3 obgE GTPase ObgE
HKOGLL_11735 HKOGLL_11735 91.5 Morganella morganii S5 obgE GTPase ObgE
PMI_RS16960 PMI_RS16960 78.9 Proteus mirabilis HI4320 cgtA Obg family GTPase CgtA

Distribution of the homologs in the orthogroup group_1393

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1393

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q2NW34 0.0 591 77 3 392 3 obg GTPase Obg Sodalis glossinidius (strain morsitans)
B4F2A8 0.0 590 77 1 392 3 obg GTPase Obg Proteus mirabilis (strain HI4320)
Q7MYX6 0.0 583 81 1 392 3 obg GTPase Obg Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B2VGT5 0.0 577 78 1 366 3 obg GTPase Obg Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JMI3 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F73 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRJ6 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pestis (strain Pestoides F)
Q1CEK0 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Nepal516)
A9R591 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Angola)
Q7CKJ6 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pestis
B2K2P2 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBZ4 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMT5 0.0 561 76 1 392 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8AQ74 0.0 561 78 1 363 3 obg GTPase Obg Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1JIV6 0.0 552 76 1 392 3 obg GTPase Obg Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5XSV8 0.0 547 78 2 367 3 obg GTPase Obg Klebsiella pneumoniae (strain 342)
A6TEK2 0.0 547 79 1 363 3 obg GTPase Obg Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WEZ6 0.0 547 79 1 363 3 obg GTPase Obg Enterobacter sp. (strain 638)
A8G8Z4 0.0 543 76 2 394 3 obg GTPase Obg Serratia proteamaculans (strain 568)
A7MJF1 0.0 543 76 2 396 3 obg GTPase Obg Cronobacter sakazakii (strain ATCC BAA-894)
P42641 0.0 541 76 1 392 1 obgE GTPase ObgE/CgtA Escherichia coli (strain K12)
B1XHF9 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli (strain K12 / DH10B)
Q8FD82 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCS7 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG86 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O1:K1 / APEC
B5YS72 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9K7 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O157:H7
B7MBV2 0.0 541 76 1 392 3 obg GTPase Obg Escherichia coli O45:K1 (strain S88 / ExPEC)
B5REP9 0.0 540 75 1 392 3 obg GTPase Obg Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q6D9C3 0.0 538 74 1 392 3 obg GTPase Obg Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8Z3H1 0.0 535 77 1 363 3 obg GTPase Obg Salmonella typhi
Q8ZLS5 0.0 535 77 1 363 1 obg GTPase Obg Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWF3 0.0 535 77 1 363 3 obg GTPase Obg Salmonella schwarzengrund (strain CVM19633)
B5BGK7 0.0 535 77 1 363 3 obg GTPase Obg Salmonella paratyphi A (strain AKU_12601)
C0PZJ5 0.0 535 77 1 363 3 obg GTPase Obg Salmonella paratyphi C (strain RKS4594)
A9N750 0.0 535 77 1 363 3 obg GTPase Obg Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLB7 0.0 535 77 1 363 3 obg GTPase Obg Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T714 0.0 535 77 1 363 3 obg GTPase Obg Salmonella newport (strain SL254)
B4TJ21 0.0 535 77 1 363 3 obg GTPase Obg Salmonella heidelberg (strain SL476)
B5R0H4 0.0 535 77 1 363 3 obg GTPase Obg Salmonella enteritidis PT4 (strain P125109)
B5FIN3 0.0 535 77 1 363 3 obg GTPase Obg Salmonella dublin (strain CT_02021853)
Q57JG7 0.0 535 77 1 363 3 obg GTPase Obg Salmonella choleraesuis (strain SC-B67)
A9MP23 0.0 535 75 2 393 3 obg GTPase Obg Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F6V2 0.0 535 77 1 363 3 obg GTPase Obg Salmonella agona (strain SL483)
Q1R6F4 0.0 533 77 1 363 3 obg GTPase Obg Escherichia coli (strain UTI89 / UPEC)
Q83Q14 0.0 523 76 1 392 3 obg GTPase Obg Shigella flexneri
Q0T0A1 0.0 523 76 1 392 3 obg GTPase Obg Shigella flexneri serotype 5b (strain 8401)
Q31W60 0.0 523 76 1 392 3 obg GTPase Obg Shigella boydii serotype 4 (strain Sb227)
B2U1Z4 0.0 523 76 1 392 3 obg GTPase Obg Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LR50 0.0 523 76 1 392 3 obg GTPase Obg Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LFT3 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli (strain SMS-3-5 / SECEC)
B6I1Q6 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli (strain SE11)
B7NDG7 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IQU0 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A4Z8 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O9:H4 (strain HS)
B7M089 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O8 (strain IAI1)
B7N0W5 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O81 (strain ED1a)
B7LHP6 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli (strain 55989 / EAEC)
B7UJ76 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZS79 0.0 523 76 1 392 3 obg GTPase Obg Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YX58 0.0 523 76 1 392 3 obg GTPase Obg Shigella sonnei (strain Ss046)
B7NKQ0 0.0 522 75 1 392 3 obg GTPase Obg Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q32BF0 0.0 521 75 2 397 3 obg GTPase Obg Shigella dysenteriae serotype 1 (strain Sd197)
B0UVI2 4.39e-180 509 71 1 365 3 obg GTPase Obg Histophilus somni (strain 2336)
Q0I1P5 8.24e-179 505 70 1 365 3 obg GTPase Obg Histophilus somni (strain 129Pt)
A6VMU1 9.36e-179 505 68 2 392 3 obg GTPase Obg Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CNS4 2.26e-178 504 71 1 363 3 obg GTPase Obg Pasteurella multocida (strain Pm70)
Q15PF0 3.7e-175 496 70 1 365 3 obg GTPase Obg Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4QM31 3.82e-174 493 68 1 391 3 obg GTPase Obg Haemophilus influenzae (strain 86-028NP)
Q65S59 2.48e-173 491 68 1 391 3 obg GTPase Obg Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UDJ7 4.58e-172 489 69 1 365 3 obg GTPase Obg Haemophilus influenzae (strain PittEE)
A5UI23 7.66e-172 488 69 1 365 3 obg GTPase Obg Haemophilus influenzae (strain PittGG)
B0BRJ9 8.51e-171 485 67 1 392 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZN0 8.51e-171 485 67 1 392 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MYB2 8.89e-171 485 65 3 399 3 obg GTPase Obg Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F871 4.04e-169 481 67 2 393 3 obg GTPase Obg Glaesserella parasuis serovar 5 (strain SH0165)
B4RZH3 5.16e-168 478 68 1 369 3 obg GTPase Obg Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
P44915 5.8e-168 478 69 1 391 3 obg GTPase Obg Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A4SR17 6.52e-166 473 70 2 362 3 obg GTPase Obg Aeromonas salmonicida (strain A449)
Q5R039 1.18e-165 472 67 1 359 3 obg GTPase Obg Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A0KGS9 5.08e-165 471 69 2 365 3 obg GTPase Obg Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VP37 1.29e-163 467 64 3 399 3 obg GTPase Obg Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87SU2 1.91e-163 466 67 1 370 3 obg GTPase Obg Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6E0U3 6.18e-162 462 67 1 370 1 cgtA GTPase Obg/CgtA Vibrio harveyi
A7N0G2 6.18e-162 462 67 1 370 3 obg GTPase Obg Vibrio campbellii (strain ATCC BAA-1116)
Q7MP92 8.91e-162 462 69 2 359 3 obg GTPase Obg Vibrio vulnificus (strain YJ016)
Q1LSJ9 1.7e-161 459 66 0 333 3 obg GTPase Obg Baumannia cicadellinicola subsp. Homalodisca coagulata
A3QB95 9.83e-161 459 67 1 368 3 obg GTPase Obg Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8DEC6 1.09e-160 459 69 2 359 3 obg GTPase Obg Vibrio vulnificus (strain CMCP6)
B1KGH1 1.34e-160 459 65 1 368 3 obg GTPase Obg Shewanella woodyi (strain ATCC 51908 / MS32)
B7VID5 1.4e-160 459 66 1 370 3 obg GTPase Obg Vibrio atlanticus (strain LGP32)
Q9KUS8 2.42e-160 458 66 1 370 1 cgtA GTPase Obg/CgtA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1SSB6 2.52e-159 456 67 1 363 3 obg GTPase Obg Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q5E871 1.16e-158 454 66 1 370 3 obg GTPase Obg Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGF9 3.65e-158 453 66 1 370 3 obg GTPase Obg Aliivibrio fischeri (strain MJ11)
B8CSY3 1.38e-155 446 62 1 392 3 obg GTPase Obg Shewanella piezotolerans (strain WP3 / JCM 13877)
A8FRU4 3.3e-155 445 66 1 362 3 obg GTPase Obg Shewanella sediminis (strain HAW-EB3)
Q6LV46 3.51e-155 445 65 1 366 3 obg GTPase Obg Photobacterium profundum (strain SS9)
Q3IFF6 7.07e-155 444 66 1 366 3 obg GTPase Obg Pseudoalteromonas translucida (strain TAC 125)
B6EL43 3e-153 441 64 2 374 3 obg GTPase Obg Aliivibrio salmonicida (strain LFI1238)
Q0HRZ8 5.81e-152 437 66 1 364 3 obg GTPase Obg Shewanella sp. (strain MR-7)
Q0HLU0 5.81e-152 437 66 1 364 3 obg GTPase Obg Shewanella sp. (strain MR-4)
A0L072 5.81e-152 437 66 1 364 3 obg GTPase Obg Shewanella sp. (strain ANA-3)
A9L430 7.98e-152 437 65 1 367 3 obg GTPase Obg Shewanella baltica (strain OS195)
A6WK51 7.98e-152 437 65 1 367 3 obg GTPase Obg Shewanella baltica (strain OS185)
A3D180 7.98e-152 437 65 1 367 3 obg GTPase Obg Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EC04 7.98e-152 437 65 1 367 3 obg GTPase Obg Shewanella baltica (strain OS223)
Q8EB83 6.21e-151 434 65 1 368 3 obg GTPase Obg Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A4XYL2 8.5e-151 435 60 1 369 3 obg GTPase Obg Pseudomonas mendocina (strain ymp)
Q88Q08 1.13e-150 435 62 1 369 3 obg GTPase Obg Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYC6 1.13e-150 435 62 1 369 3 obg GTPase Obg Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1RMV6 1.19e-150 434 66 1 368 3 obg GTPase Obg Shewanella sp. (strain W3-18-1)
A4Y427 1.19e-150 434 66 1 368 3 obg GTPase Obg Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q07YJ0 1.64e-150 433 64 1 368 3 obg GTPase Obg Shewanella frigidimarina (strain NCIMB 400)
B0KMF6 3.06e-150 434 61 1 369 3 obg GTPase Obg Pseudomonas putida (strain GB-1)
A1S9H3 8.54e-149 429 66 1 392 3 obg GTPase Obg Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q47VL4 8.99e-149 429 65 1 363 3 obg GTPase Obg Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q4ZYK1 3.22e-148 428 61 1 369 3 obg GTPase Obg Pseudomonas syringae pv. syringae (strain B728a)
Q48NL2 3.22e-148 428 61 1 369 3 obg GTPase Obg Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9HVL8 7.13e-148 427 60 2 370 3 obg GTPase Obg Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02GB1 7.13e-148 427 60 2 370 1 obg GTPase Obg Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V0A9 7.13e-148 427 60 2 370 3 obg GTPase Obg Pseudomonas aeruginosa (strain LESB58)
A8H0U4 8.43e-148 427 66 1 360 3 obg GTPase Obg Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A6VBV3 1.58e-147 427 60 2 370 3 obg GTPase Obg Pseudomonas aeruginosa (strain PA7)
Q3K6K9 7.06e-147 425 61 1 369 3 obg GTPase Obg Pseudomonas fluorescens (strain Pf0-1)
C1DEA4 1.08e-146 424 60 1 369 3 obg GTPase Obg Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4K5T8 1.23e-146 424 62 1 369 3 obg GTPase Obg Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1IF13 2.37e-146 424 59 1 369 3 obg GTPase Obg Pseudomonas entomophila (strain L48)
A1TYY4 2.88e-146 423 63 0 341 3 obg GTPase Obg Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B1JF57 3.08e-146 423 59 1 369 3 obg GTPase Obg Pseudomonas putida (strain W619)
B0TUI2 8.71e-146 421 65 1 367 3 obg GTPase Obg Shewanella halifaxensis (strain HAW-EB4)
Q12K23 1.25e-145 421 65 1 360 3 obg GTPase Obg Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4VI54 8.98e-141 409 59 1 369 3 obg GTPase Obg Stutzerimonas stutzeri (strain A1501)
Q21M07 3.86e-140 407 57 2 400 3 obg GTPase Obg Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2S9T3 1.03e-139 406 59 2 365 3 obg GTPase Obg Hahella chejuensis (strain KCTC 2396)
Q605N2 2.6e-139 403 62 1 340 3 obg GTPase Obg Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B3PIU9 2.68e-139 405 61 0 332 3 obg GTPase Obg Cellvibrio japonicus (strain Ueda107)
Q8K9G1 4.44e-139 402 57 1 332 3 obg GTPase Obg Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B8D7S4 9.65e-139 402 57 0 332 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57469 9.65e-139 402 57 0 332 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9H2 9.65e-139 402 57 0 332 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A6W352 4.21e-138 402 63 0 333 3 obg GTPase Obg Marinomonas sp. (strain MWYL1)
Q83ED8 7.93e-136 394 60 0 337 3 obg GTPase Obg Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KEJ7 7.93e-136 394 60 0 337 3 obg GTPase Obg Coxiella burnetii (strain Dugway 5J108-111)
B6J1S8 7.93e-136 394 60 0 337 3 obg GTPase Obg Coxiella burnetii (strain CbuG_Q212)
B6J9K2 8.84e-136 394 60 0 337 3 obg GTPase Obg Coxiella burnetii (strain CbuK_Q154)
B8GQQ3 1.07e-135 394 60 1 333 3 obg GTPase Obg Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A9NBL5 7.67e-135 392 59 0 337 3 obg GTPase Obg Coxiella burnetii (strain RSA 331 / Henzerling II)
Q5WTF1 1.12e-134 391 59 1 341 3 obg GTPase Obg Legionella pneumophila (strain Lens)
Q5X1P1 2.32e-134 390 60 1 334 3 obg GTPase Obg Legionella pneumophila (strain Paris)
A1KAD0 4.85e-134 392 61 2 349 3 obg GTPase Obg Azoarcus sp. (strain BH72)
Q5ZS70 6.12e-134 390 60 1 334 3 obg GTPase Obg Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IAS7 8.48e-133 387 59 1 334 3 obg GTPase Obg Legionella pneumophila (strain Corby)
Q3J6S0 8.25e-132 384 60 1 333 3 obg GTPase Obg Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q1GZ53 6.01e-131 382 59 2 344 3 obg GTPase Obg Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4JBB8 1.18e-130 382 59 2 344 3 obg GTPase Obg Burkholderia vietnamiensis (strain G4 / LMG 22486)
B0VCR5 2.97e-129 380 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain AYE)
A3M7M2 2.97e-129 380 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWM9 2.97e-129 380 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain ACICU)
B7I557 2.97e-129 380 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain AB0057)
B7GYV1 2.97e-129 380 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain AB307-0294)
Q5P7Z4 3.85e-129 380 60 2 343 3 obg GTPase Obg Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6F9D8 7.22e-129 379 58 0 341 3 obg GTPase Obg Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1R0C0 8.85e-129 379 57 0 341 3 obg GTPase Obg Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0VTQ1 3.51e-128 377 60 0 330 3 obg GTPase Obg Acinetobacter baumannii (strain SDF)
Q2Y807 5.02e-128 375 58 1 333 3 obg GTPase Obg Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NZS1 1.76e-127 375 57 2 349 3 obg GTPase Obg Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q39JU7 2.4e-127 374 58 1 337 3 obg GTPase Obg Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0AAD6 6.33e-127 372 58 2 347 3 obg GTPase Obg Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q82V20 7.72e-127 372 57 1 343 3 obg GTPase Obg Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1QA43 8.43e-127 374 60 0 329 3 obg GTPase Obg Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0VSE6 9.75e-127 373 58 0 329 3 obg GTPase Obg Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A3NDS7 1e-126 372 56 2 358 3 obg GTPase Obg Burkholderia pseudomallei (strain 668)
Q4FRK6 1.36e-126 373 60 0 329 3 obg GTPase Obg Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2SZG0 1.49e-126 372 55 2 358 3 obg GTPase Obg Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6T2D5 2.05e-126 372 57 0 332 3 obg GTPase Obg Janthinobacterium sp. (strain Marseille)
Q63QM0 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia pseudomallei (strain K96243)
Q3JNG0 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia pseudomallei (strain 1710b)
A3NZJ0 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia pseudomallei (strain 1106a)
A1V0P1 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia mallei (strain SAVP1)
Q62GV4 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia mallei (strain ATCC 23344)
A2S5R8 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10229)
A3MR90 2.06e-126 372 56 2 358 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10247)
A0Q8K2 4.66e-126 369 56 2 335 3 obg GTPase Obg Francisella tularensis subsp. novicida (strain U112)
A4G8R4 8.02e-126 370 57 0 332 3 obg GTPase Obg Herminiimonas arsenicoxydans
Q13U15 1.63e-125 369 56 1 337 3 obg GTPase Obg Paraburkholderia xenovorans (strain LB400)
Q5NEB0 4.12e-125 367 56 2 335 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FR3 4.12e-125 367 56 2 335 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain FSC 198)
B0TWK7 4.6e-125 367 56 2 335 3 obg GTPase Obg Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2SEA8 6.88e-125 366 56 2 335 3 obg GTPase Obg Francisella tularensis subsp. mediasiatica (strain FSC147)
Q9PAS3 9.2e-125 367 56 4 358 3 obg GTPase Obg Xylella fastidiosa (strain 9a5c)
Q87BL2 1.17e-124 367 56 3 353 3 obg GTPase Obg Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6V6 1.17e-124 367 56 3 353 3 obg GTPase Obg Xylella fastidiosa (strain M23)
A4IVW3 1.54e-124 365 56 2 335 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SYV2 2.43e-124 366 56 1 337 3 obg GTPase Obg Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2JHD7 2.45e-124 366 56 1 337 3 obg GTPase Obg Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2FTD3 4.1e-124 365 58 1 346 3 obg GTPase Obg Stenotrophomonas maltophilia (strain K279a)
Q1BZE0 7.37e-124 365 59 1 337 3 obg GTPase Obg Burkholderia orbicola (strain AU 1054)
B4E5X0 7.37e-124 365 59 1 337 3 obg GTPase Obg Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B2UCV3 7.58e-124 365 58 1 334 3 obg GTPase Obg Ralstonia pickettii (strain 12J)
B9MDZ7 9.57e-124 364 58 2 344 3 obg GTPase Obg Acidovorax ebreus (strain TPSY)
Q8XVL0 1.27e-123 364 56 2 353 3 obg GTPase Obg Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q47AD0 1.7e-123 364 58 3 343 3 obg GTPase Obg Dechloromonas aromatica (strain RCB)
B4SP14 1.87e-123 363 58 1 346 3 obg GTPase Obg Stenotrophomonas maltophilia (strain R551-3)
B1JVA1 2.91e-123 363 59 1 337 3 obg GTPase Obg Burkholderia orbicola (strain MC0-3)
A0K4B0 2.91e-123 363 59 1 337 3 obg GTPase Obg Burkholderia cenocepacia (strain HI2424)
Q31IT4 6.16e-123 362 58 0 344 3 obg GTPase Obg Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B0U3R3 8.73e-123 362 55 4 358 3 obg GTPase Obg Xylella fastidiosa (strain M12)
Q0AHG5 9.39e-123 361 59 1 333 3 obg GTPase Obg Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A1WY48 2.13e-122 360 60 3 341 3 obg GTPase Obg Halorhodospira halophila (strain DSM 244 / SL1)
Q0BK24 2.25e-122 360 55 2 335 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1B4 2.25e-122 360 55 2 335 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain LVS)
A7NEQ3 2.25e-122 360 55 2 335 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B1YSU7 2.6e-122 361 57 2 353 3 obg GTPase Obg Burkholderia ambifaria (strain MC40-6)
A1W4B0 3.68e-122 360 57 2 344 3 obg GTPase Obg Acidovorax sp. (strain JS42)
A5WFV1 4.44e-122 362 58 1 330 3 obg GTPase Obg Psychrobacter sp. (strain PRwf-1)
Q0BIH8 4.83e-122 360 56 2 353 3 obg GTPase Obg Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A2SD36 9.59e-122 360 56 0 335 3 obg GTPase Obg Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A9BP68 1.71e-121 359 58 2 343 3 obg GTPase Obg Delftia acidovorans (strain DSM 14801 / SPH-1)
Q493U5 2.16e-121 358 52 2 342 3 obg GTPase Obg Blochmanniella pennsylvanica (strain BPEN)
B3R898 3.98e-121 358 56 1 335 3 obg GTPase Obg Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0K6P6 4.25e-121 358 57 1 335 3 obg GTPase Obg Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A1KWG2 4.63e-121 358 56 3 352 3 obg GTPase Obg Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q1LIQ0 5.11e-121 358 58 1 327 3 obg GTPase Obg Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8PN23 7.34e-121 357 57 1 351 3 obg GTPase Obg Xanthomonas axonopodis pv. citri (strain 306)
B4RQP4 1.11e-120 357 56 3 352 3 obg GTPase Obg Neisseria gonorrhoeae (strain NCCP11945)
Q5F5D9 1.11e-120 357 56 3 352 1 obg GTPase Obg Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q3SKG2 1.25e-120 356 58 2 343 3 obg GTPase Obg Thiobacillus denitrificans (strain ATCC 25259)
Q9JXE5 1.86e-120 357 56 3 352 3 obg GTPase Obg Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1IPH6 4.5e-120 356 57 3 347 3 obg GTPase Obg Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5H2E5 4.55e-120 355 57 1 346 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STC0 4.55e-120 355 57 1 346 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P5B4 4.55e-120 355 57 1 346 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A1TTD3 5.45e-120 355 58 2 338 3 obg GTPase Obg Paracidovorax citrulli (strain AAC00-1)
Q3BW46 5.5e-120 355 57 1 342 3 obg GTPase Obg Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A4SVA3 1.31e-119 354 55 1 343 3 obg GTPase Obg Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A9M061 3.33e-119 353 56 3 352 3 obg GTPase Obg Neisseria meningitidis serogroup C (strain 053442)
A9IFF9 4.27e-119 353 53 5 369 3 obg GTPase Obg Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q46X17 1.58e-118 351 56 1 327 3 obg GTPase Obg Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9AI60 2.08e-118 351 58 1 337 3 obg GTPase Obg Burkholderia multivorans (strain ATCC 17616 / 249)
B1XT35 4.56e-118 350 54 1 351 3 obg GTPase Obg Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B1Y280 7.69e-118 350 54 2 351 3 obg GTPase Obg Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2L062 1.18e-117 349 55 5 367 3 obg GTPase Obg Bordetella avium (strain 197N)
B5ELU2 1.65e-117 349 59 0 332 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J427 1.65e-117 349 59 0 332 3 obg GTPase Obg Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A5EVP4 1.06e-116 346 55 2 343 3 obg GTPase Obg Dichelobacter nodosus (strain VCS1703A)
Q12F99 9.61e-116 344 53 2 355 3 obg GTPase Obg Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q89AE7 1.96e-115 342 53 0 332 3 obg GTPase Obg Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1VK90 8.2e-115 342 54 2 343 3 obg GTPase Obg Polaromonas naphthalenivorans (strain CJ2)
A1WPR5 6.41e-114 339 54 1 345 3 obg GTPase Obg Verminephrobacter eiseniae (strain EF01-2)
A1AW67 9.64e-114 338 54 1 332 3 obg GTPase Obg Ruthia magnifica subsp. Calyptogena magnifica
Q8PBH0 1.36e-113 338 59 1 346 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RY32 1.36e-113 338 59 1 346 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain B100)
Q4US36 1.36e-113 338 59 1 346 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain 8004)
Q21YZ9 1.27e-112 336 54 2 343 3 obg GTPase Obg Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7VZX6 5.25e-112 335 54 5 363 3 obg GTPase Obg Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1P2 5.25e-112 335 54 5 363 3 obg GTPase Obg Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQL8 5.25e-112 335 54 5 363 3 obg GTPase Obg Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A5CX17 1.62e-111 332 52 1 332 3 obg GTPase Obg Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A0LCZ3 1.18e-107 324 54 1 329 3 obg GTPase Obg Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
C0QUB5 8.83e-102 308 51 1 330 3 obg GTPase Obg Persephonella marina (strain DSM 14350 / EX-H1)
Q0BRE9 1.21e-101 307 51 2 342 3 obg GTPase Obg Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A5FV29 1.24e-101 307 53 2 332 3 obg GTPase Obg Acidiphilium cryptum (strain JF-5)
Q057J0 8.73e-101 305 48 2 338 3 obg GTPase Obg Buchnera aphidicola subsp. Cinara cedri (strain Cc)
B8CXZ0 1.39e-100 308 50 3 354 3 obg GTPase Obg Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B5YJ65 3.95e-100 303 51 1 330 3 obg GTPase Obg Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B3QVU6 9.52e-100 302 49 4 336 3 obg GTPase Obg Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B2IYX1 1.69e-99 302 51 3 334 3 obg GTPase Obg Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A9FJF8 2.08e-99 302 50 3 334 3 obg GTPase Obg Sorangium cellulosum (strain So ce56)
Q2J3J8 3.64e-99 301 53 4 325 3 obg GTPase Obg Rhodopseudomonas palustris (strain HaA2)
A5E965 4.14e-99 301 49 5 359 3 obg GTPase Obg Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q6NDE6 5.26e-99 301 53 4 325 3 obg GTPase Obg Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B3Q731 5.68e-99 301 51 4 336 3 obg GTPase Obg Rhodopseudomonas palustris (strain TIE-1)
Q13DL7 8.48e-99 300 53 4 325 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB5)
A7HT67 1.08e-98 300 53 3 322 3 obg GTPase Obg Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B3E609 1.6e-98 299 51 3 342 3 obg GTPase Obg Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q5FUL2 1.79e-98 299 50 2 338 3 obg GTPase Obg Gluconobacter oxydans (strain 621H)
Q3A1D8 2.59e-98 299 52 2 329 3 obg GTPase Obg Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2LR77 4.39e-98 298 51 3 335 3 obg GTPase Obg Syntrophus aciditrophicus (strain SB)
A9H0F1 7.94e-98 298 51 4 346 3 obg GTPase Obg Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q07U75 8.48e-98 298 52 4 325 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisA53)
B2V968 9.26e-98 298 47 1 347 3 obg GTPase Obg Sulfurihydrogenibium sp. (strain YO3AOP1)
Q3SVI2 1.3e-97 298 51 4 333 3 obg GTPase Obg Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2IH84 2.53e-97 297 51 4 341 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-C)
B4UIU2 4.07e-97 296 51 4 341 3 obg GTPase Obg Anaeromyxobacter sp. (strain K)
B8JBP2 5.4e-97 296 51 4 341 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A4YKF3 5.82e-97 296 49 5 354 3 obg GTPase Obg Bradyrhizobium sp. (strain ORS 278)
A8FFS8 8.49e-97 298 46 1 355 3 obg GTPase Obg Bacillus pumilus (strain SAFR-032)
Q0AKX2 1.52e-96 295 50 3 332 3 obg GTPase Obg Maricaulis maris (strain MCS10)
Q38WT4 1.57e-96 297 49 0 330 3 obg GTPase Obg Latilactobacillus sakei subsp. sakei (strain 23K)
Q3AF51 1.62e-96 297 51 1 340 3 obg GTPase Obg Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B3QRD8 2.44e-96 293 49 5 349 3 obg GTPase Obg Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B6JD21 3.06e-96 294 50 4 337 3 obg GTPase Obg Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A7HIF8 4.43e-96 293 52 4 328 3 obg GTPase Obg Anaeromyxobacter sp. (strain Fw109-5)
A4J7I9 7.4e-96 295 50 2 331 3 obg GTPase Obg Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A1BJ56 7.44e-96 292 48 2 337 3 obg GTPase Obg Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q88VG4 9.19e-96 295 49 2 336 3 obg GTPase Obg Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A1B9C8 1.33e-95 292 54 3 321 3 obg GTPase Obg Paracoccus denitrificans (strain Pd 1222)
Q3B6H6 1.44e-95 292 50 3 324 3 obg GTPase Obg Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q1DC95 1.76e-95 296 53 3 336 3 obg GTPase Obg Myxococcus xanthus (strain DK1622)
Q8KAF0 1.77e-95 291 49 4 343 3 obg GTPase Obg Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
C1F9K2 2.29e-95 291 50 3 332 3 obg GTPase Obg Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A0LPF9 2.63e-95 291 53 4 336 3 obg GTPase Obg Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q3APF4 2.79e-95 291 51 2 324 3 obg GTPase Obg Chlorobium chlorochromatii (strain CaD3)
Q0BZ39 3.18e-95 291 49 2 332 3 obg GTPase Obg Hyphomonas neptunium (strain ATCC 15444)
Q2NCX8 4.09e-95 291 50 3 332 3 obg GTPase Obg Erythrobacter litoralis (strain HTCC2594)
Q03F34 4.46e-95 294 50 2 339 3 obg GTPase Obg Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B8IEL9 6.02e-95 290 48 3 343 3 obg GTPase Obg Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q98EZ3 6.08e-95 290 48 4 347 3 obg GTPase Obg Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A7Z781 6.55e-95 293 48 1 332 3 obg GTPase Obg Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B0UMS4 8.6e-95 290 51 3 321 3 obg GTPase Obg Methylobacterium sp. (strain 4-46)
B1LA53 9.09e-95 293 49 2 339 3 obg GTPase Obg Thermotoga sp. (strain RQ2)
Q8FYM2 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella suis biovar 1 (strain 1330)
A9WWW9 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VSI5 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YJ80 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M882 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57B45 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella abortus biovar 1 (strain 9-941)
Q2YLM2 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella abortus (strain 2308)
B2S806 1.15e-94 290 50 4 343 3 obg GTPase Obg Brucella abortus (strain S19)
A1URN4 1.33e-94 289 51 3 321 3 obg GTPase Obg Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A5IKX2 1.51e-94 292 49 2 339 3 obg GTPase Obg Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q2JJ90 1.54e-94 290 48 2 341 3 obg GTPase Obg Synechococcus sp. (strain JA-2-3B'a(2-13))
Q0AWJ4 2.25e-94 291 50 2 336 3 obg GTPase Obg Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2S3C0 3.24e-94 288 49 3 342 3 obg GTPase Obg Salinibacter ruber (strain DSM 13855 / M31)
B9IZ16 3.69e-94 291 48 1 332 3 obg GTPase Obg Bacillus cereus (strain Q1)
Q89X89 3.75e-94 288 50 4 326 3 obg GTPase Obg Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5LRY4 3.76e-94 288 52 3 321 3 obg GTPase Obg Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B7HE73 3.94e-94 291 47 1 332 3 obg GTPase Obg Bacillus cereus (strain B4264)
Q5NR23 4.46e-94 288 47 4 356 3 obg GTPase Obg Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A6LJZ0 4.91e-94 291 47 2 348 3 obg GTPase Obg Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B1M697 5.21e-94 288 48 4 342 3 obg GTPase Obg Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q2G983 5.22e-94 288 53 3 332 3 obg GTPase Obg Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2VZU2 5.48e-94 290 49 4 353 3 obg GTPase Obg Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A5D410 6.09e-94 290 50 1 330 3 obg GTPase Obg Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q6HD85 6.54e-94 291 46 2 353 3 obg GTPase Obg Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634A3 6.54e-94 291 46 2 353 3 obg GTPase Obg Bacillus cereus (strain ZK / E33L)
C1ETN7 6.54e-94 291 46 2 353 3 obg GTPase Obg Bacillus cereus (strain 03BB102)
A0RJ47 6.54e-94 291 46 2 353 3 obg GTPase Obg Bacillus thuringiensis (strain Al Hakam)
Q747Q2 7.3e-94 287 50 2 329 3 obg GTPase Obg Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B7HQJ8 7.37e-94 290 47 1 332 3 obg GTPase Obg Bacillus cereus (strain AH187)
Q817U6 9.14e-94 290 47 1 332 3 obg GTPase Obg Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q21D04 9.82e-94 287 49 5 351 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB18)
A5GD29 9.89e-94 287 51 1 338 3 obg GTPase Obg Geotalea uraniireducens (strain Rf4)
P72931 1.07e-93 288 53 1 291 3 obg GTPase Obg Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7JQ26 1.1e-93 290 45 2 353 3 obg GTPase Obg Bacillus cereus (strain AH820)
Q81LF0 1.1e-93 290 45 2 353 3 obg GTPase Obg Bacillus anthracis
A6WXS0 1.57e-93 286 52 3 321 3 obg GTPase Obg Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B7GIR2 2.12e-93 289 48 1 332 3 obg GTPase Obg Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5N4J6 2.32e-93 286 48 5 351 3 obg GTPase Obg Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PN0 2.32e-93 286 48 5 351 3 obg GTPase Obg Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4S5P1 3.54e-93 285 52 1 289 3 obg GTPase Obg Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q39QR4 4.05e-93 285 49 2 342 3 obg GTPase Obg Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B1HVB2 4.14e-93 288 46 1 330 3 obg GTPase Obg Lysinibacillus sphaericus (strain C3-41)
B1X0M2 5.47e-93 285 49 2 324 3 obg GTPase Obg Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1ZL15 5.77e-93 285 50 4 323 3 obg GTPase Obg Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q6G4Z2 5.85e-93 285 50 3 324 3 obg GTPase Obg Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A4WZ45 7.02e-93 285 53 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A8F478 8.53e-93 288 49 1 330 3 obg GTPase Obg Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A4IRC7 9e-93 288 49 1 332 3 obg GTPase Obg Geobacillus thermodenitrificans (strain NG80-2)
Q1QQU0 1.1e-92 285 49 5 348 3 obg GTPase Obg Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B0CDA2 1.19e-92 285 46 2 351 3 obg GTPase Obg Acaryochloris marina (strain MBIC 11017)
A9IMA6 1.35e-92 284 50 3 322 3 obg GTPase Obg Bartonella tribocorum (strain CIP 105476 / IBS 506)
A9VYM4 1.4e-92 284 49 4 336 3 obg GTPase Obg Methylorubrum extorquens (strain PA1)
B7KSH0 1.4e-92 284 49 4 336 3 obg GTPase Obg Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B7KIC1 1.52e-92 284 47 2 339 3 obg GTPase Obg Gloeothece citriformis (strain PCC 7424)
A0Q1T4 1.62e-92 287 47 1 331 3 obg GTPase Obg Clostridium novyi (strain NT)
A9VIR5 1.81e-92 287 47 1 332 3 obg GTPase Obg Bacillus mycoides (strain KBAB4)
Q1GHD0 2.35e-92 284 52 4 322 3 obg GTPase Obg Ruegeria sp. (strain TM1040)
Q72ZY5 2.36e-92 286 47 1 332 3 obg GTPase Obg Bacillus cereus (strain ATCC 10987 / NRS 248)
A4SCP4 2.7e-92 283 52 1 287 3 obg GTPase Obg Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q2JS78 2.84e-92 285 51 2 332 3 obg GTPase Obg Synechococcus sp. (strain JA-3-3Ab)
Q46HF4 3.34e-92 283 51 2 321 3 obg GTPase Obg Prochlorococcus marinus (strain NATL2A)
B9L101 3.34e-92 288 51 4 343 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q1RGV9 3.64e-92 283 48 3 324 3 obg GTPase Obg Rickettsia bellii (strain RML369-C)
A8GUG0 3.64e-92 283 48 3 324 3 obg GTPase Obg Rickettsia bellii (strain OSU 85-389)
Q10XA1 3.73e-92 283 51 4 339 3 obg GTPase Obg Trichodesmium erythraeum (strain IMS101)
Q5WHS8 4.66e-92 286 47 2 336 3 obg GTPase Obg Shouchella clausii (strain KSM-K16)
B7IGK8 4.89e-92 286 45 2 348 3 obg GTPase Obg Thermosipho africanus (strain TCF52B)
Q5KWP5 5.19e-92 286 48 3 343 3 obg GTPase Obg Geobacillus kaustophilus (strain HTA426)
A2C050 5.37e-92 282 51 2 321 3 obg GTPase Obg Prochlorococcus marinus (strain NATL1A)
B6IQZ9 6.49e-92 283 49 3 332 3 obg GTPase Obg Rhodospirillum centenum (strain ATCC 51521 / SW)
B4RD64 7.03e-92 283 52 5 326 3 obg GTPase Obg Phenylobacterium zucineum (strain HLK1)
Q165Y6 8.38e-92 282 56 3 297 3 obg GTPase Obg Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B7IIV2 1.19e-91 285 45 1 354 3 obg GTPase Obg Bacillus cereus (strain G9842)
Q6AK07 1.21e-91 283 50 3 325 3 obg GTPase Obg Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A9BK05 1.21e-91 285 50 1 323 3 obg GTPase Obg Petrotoga mobilis (strain DSM 10674 / SJ95)
A8ZRY1 1.28e-91 281 47 2 335 3 obg GTPase Obg Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q9WXV3 1.29e-91 285 49 2 339 3 obg GTPase Obg Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B9M3W3 1.63e-91 281 51 1 325 3 obg GTPase Obg Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B9KW04 2.04e-91 281 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B1X580 2.42e-91 281 47 2 335 3 obg Putative GTPase Obg Paulinella chromatophora
B4SBR3 2.72e-91 281 47 3 340 3 obg GTPase Obg Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q3IXX9 2.76e-91 281 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PQJ0 2.76e-91 281 52 3 321 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A5VD74 3.04e-91 281 50 3 333 3 obg GTPase Obg Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B5YEQ1 3.36e-91 284 49 7 347 3 obg GTPase Obg Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A7IH06 4.07e-91 281 49 4 323 3 obg GTPase Obg Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q97JL4 4.08e-91 283 47 1 332 3 obg GTPase Obg Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B0T310 7.8e-91 280 50 2 325 3 obg GTPase Obg Caulobacter sp. (strain K31)
Q92G19 9.59e-91 279 48 3 324 3 obg GTPase Obg Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3AM97 1.27e-90 279 51 1 305 3 obg GTPase Obg Synechococcus sp. (strain CC9605)
C0QLE9 1.53e-90 279 47 2 335 3 obg GTPase Obg Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A8F2Y3 1.96e-90 278 48 3 330 3 obg GTPase Obg Rickettsia massiliae (strain Mtu5)
A8GTZ9 2.36e-90 278 48 3 324 3 obg GTPase Obg Rickettsia rickettsii (strain Sheila Smith)
B0BVJ1 2.36e-90 278 48 3 324 3 obg GTPase Obg Rickettsia rickettsii (strain Iowa)
Q65GM7 2.61e-90 281 47 1 332 3 obg GTPase Obg Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7HJZ8 2.84e-90 281 47 5 359 3 obg GTPase Obg Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B8I179 4.01e-90 281 47 1 332 3 obg GTPase Obg Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A9AXD9 4.75e-90 281 49 4 333 3 obg GTPase Obg Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8Y6Z3 5.48e-90 281 46 1 332 3 obg GTPase Obg Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DHL1 5.48e-90 281 46 1 332 3 obg GTPase Obg Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZD3 5.48e-90 281 46 1 332 3 obg GTPase Obg Listeria monocytogenes serotype 4b (strain F2365)
A8F063 6.18e-90 277 47 3 332 3 obg GTPase Obg Rickettsia canadensis (strain McKiel)
B3EP74 6.34e-90 277 49 3 324 3 obg GTPase Obg Chlorobium phaeobacteroides (strain BS1)
Q03YT6 7.75e-90 280 47 2 337 3 obg GTPase Obg Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B1XN32 7.91e-90 278 47 4 353 3 obg GTPase Obg Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q92BH7 8.35e-90 280 46 1 332 3 obg GTPase Obg Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B9K736 1.01e-89 280 51 2 323 3 obg GTPase Obg Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A8LK09 1.06e-89 277 49 4 343 3 obg GTPase Obg Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2RKZ8 1.08e-89 280 51 2 332 3 obg GTPase Obg Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A0AIY6 1.34e-89 280 46 1 332 3 obg GTPase Obg Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B2TK70 1.48e-89 280 47 1 319 3 obg GTPase Obg Clostridium botulinum (strain Eklund 17B / Type B)
B0TBW1 1.63e-89 280 50 1 330 3 obg GTPase Obg Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
P20964 1.86e-89 279 48 1 326 1 obg GTPase Obg Bacillus subtilis (strain 168)
Q4UJV1 1.89e-89 276 48 3 324 3 obg GTPase Obg Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q6G0S8 2.2e-89 276 49 3 324 3 obg GTPase Obg Bartonella quintana (strain Toulouse)
B3WE52 2.28e-89 279 47 2 350 3 obg GTPase Obg Lacticaseibacillus casei (strain BL23)
B9DNE7 2.37e-89 279 47 1 333 3 obg GTPase Obg Staphylococcus carnosus (strain TM300)
Q039J3 2.38e-89 279 47 2 350 3 obg GTPase Obg Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A1AT81 2.4e-89 276 48 1 325 3 obg GTPase Obg Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q8YQT0 2.64e-89 276 49 3 344 3 obg GTPase Obg Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1H0I4 3.5e-89 278 46 4 343 3 obg GTPase Obg Endomicrobium trichonymphae
Q11CP6 3.55e-89 276 53 2 294 3 obg GTPase Obg Chelativorans sp. (strain BNC1)
B0JI21 4.03e-89 275 48 3 335 3 obg GTPase Obg Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A8GQ55 4.12e-89 275 48 3 324 3 obg GTPase Obg Rickettsia akari (strain Hartford)
B4U3Q7 4.31e-89 278 48 3 337 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MBS1 4.52e-89 278 48 3 337 3 obg GTPase Obg Streptococcus equi subsp. equi (strain 4047)
Q1WT46 4.55e-89 278 47 2 340 3 obg GTPase Obg Ligilactobacillus salivarius (strain UCC118)
Q4FP46 7.25e-89 274 51 3 295 3 obg GTPase Obg Pelagibacter ubique (strain HTCC1062)
Q03QP2 9.49e-89 277 44 2 356 3 obg GTPase Obg Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B7JVH9 1.12e-88 274 52 1 291 3 obg GTPase Obg Rippkaea orientalis (strain PCC 8801 / RF-1)
B3CQ33 1.45e-88 273 45 3 330 3 obg GTPase Obg Orientia tsutsugamushi (strain Ikeda)
A5CDM6 1.45e-88 273 45 3 330 3 obg GTPase Obg Orientia tsutsugamushi (strain Boryong)
B8EQH4 1.47e-88 274 50 3 331 3 obg GTPase Obg Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q8RBA5 1.78e-88 276 47 2 341 3 obg GTPase Obg Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q3MCS7 1.81e-88 274 48 3 344 3 obg GTPase Obg Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q2K2X6 1.96e-88 274 47 3 332 3 obg GTPase Obg Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B8E0B2 2.11e-88 276 49 7 342 3 obg GTPase Obg Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A8YV14 2.7e-88 276 46 0 325 3 obg GTPase Obg Lactobacillus helveticus (strain DPC 4571)
B5Y805 3.56e-88 276 48 3 333 3 obg GTPase Obg Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
B1N057 3.67e-88 276 48 2 337 3 obg GTPase Obg Leuconostoc citreum (strain KM20)
A8HS51 3.9e-88 273 46 5 343 3 obg GTPase Obg Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O67849 5.46e-88 273 47 1 323 3 obg GTPase Obg Aquifex aeolicus (strain VF5)
A9BDI4 7.67e-88 271 49 3 332 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9211)
B2GBD0 8.36e-88 275 45 2 362 3 obg GTPase Obg Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B8J4L3 9.07e-88 273 48 5 342 3 obg GTPase Obg Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8EPQ0 1.31e-87 274 46 1 332 3 obg GTPase Obg Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B3PRZ3 1.39e-87 272 46 3 344 3 obg GTPase Obg Rhizobium etli (strain CIAT 652)
A8AWM9 1.47e-87 275 46 1 335 3 obg GTPase Obg Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A3CM33 2.02e-87 274 46 1 335 3 obg GTPase Obg Streptococcus sanguinis (strain SK36)
C0MDB4 2.03e-87 274 47 3 337 3 obg GTPase Obg Streptococcus equi subsp. zooepidemicus (strain H70)
A1VF56 2.06e-87 272 47 4 343 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain DP4)
Q72DK0 2.06e-87 272 47 4 343 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1IVS5 2.3e-87 272 47 4 348 3 obg GTPase Obg Koribacter versatilis (strain Ellin345)
B5E958 2.47e-87 271 50 1 328 3 obg GTPase Obg Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q30XW0 2.5e-87 271 48 4 338 3 obg GTPase Obg Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B2KAW2 2.85e-87 275 46 3 333 3 obg GTPase Obg Elusimicrobium minutum (strain Pei191)
Q03JJ8 4.22e-87 273 46 1 335 3 obg GTPase Obg Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3C8 4.22e-87 273 46 1 335 3 obg GTPase Obg Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYR4 4.22e-87 273 46 1 335 3 obg GTPase Obg Streptococcus thermophilus (strain CNRZ 1066)
A5I666 4.56e-87 273 46 1 332 3 obg GTPase Obg Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXU6 4.56e-87 273 46 1 332 3 obg GTPase Obg Clostridium botulinum (strain ATCC 19397 / Type A)
B1ILY5 4.66e-87 273 46 1 332 3 obg GTPase Obg Clostridium botulinum (strain Okra / Type B1)
C1A1L5 4.72e-87 275 43 6 348 3 obg GTPase Obg Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A2BP15 5.11e-87 270 50 1 302 3 obg GTPase Obg Prochlorococcus marinus (strain AS9601)
A7GHK2 5.48e-87 273 46 1 332 3 obg GTPase Obg Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B8DRN9 5.92e-87 271 49 7 346 3 obg GTPase Obg Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B8FUR9 5.97e-87 273 52 1 324 3 obg GTPase Obg Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q8P0I6 8.15e-87 273 47 2 334 3 obg GTPase Obg Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XBM1 8.51e-87 273 47 2 334 3 obg GTPase Obg Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q99Z94 8.79e-87 273 47 2 334 3 obg GTPase Obg Streptococcus pyogenes serotype M1
P0DB53 9.78e-87 273 46 3 337 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB52 9.78e-87 273 46 3 337 3 obg GTPase Obg Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B2G6R9 1.02e-86 272 47 2 334 3 obg GTPase Obg Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ99 1.02e-86 272 47 2 334 3 obg GTPase Obg Limosilactobacillus reuteri (strain DSM 20016)
Q1JLA1 1.13e-86 272 47 2 334 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBB7 1.13e-86 272 47 2 334 3 obg GTPase Obg Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5HFB9 1.17e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q7A0Q3 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 1.24e-86 272 45 1 333 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 1.24e-86 272 45 1 333 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09830
Feature type CDS
Gene obgE
Product GTPase ObgE
Location 68862 - 70040 (strand: 1)
Length 1179 (nucleotides) / 392 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1393
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01018 GTP1/OBG
PF01926 50S ribosome-binding GTPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0536 Cell cycle control, cell division, chromosome partitioning (D)
Replication, recombination and repair (L)		 DL GTPase involved in cell partioning and DNA repair

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03979 GTPase [EC:3.6.5.-] - -

Protein Sequence

MKFVDEAKILVVAGDGGNGCVSFRREKYIPRGGPDGGDGGDGGDVYLEADENLNTLIDYRFENSFRAERGQNGQSRDCTGRHSSDIFIHVPVGTRIRDTATNEVLGDMLLHGQRLMVAKGGYHGLGNARFKSSVNRAPRQRTMGTPGEARELMMELMLLADVGMLGMPNAGKSTFIRSVSAAKPKVADYPFTTLVPSLGVVRMDNLQSFVVADIPGLIEGASDGAGLGIRFLKHLERCRVLLHLIDIFPVDESDPVENAKIIVGELEKYSEKLAEKPRWLVFNKIDLVDPEEAKARAQAIADALGWEDKFYMISAVNHEGVKALCWDLMEFLNTHAREAAEAAVVVDDAKVDFMWDDYHKEQLEQADDLTDDLDDDDWDEDDEEGIEFIYQK

Flanking regions ( +/- flanking 50bp)

GGGCATACGGACCCGATAGTCCGGACACGGCAACGTTACGGAGAAAAATAATGAAATTTGTAGATGAAGCGAAGATCCTGGTCGTGGCAGGAGATGGCGGTAATGGTTGCGTCAGCTTCCGCCGCGAAAAATATATTCCGCGAGGCGGGCCTGATGGCGGAGATGGCGGTGATGGTGGTGATGTTTACCTCGAAGCCGATGAAAATCTCAATACCCTGATTGATTACCGTTTCGAAAATTCGTTCCGCGCAGAACGGGGACAAAACGGACAAAGCCGTGACTGTACCGGCAGGCACAGCAGTGATATCTTTATTCATGTGCCTGTAGGTACCCGTATCCGCGACACGGCGACCAATGAGGTATTGGGCGACATGTTGCTGCACGGACAGCGCCTGATGGTTGCTAAAGGCGGATATCACGGTCTGGGCAATGCCCGCTTTAAATCCTCCGTCAACCGGGCACCACGTCAGCGTACCATGGGAACGCCGGGTGAAGCCCGCGAACTGATGATGGAACTGATGTTGCTGGCTGATGTGGGCATGCTGGGTATGCCGAATGCCGGTAAATCCACGTTTATCCGCTCTGTCTCTGCGGCGAAGCCAAAAGTAGCGGATTATCCGTTTACTACCCTGGTACCAAGCCTGGGTGTGGTACGGATGGATAACTTACAGAGTTTTGTGGTTGCTGATATTCCCGGGCTGATTGAAGGCGCATCCGACGGCGCAGGCCTCGGTATCCGCTTCCTGAAGCATCTGGAGCGCTGCCGCGTCCTTCTGCACCTCATTGATATTTTCCCGGTTGATGAAAGTGATCCGGTTGAAAATGCGAAAATCATTGTGGGTGAGCTGGAGAAATACAGCGAAAAACTGGCTGAAAAGCCACGTTGGTTAGTCTTCAACAAAATTGATCTTGTTGATCCGGAAGAAGCTAAAGCGCGCGCTCAGGCGATCGCCGATGCGCTGGGCTGGGAAGATAAGTTCTATATGATCTCTGCGGTGAATCACGAGGGCGTGAAAGCACTGTGCTGGGATCTGATGGAATTCCTGAATACGCATGCGCGTGAAGCTGCTGAAGCCGCCGTTGTTGTTGATGATGCAAAAGTCGATTTCATGTGGGATGATTACCACAAGGAACAGCTTGAGCAGGCAGACGATCTGACTGATGACCTGGACGATGATGACTGGGATGAAGATGATGAAGAAGGTATCGAATTCATCTACCAGAAATAATGTCCTGAGTAATAAGAAGCCCGGTGCTGATGCCCCGGGTTTTTTTATGC