Homologs in group_1390

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08590 FBDBKF_08590 84.5 Morganella morganii S1 ispB octaprenyl diphosphate synthase
EHELCC_12935 EHELCC_12935 84.5 Morganella morganii S2 ispB octaprenyl diphosphate synthase
NLDBIP_13275 NLDBIP_13275 84.5 Morganella morganii S4 ispB octaprenyl diphosphate synthase
LHKJJB_13280 LHKJJB_13280 84.5 Morganella morganii S3 ispB octaprenyl diphosphate synthase
HKOGLL_11750 HKOGLL_11750 84.5 Morganella morganii S5 ispB octaprenyl diphosphate synthase
F4V73_RS09815 F4V73_RS09815 83.0 Morganella psychrotolerans ispB octaprenyl diphosphate synthase

Distribution of the homologs in the orthogroup group_1390

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1390

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AD58 0.0 526 76 0 321 3 ispB Octaprenyl diphosphate synthase Shigella flexneri
P0AD57 0.0 526 76 0 321 1 ispB Octaprenyl diphosphate synthase Escherichia coli (strain K12)
P44916 1.82e-151 431 63 0 321 1 ispB Octaprenyl diphosphate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O24743 2.98e-93 283 45 3 319 1 sdsA All-trans-nonaprenyl-diphosphate synthase (geranyl-diphosphate specific) Rhodobacter capsulatus
Q8S948 3.19e-55 187 32 2 317 1 SPS1 Solanesyl diphosphate synthase 1, chloroplastic Arabidopsis thaliana
Q76FS5 7.5e-55 187 31 3 327 1 SPS2 Solanesyl diphosphate synthase 2, chloroplastic Arabidopsis thaliana
Q0INZ4 1.12e-53 184 32 4 328 3 SPS3 Probable solanesyl-diphosphate synthase 3, chloroplastic Oryza sativa subsp. japonica
Q75HZ9 5.84e-53 182 31 3 327 1 SPS2 Solanesyl-diphosphate synthase 2, chloroplastic Oryza sativa subsp. japonica
P72580 4.69e-51 174 35 3 287 3 preA Prenyl transferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q53479 4.27e-49 169 34 3 289 1 idsA Short chain isoprenyl diphosphate synthase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q9TLS1 7.75e-48 166 34 2 281 3 preA Prenyl transferase Cyanidium caldarium
P31171 8.62e-48 166 35 2 287 3 preA Prenyl transferase Cyanophora paradoxa
Q7S565 4.26e-47 167 39 3 260 3 NCU02305 Probable hexaprenyl pyrophosphate synthase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O43091 2e-46 164 31 5 347 1 dps1 Decaprenyl-diphosphate synthase subunit 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P31114 2.58e-46 163 30 2 298 1 hepT Heptaprenyl diphosphate synthase component 2 Bacillus subtilis (strain 168)
A0A0A7GEY4 4.68e-46 161 32 5 292 1 GACE_1337 Geranylgeranyl pyrophosphate synthase Geoglobus acetivorans
Q653T6 1.09e-45 163 32 3 293 1 SPS1 Solanesyl-diphosphate synthase 1, mitochondrial Oryza sativa subsp. japonica
O26156 1.3e-45 160 33 3 289 3 idsA Short chain isoprenyl diphosphate synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P39464 4.97e-45 159 30 5 317 1 gds Geranylgeranyl diphosphate synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P55785 6.41e-45 158 29 1 315 3 hepT Heptaprenyl diphosphate synthase component 2 Geobacillus stearothermophilus
P51268 1.85e-44 157 31 5 291 3 preA Prenyl transferase Porphyra purpurea
Q1XDL8 3.76e-44 156 30 2 289 3 preA Prenyl transferase Neopyropia yezoensis
Q54VJ9 1.08e-43 158 32 3 292 3 coq1 Decaprenyl-diphosphate synthase Dictyostelium discoideum
P95999 3.24e-41 149 28 5 316 3 gds Geranylgeranyl diphosphate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O66129 6.91e-41 148 30 4 299 1 hexs-b Hexaprenyl-diphosphate synthase large subunit ((2E,6E)-farnesyl-diphosphate specific) Micrococcus luteus
Q5T2R2 8.85e-41 150 30 5 323 1 PDSS1 All trans-polyprenyl-diphosphate synthase PDSS1 Homo sapiens
Q5HZ00 2.36e-40 149 32 7 311 1 SPS3 Solanesyl diphosphate synthase 3, chloroplastic/mitochondrial Arabidopsis thaliana
Q33DR2 3.85e-40 148 30 4 323 1 Pdss1 All trans-polyprenyl-diphosphate synthase PDSS1 Mus musculus
Q58270 4.25e-40 146 30 5 271 3 idsA Short chain isoprenyl diphosphate synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8PW34 2.7e-39 144 32 4 293 3 MM_1767 Geranylgeranyl diphosphate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q6CBH3 2.83e-38 144 34 3 263 3 COQ1 Probable hexaprenyl pyrophosphate synthase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
P18900 3.33e-36 139 32 5 303 1 COQ1 Hexaprenyl pyrophosphate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q3IPL1 1.76e-35 134 30 6 327 1 idsA3 Geranylfarnesyl diphosphate synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q08291 1.37e-32 125 35 4 215 1 None Farnesyl diphosphate synthase Geobacillus stearothermophilus
B1XJV9 5.4e-31 121 31 3 232 1 crtE Geranylgeranyl pyrophosphate synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q9UWR6 1.32e-30 120 31 4 296 1 fgs Geranylfarnesyl diphosphate synthase Aeropyrum pernix
P9WKH1 8.04e-30 119 28 5 300 1 Rv3398c (2E,6E)-farnesyl diphosphate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKH0 8.04e-30 119 28 5 300 3 MT3506 (2E,6E)-farnesyl diphosphate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5H9 8.04e-30 119 28 5 300 3 BQ2027_MB3431C (2E,6E)-farnesyl diphosphate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8PYS1 4.91e-29 116 34 2 179 1 MM_0789 Geranylfarnesyl diphosphate synthase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q94ID7 5.51e-29 117 32 5 238 1 GGPS Geranylgeranyl pyrophosphate synthase, chloroplastic Hevea brasiliensis
Q9ZU77 1.25e-28 116 31 7 268 2 At2g18620 Geranylgeranyl pyrophosphate synthase 7, chloroplastic Arabidopsis thaliana
Q9LRR0 6.23e-28 114 32 5 240 5 At3g14510 Putative geranylgeranyl pyrophosphate synthase 8, chloroplastic Arabidopsis thaliana
Q42698 8.26e-28 114 29 4 257 3 GGPS1 Geranylgeranyl pyrophosphate synthase, chloroplastic Catharanthus roseus
O06428 9.87e-28 113 29 5 290 1 grcC1 Nonaprenyl diphosphate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O50410 5.54e-27 111 28 4 261 1 idsB Geranylgeranyl diphosphate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P34802 1.19e-26 111 28 5 244 1 GGPPS1 Heterodimeric geranylgeranyl pyrophosphate synthase large subunit 1, chloroplastic Arabidopsis thaliana
P80042 1.38e-26 110 27 4 260 1 GGPS1 Geranylgeranyl pyrophosphate synthase, chloroplastic Capsicum annuum
Q9SLG2 3.58e-26 110 29 5 246 1 GGPP4 Geranylgeranyl pyrophosphate synthase 4 Arabidopsis thaliana
P48368 7.57e-26 107 30 3 235 3 crtE Geranylgeranyl diphosphate synthase Cyanophora paradoxa
O04046 3.45e-25 107 28 5 240 1 GGPPS2 Heterodimeric geranylgeranyl pyrophosphate synthase large subunit 2 Arabidopsis thaliana
Q43133 3.18e-24 104 29 6 263 1 GGPS1 Geranylgeranyl pyrophosphate synthase, chloroplastic/chromoplastic Sinapis alba
A0A0U3BRC5 1.05e-23 102 31 5 233 1 GFDPS Geranylfarnesyl diphosphate synthase, chloroplastic Leucosceptrum canum
P54383 1.33e-23 101 31 4 219 3 ispA Farnesyl diphosphate synthase Bacillus subtilis (strain 168)
Q9LJY2 1.36e-23 102 31 7 251 1 At3g20160 Geranylgeranyl pyrophosphate synthase 10, mitochondrial Arabidopsis thaliana
Q9LUD9 1.58e-23 102 32 5 238 1 GGPP3 Geranylgeranyl pyrophosphate synthase 3, chloroplastic Arabidopsis thaliana
O66126 2.98e-23 100 30 5 230 3 fps Farnesyl diphosphate synthase Micrococcus luteus
O05572 4.27e-23 100 27 5 279 1 grcC2 Dimethylallyltranstransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WEQ2 8.34e-23 100 26 5 282 3 olcC Geranylgeranyl pyrophosphate synthase olcC Penicillium canescens
Q9LUE1 8.36e-23 100 31 5 244 1 GGPPS9 Geranylgeranyl pyrophosphate synthase 9, chloroplastic Arabidopsis thaliana
Q9LIA0 9.63e-23 100 31 6 262 2 At3g29430 Geranylgeranyl pyrophosphate synthase 11, chloroplastic Arabidopsis thaliana
P9WEW8 1.07e-22 99 27 4 262 1 dpmpD Geranylgeranyl pyrophosphate synthase dpmpD Macrophomina phaseolina (strain MS6)
Q9LHR4 1.09e-22 100 32 4 238 2 At3g32040 Geranylgeranyl pyrophosphate synthase 12, chloroplastic Arabidopsis thaliana
O22043 5.11e-22 97 31 6 245 1 GGPP6 Geranylgeranyl pyrophosphate synthase 6, mitochondrial Arabidopsis thaliana
K2SUY0 6.65e-22 99 28 5 238 1 MPH_02178 Macrophomene synthase Macrophomina phaseolina (strain MS6)
V5TF61 1.17e-21 97 30 7 244 1 ambP2 Dimethylallyltranstransferase Fischerella ambigua (strain UTEX 1903)
O66952 1.18e-21 95 30 5 215 3 ispA Farnesyl diphosphate synthase Aquifex aeolicus (strain VF5)
A0A140JWS2 3.04e-21 95 26 5 271 3 ptmG Geranylgeranyl pyrophosphate synthase penG Penicillium simplicissimum
A0A0E3D8P4 4.28e-21 95 26 5 271 3 penG Geranylgeranyl pyrophosphate synthase penG Penicillium crustosum
Q92236 4.86e-21 96 27 4 251 3 GGS Geranylgeranyl pyrophosphate synthase Gibberella fujikuroi
Q6F5E6 7.2e-21 94 24 5 261 1 GGS Geranylgeranyl pyrophosphate synthase Neocamarosporium betae
P9WEX3 3.73e-20 92 26 8 313 1 dpasD Geranylgeranyl pyrophosphate synthase dpasD Apiospora sacchari
P22873 5.68e-20 91 31 10 235 1 crtE Geranylgeranyl diphosphate synthase Pseudescherichia vulneris
P17060 1.29e-19 90 33 9 214 3 crtE Geranylgeranyl diphosphate synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
A0A0E3D8M9 3.86e-19 90 26 6 261 3 janG Geranylgeranyl pyrophosphate synthase janG Penicillium janthinellum
Q54BK1 9.09e-19 88 27 10 286 3 ggps1 Geranylgeranyl pyrophosphate synthase Dictyostelium discoideum
Q9P885 1.54e-18 87 24 5 271 1 carG Geranylgeranyl pyrophosphate synthase Mucor circinelloides f. lusitanicus
F9WZD2 2.02e-18 87 25 6 274 3 GGS1 Geranylgeranyl pyrophosphate synthase 1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
P22939 2.2e-18 87 28 8 276 1 ispA Farnesyl diphosphate synthase Escherichia coli (strain K12)
P24322 3.18e-18 88 26 7 271 2 al-3 Geranylgeranyl pyrophosphate synthase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A348FUE1 4.51e-18 88 27 5 270 1 PvCPS Copalyl diphosphate synthase Talaromyces verruculosus
P21684 8.43e-18 85 30 7 207 3 crtE Geranylgeranyl diphosphate synthase Pantoea ananas
A0A858E7G0 8.79e-18 86 27 8 294 1 GGDPS Geranylgeranyl pyrophosphate synthase Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7)
I1RL14 9.01e-18 86 25 4 274 1 dpfgD Geranylgeranyl pyrophosphate synthase dpfgD Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1B4XBK0 2.09e-17 86 28 8 270 3 sdnC Geranylgeranyl diphosphate synthase sdnC Sordaria araneosa
A0A1Y1C7Q5 2.62e-17 86 25 7 263 3 EvQS Quiannulatene synthase Emericella variicolor
B2DBE9 3.41e-17 85 25 7 261 1 GGS-D Geranylgeranyl pyrophosphate synthase D Phomopsis amygdali
A0A858E6N7 3.84e-17 84 26 8 294 1 GGDPS Geranylgeranyl pyrophosphate synthase Melampsora lini
F9WWF1 9.89e-17 82 26 8 232 3 GGS2 Geranylgeranyl pyrophosphate synthase 2 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q6F596 1.17e-16 82 26 7 271 2 Ggps1 Geranylgeranyl pyrophosphate synthase Rattus norvegicus
P56966 1.28e-16 82 26 7 271 1 GGPS1 Geranylgeranyl pyrophosphate synthase Bos taurus
O95749 1.75e-16 81 26 7 278 1 GGPS1 Geranylgeranyl pyrophosphate synthase Homo sapiens
Q9WTN0 8.74e-16 79 25 7 276 1 Ggps1 Geranylgeranyl pyrophosphate synthase Mus musculus
Q12051 9.1e-16 80 24 4 227 1 BTS1 Geranylgeranyl pyrophosphate synthase BTS1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P54976 9.38e-16 79 29 7 209 3 crtE Geranylgeranyl diphosphate synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A0A3S5XFG0 1.07e-15 80 27 10 305 1 cle6 Geranylgeranyl pyrophosphate synthase cle6 Aspergillus versicolor
P9WER5 1.46e-15 80 26 8 273 1 None Talaropentaene synthase Talaromyces verruculosus
P45204 1.49e-15 79 28 4 236 3 ispA Farnesyl diphosphate synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q672V6 2.58e-15 79 24 5 257 2 atmG Geranylgeranyl pyrophosphate synthase atmG Aspergillus flavus
J7FIX8 3.39e-15 78 24 5 255 3 idtG Geranylgeranyl pyrophosphate synthase idtG Claviceps paspali
P9WEX9 4.2e-15 78 23 4 258 1 dpmaD Geranylgeranyl pyrophosphate synthase dpmaD Metarhizium anisopliae
Q56RZ7 4.22e-15 78 24 6 277 2 ltmG Geranylgeranyl pyrophosphate synthase ltmG Epichloe festucae var. lolii
Q56RZ3 4.22e-15 78 24 6 277 2 ltmG Geranylgeranyl pyrophosphate synthase ltmG Epichloe festucae (strain Fl1)
A0A7D0AGU9 4.52e-15 77 23 5 281 2 TPS Terpene synthase Matsumurasca onukii
H1VQB1 5.52e-15 77 23 5 267 1 dpchD Geranylgeranyl pyrophosphate synthase dpchD Colletotrichum higginsianum (strain IMI 349063)
C9K2Q3 8.02e-15 78 29 2 215 1 bsc8 Fusicoccadiene synthase Alternaria brassicicola
F9XLC1 8.19e-15 77 26 7 276 3 GGS3 Geranylgeranyl pyrophosphate synthase 3 Zymoseptoria tritici (strain CBS 115943 / IPO323)
A0A1U8QLG8 8.24e-15 77 24 4 269 2 AN1592 Geranylgeranyl pyrophosphate synthase AN1592 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9C446 8.24e-15 77 25 4 254 3 paxG Geranylgeranyl pyrophosphate synthase paxG Penicillium paxilli
Q758K0 8.26e-15 77 25 8 287 3 BTS1 Geranylgeranyl pyrophosphate synthase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
O53507 1.15e-14 77 26 12 332 1 idsA2 (2E,6E)-farnesyl diphosphate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
N4V6D4 1.17e-14 78 25 5 247 1 btcA Sesterterpene synthase btcA Colletotrichum orbiculare (strain 104-T / ATCC 96160 / CBS 514.97 / LARS 414 / MAFF 240422)
A0A2Z6AQX6 1.32e-14 78 26 6 222 1 PvPS Preasperterpenoid A synthase PvPS Talaromyces verruculosus
P9WEP0 1.42e-14 77 24 5 260 1 AuAS Aspergildiene synthase Aspergillus ustus
A0A2I6PJ05 1.45e-14 77 25 7 265 3 ggs1 Geranylgeranyl pyrophosphate synthase Hypoxylon pulicicidum
P55539 1.81e-14 76 31 6 213 3 NGR_a02750 Probable farnesyl diphosphate synthase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q45220 2.78e-14 75 29 6 238 3 fppS Probable farnesyl diphosphate synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
E9F5E9 5.2e-14 75 22 5 265 1 subD Geranylgeranyl pyrophosphate synthase subD Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0P0ZD79 5.21e-14 76 25 6 239 1 EvVS Variediene synthase Emericella variicolor
A0A0P0ZEM1 6.12e-14 75 26 5 223 1 Stl-SS Stellatatriene synthase Emericella variicolor
A0A1V1FVQ6 8.13e-14 75 26 6 234 1 oblA Ophiobolin F synthase oblA Emericella variicolor
A0A1L9WQI2 8.65e-14 75 26 8 271 1 vrcA Bifunctional sesterterpene synthase Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A2Z6FZ31 1.9e-13 74 25 6 199 1 btcA Sesterterpene synthase btcA Neocamarosporium betae
A0A8D5M3Y5 2.26e-13 73 27 5 208 1 esdpD Geranylgeranyl pyrophosphate synthase esdpD Penicillium shearii
A0A1L9UKS1 2.55e-13 73 25 4 224 1 AbVS Variediene synthase Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A2PZA5 2.56e-13 73 25 4 223 1 PaFS Fusicoccadiene synthase Phomopsis amygdali
S0E627 2.64e-13 73 25 5 257 2 GGS2 Geranylgeranyl pyrophosphate synthase 2 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A8K1AY78 6.1e-13 73 26 9 235 1 tndC Bifunctional type I diterpene synthase tndC Aspergillus flavipes
A0A2Z6AQX7 6.11e-13 73 25 6 226 1 PbSS Sesterbrasiliatriene synthase PbSS Penicillium brasilianum
P9WEV7 6.49e-13 72 29 7 235 1 CgDS Dolasta-1(15),8-diene synthase Colletotrichum gloeosporioides
A0A3Q9FFM1 1.15e-12 72 29 10 232 1 astC Bifunctional sesterterpene synthase astC Talaromyces wortmannii
P9WER6 1.39e-12 72 26 7 214 1 None Fusoxypene synthase Fusarium oxysporum
M2V8C1 1.83e-12 71 25 7 279 1 oblA Ophiobolin F synthase oblA Cochliobolus heterostrophus (strain C5 / ATCC 48332 / race O)
A0A8H4CUY8 2.17e-12 71 24 7 264 1 GCG54_00000376 Colleterpenol synthase Colletotrichum gloeosporioides
Q39108 2.26e-12 70 25 7 192 1 GGR Heterodimeric geranylgeranyl pyrophosphate synthase small subunit, chloroplastic Arabidopsis thaliana
A0A0U5G0B1 2.67e-12 70 24 6 233 1 AcldOS Ophiobolin F synthase Aspergillus calidoustus
P57537 7.2e-12 68 23 8 261 3 ispA Farnesyl diphosphate synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A0A1V0QSA8 1.73e-11 67 22 7 250 2 eriE Geranylgeranyl pyrophosphate synthase AN1592 Hericium erinaceus
P9WEV6 1.75e-11 68 27 4 256 1 PaPS Phomopsene synthase Phomopsis amygdali
A0A1L7VFX3 3.8e-11 67 25 6 235 1 FUP1 Bifunctional terpene synthase FUP1 Fusarium proliferatum (strain ET1)
A0A2L0VXR5 4.56e-11 66 24 4 269 2 GGPS Geranylgeranyl pyrophosphate synthase Clitopilus passeckerianus
W6QAE7 1.44e-10 65 25 8 267 1 PrDS Conidiogenone synthase Penicillium roqueforti (strain FM164)
A0A858E7J4 1.58e-10 64 26 7 184 1 ILTPS1 IDS-like terpene synthase 1 Melampsora lini
B6HFX8 1.89e-10 65 25 6 220 1 PchDS Conidiogenone synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B2DBE8 1.9e-10 64 24 3 215 1 GGS-A Geranylgeranyl pyrophosphate synthase A Phomopsis amygdali
A0A169T193 3.22e-10 64 23 4 259 1 EvAS Astellifadiene synthase Emericella variicolor
Q97W92 5.84e-10 62 26 6 220 1 gdS-2 Hexaprenyl pyrophosphate synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A0A6S6QJ62 6.67e-10 63 24 4 269 1 ple4 Geranylgeranyl pyrophosphate synthase Rhodocybe pseudopiperita
M2U578 1.05e-09 63 23 3 213 1 tpcA Preterpestacin I synthase tpcA Cochliobolus heterostrophus (strain C5 / ATCC 48332 / race O)
A0A858E4Y6 1.2e-09 62 25 5 179 1 ILTPS2 IDS-like terpene synthase 2 Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7)
Q8K9A0 1.92e-09 61 25 9 247 3 ispA Farnesyl diphosphate synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A1C8C3 2e-09 62 23 6 250 1 oblA Ophiobolin F synthase oblA Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A858E4Y8 2.68e-08 58 27 8 190 1 ILTPS1 IDS-like terpene synthase 1 Melampsora larici-populina (strain 98AG31 / pathotype 3-4-7)
P9WEV2 2.91e-08 58 22 2 181 1 sttA Preaspterpenacid I synthase sttA Aspergillus terreus
A0A858E899 2.99e-08 57 25 10 247 1 ILTPS3 IDS-like terpene synthase 3 Melampsora lini
A0A858EAD5 8.63e-08 56 26 10 242 1 ILTPS2 IDS-like terpene synthase 2 Melampsora lini
D7PHZ5 9.21e-08 56 27 6 206 1 vrtD Farnesyl pyrophosphate synthase vrtD Penicillium aethiopicum
A0A348DU52 1.62e-07 56 24 11 293 1 PcCS Cyclopiane-type diterpene synthase Penicillium chrysogenum
Q33DR3 3.26e-07 55 26 9 253 1 Pdss2 All trans-polyprenyl-diphosphate synthase PDSS2 Mus musculus
A1DN30 3.58e-07 55 21 3 210 1 NfSS Sesterfisherol synthase Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q5U2R1 5.4e-07 54 25 9 255 2 Pdss2 All trans-polyprenyl-diphosphate synthase PDSS2 Rattus norvegicus
Q0CRW6 5.71e-07 54 23 4 186 1 sttA Preaspterpenacid I synthase sttA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2I6PJ13 2.77e-06 52 23 8 260 3 nodC Prenyl transferase nodC Hypoxylon pulicicidum
Q86YH6 1.48e-05 50 23 8 253 1 PDSS2 All trans-polyprenyl-diphosphate synthase PDSS2 Homo sapiens
A0A386JV86 4.55e-05 48 24 6 200 1 TPS IDS-type sesquiterpene synthase Nezara viridula
Q8WMY2 5.85e-05 47 22 6 235 1 FDPS Farnesyl pyrophosphate synthase Bos taurus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16945
Feature type CDS
Gene ispB
Product octaprenyl diphosphate synthase
Location 3730695 - 3731666 (strand: -1)
Length 972 (nucleotides) / 323 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1390
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00348 Polyprenyl synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0142 Coenzyme transport and metabolism (H) H Geranylgeranyl pyrophosphate synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02523 octaprenyl-diphosphate synthase [EC:2.5.1.90] Terpenoid backbone biosynthesis
Biosynthesis of secondary metabolites		 -

Protein Sequence

MNLESIIKLTSADMAAVNDAILYQLNSDVSLINQLGYYIISGGGKRIRPMIAVLTGRALDYQGDKHISVAALIEFIHTATLLHDDVVDESDMRRGKQTANAVFGNAASVLVGDFIYTRSFQMMTDLDSMRVLKLMSSATNVIAEGEVLQLMNCNDPDITEDDYMQVIYSKTARLFEAASHASAILCGATPEQEKAFQDYGRYLGTAFQLIDDLLDYDADNTQLGKNTGDDLDEGKPTLPLLHAMHHGNETESQLIRQAIEKGNGRHLLDTVLKTMKQCGSLEYTRQKAEEEADKAIEALAIIPDSSYKDALIGLAHVAVQRQS

Flanking regions ( +/- flanking 50bp)

CATTTTTTATTAATTATAACGCGCTCATTGGCGAGCCAAAGTCGAAAAACATGAATTTAGAATCTATTATAAAACTCACATCCGCTGATATGGCTGCGGTAAATGACGCAATTCTTTACCAGCTTAATTCAGATGTTTCTTTGATAAACCAGCTTGGTTACTACATCATTAGCGGTGGTGGTAAAAGGATCCGCCCAATGATCGCTGTTCTGACCGGCCGAGCTTTGGATTATCAAGGGGACAAACATATCTCTGTCGCCGCTTTAATTGAATTTATTCATACCGCAACATTATTGCACGACGATGTTGTTGATGAATCCGATATGCGTAGAGGCAAACAAACAGCTAATGCTGTGTTTGGTAATGCTGCAAGCGTGCTGGTAGGTGACTTTATTTATACACGATCTTTTCAGATGATGACGGATCTTGATTCCATGCGCGTGCTAAAGCTGATGTCTAGCGCAACCAATGTGATCGCTGAAGGTGAAGTATTACAATTAATGAATTGTAACGATCCTGACATTACTGAAGATGACTATATGCAAGTTATCTACAGTAAAACCGCCCGTTTATTTGAAGCTGCCTCTCATGCGTCAGCCATCCTCTGCGGAGCCACTCCAGAGCAAGAGAAAGCTTTCCAAGATTATGGTCGTTATCTTGGTACCGCATTCCAGCTGATTGACGATTTACTGGATTATGATGCAGATAATACCCAATTAGGTAAAAATACCGGTGACGATCTGGATGAAGGTAAACCTACTTTGCCTTTACTTCATGCCATGCACCATGGTAACGAAACAGAATCACAACTCATTCGTCAAGCCATTGAAAAAGGTAACGGCCGTCATTTACTCGACACTGTGTTAAAAACGATGAAACAGTGTGGCTCACTGGAATATACCCGCCAAAAAGCGGAAGAAGAAGCCGATAAAGCCATTGAGGCGTTAGCGATTATTCCTGATTCATCTTACAAAGATGCATTAATTGGCCTTGCGCACGTTGCTGTGCAACGACAATCGTAATTTTCATACCTAAACCCCATAAAGTATGAGAAGCCCGTCAGAGCGACTAT