Homologs in group_1357

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08410 FBDBKF_08410 77.3 Morganella morganii S1 asd archaetidylserine decarboxylase
EHELCC_13115 EHELCC_13115 77.3 Morganella morganii S2 asd archaetidylserine decarboxylase
NLDBIP_13455 NLDBIP_13455 77.3 Morganella morganii S4 asd archaetidylserine decarboxylase
LHKJJB_13100 LHKJJB_13100 77.3 Morganella morganii S3 asd archaetidylserine decarboxylase
HKOGLL_11930 HKOGLL_11930 77.3 Morganella morganii S5 asd archaetidylserine decarboxylase
F4V73_RS09620 F4V73_RS09620 75.6 Morganella psychrotolerans asd archaetidylserine decarboxylase

Distribution of the homologs in the orthogroup group_1357

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1357

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYS6 1.07e-166 467 77 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JIQ6 3.55e-156 441 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JMP9 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FC4 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRP9 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis (strain Pestoides F)
Q1CEE6 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYP0 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIX1 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis
B2K1Z5 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0Z1 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMY9 8.62e-156 439 71 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9EV04 3.45e-148 421 65 1 300 3 psd Phosphatidylserine decarboxylase proenzyme Dickeya dadantii (strain 3937)
B5Y342 8.01e-144 410 66 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Klebsiella pneumoniae (strain 342)
Q8ZKB1 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TSE2 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella schwarzengrund (strain CVM19633)
B5BKH1 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi A (strain AKU_12601)
A9N419 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLG9 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T2Q7 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella newport (strain SL254)
B4TF96 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella heidelberg (strain SL476)
B5R9A9 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R023 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella enteritidis PT4 (strain P125109)
B5FRL8 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella dublin (strain CT_02021853)
Q57GM9 4.89e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella choleraesuis (strain SC-B67)
C0Q6C0 5.28e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi C (strain RKS4594)
A7MMA5 7.46e-143 408 67 0 282 3 psd Phosphatidylserine decarboxylase proenzyme Cronobacter sakazakii (strain ATCC BAA-894)
Q8Z194 7.66e-143 408 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella typhi
B7LLU4 1.04e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NTL9 1.04e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P0A8K4 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella flexneri
Q0SXB9 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella flexneri serotype 5b (strain 8401)
Q31T93 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella boydii serotype 4 (strain Sb227)
B2TY38 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LQI3 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain SMS-3-5 / SECEC)
B6I267 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain SE11)
B7NG97 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8K1 1.16e-142 407 66 0 283 1 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12)
B1IT43 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8K2 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9N1 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1XDR4 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12 / DH10B)
C5A1F4 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12 / MC4100 / BW2952)
B7M8S3 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O8 (strain IAI1)
B7MSX5 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O81 (strain ED1a)
B5Z2G9 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8K3 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O157:H7
A7ZV31 1.16e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O139:H28 (strain E24377A / ETEC)
Q328E0 1.37e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella dysenteriae serotype 1 (strain Sd197)
B7UPY0 1.61e-142 407 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5F377 2.19e-142 407 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella agona (strain SL483)
A6TH77 3.38e-142 406 67 0 280 3 psd Phosphatidylserine decarboxylase proenzyme Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8A7Q7 6.61e-142 405 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O9:H4 (strain HS)
B7LC21 6.61e-142 405 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain 55989 / EAEC)
A8AMN8 1.33e-141 405 65 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1R397 1.5e-141 404 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain UTI89 / UPEC)
B7MKW7 1.5e-141 404 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O45:K1 (strain S88 / ExPEC)
A9MFQ0 2.25e-141 404 64 0 288 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q3YUI0 2.3e-141 404 67 0 276 3 psd Phosphatidylserine decarboxylase proenzyme Shigella sonnei (strain Ss046)
B2VCV2 7.68e-141 402 64 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6D035 1.43e-139 400 66 0 285 3 psd Phosphatidylserine decarboxylase proenzyme Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NW88 3.7e-139 397 65 0 289 3 psd Phosphatidylserine decarboxylase proenzyme Sodalis glossinidius (strain morsitans)
C4K3T9 2.33e-133 382 64 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q87KZ9 3.69e-128 369 61 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MZ50 5.87e-127 366 60 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio campbellii (strain ATCC BAA-1116)
Q7MGZ5 2.25e-126 365 60 1 279 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio vulnificus (strain YJ016)
Q8DCV8 2.25e-126 365 60 1 279 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio vulnificus (strain CMCP6)
Q65RD9 3.51e-126 364 60 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3N255 1.47e-123 358 58 1 284 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F658 2.21e-123 357 58 2 285 3 psd Phosphatidylserine decarboxylase proenzyme Glaesserella parasuis serovar 5 (strain SH0165)
B0BR01 3.23e-123 357 58 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2F9 3.23e-123 357 58 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q9CJU2 5.16e-123 357 60 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Pasteurella multocida (strain Pm70)
C3LR71 8.2e-123 355 59 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain M66-2)
Q9KV19 8.2e-123 355 59 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3N7 8.2e-123 355 59 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P43789 2.43e-120 350 57 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5E2C0 2.79e-120 349 59 1 285 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EMR5 3.22e-120 349 59 2 285 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio salmonicida (strain LFI1238)
Q7VNA7 3.65e-120 349 57 1 284 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q4QP27 1.31e-119 348 57 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus influenzae (strain 86-028NP)
B5FBS2 4.38e-119 346 59 1 285 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio fischeri (strain MJ11)
Q0I4T3 6.93e-119 346 57 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Histophilus somni (strain 129Pt)
B0UWL4 1.05e-118 345 57 1 281 3 psd Phosphatidylserine decarboxylase proenzyme Histophilus somni (strain 2336)
Q6LM21 3.72e-117 342 60 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Photobacterium profundum (strain SS9)
Q5QVW0 1.28e-115 338 57 1 284 3 psd Phosphatidylserine decarboxylase proenzyme Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q47C25 1.85e-111 327 55 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Dechloromonas aromatica (strain RCB)
Q3IFN3 4.02e-109 321 54 1 285 3 psd Phosphatidylserine decarboxylase proenzyme Pseudoalteromonas translucida (strain TAC 125)
C5CU16 2.85e-108 318 53 3 286 3 psd Phosphatidylserine decarboxylase proenzyme Variovorax paradoxus (strain S110)
Q07XV9 6.5e-108 318 55 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella frigidimarina (strain NCIMB 400)
A1KBF9 6.72e-108 318 53 2 288 3 psd Phosphatidylserine decarboxylase proenzyme Azoarcus sp. (strain BH72)
A8FRC6 5.11e-107 315 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sediminis (strain HAW-EB3)
A1VUQ1 5.65e-107 315 52 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Polaromonas naphthalenivorans (strain CJ2)
A2SJL1 3.88e-106 313 53 3 281 3 psd Phosphatidylserine decarboxylase proenzyme Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A9C3H8 1.42e-105 312 54 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Delftia acidovorans (strain DSM 14801 / SPH-1)
Q121P6 3.12e-105 311 52 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Polaromonas sp. (strain JS666 / ATCC BAA-500)
A8H8H5 5.01e-105 310 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0KSQ8 7.13e-105 310 52 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain ANA-3)
A3QAD1 7.91e-105 310 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q0HR33 8.13e-105 310 52 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain MR-7)
B1KHV8 1.16e-104 310 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella woodyi (strain ATCC 51908 / MS32)
Q15Q53 1.66e-104 309 53 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q0HMP8 4.04e-104 308 51 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain MR-4)
A1SZV9 5.34e-104 308 53 1 286 3 psd Phosphatidylserine decarboxylase proenzyme Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A4YAL8 3.31e-103 306 52 2 288 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q221E5 3.48e-103 306 52 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q1LSP9 4.17e-103 306 56 0 264 3 psd Phosphatidylserine decarboxylase proenzyme Baumannia cicadellinicola subsp. Homalodisca coagulata
B0TU73 6.15e-103 305 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella halifaxensis (strain HAW-EB4)
B9MAC0 1.57e-102 304 53 3 281 3 psd Phosphatidylserine decarboxylase proenzyme Acidovorax ebreus (strain TPSY)
A1RFQ8 1.76e-102 304 52 2 288 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain W3-18-1)
Q7P0H6 1.76e-102 304 54 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B4S0J5 2.05e-102 305 51 2 288 3 psd Phosphatidylserine decarboxylase proenzyme Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4G529 2.14e-102 304 53 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Herminiimonas arsenicoxydans
A9L3W8 5.3e-102 303 51 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS195)
A6WSW1 5.3e-102 303 51 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS185)
A3D015 6.59e-102 303 51 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8ECB2 6.59e-102 303 51 2 293 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS223)
Q1GZE8 1.51e-101 301 57 2 259 3 psd Phosphatidylserine decarboxylase proenzyme Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B7V346 4.68e-101 300 55 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain LESB58)
Q02F61 5.28e-101 300 55 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain UCBPP-PA14)
A1SA30 1.42e-100 299 53 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q9HUK8 1.85e-100 299 55 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q12J86 5.45e-100 298 53 2 286 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6VD70 6.28e-100 298 54 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain PA7)
Q47VZ2 2.28e-99 296 50 2 285 3 psd Phosphatidylserine decarboxylase proenzyme Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4XPX3 4.22e-99 295 53 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas mendocina (strain ymp)
Q493W4 1.07e-98 295 49 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Blochmanniella pennsylvanica (strain BPEN)
A1U4D6 2.03e-98 294 50 3 286 3 psd Phosphatidylserine decarboxylase proenzyme Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q7VQP8 3.37e-98 293 46 1 292 3 psd Phosphatidylserine decarboxylase proenzyme Blochmanniella floridana
Q8D2C6 4.07e-97 290 49 0 280 3 psd Phosphatidylserine decarboxylase proenzyme Wigglesworthia glossinidia brevipalpis
Q2YB83 4.21e-97 290 53 4 285 3 psd Phosphatidylserine decarboxylase proenzyme Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q4KJ87 2.16e-96 288 53 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B0KL10 3.72e-96 288 52 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain GB-1)
B1JAE9 3.89e-96 288 53 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain W619)
Q1I433 5.76e-96 288 53 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas entomophila (strain L48)
Q21H90 1.55e-95 286 51 3 285 3 psd Phosphatidylserine decarboxylase proenzyme Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4VR22 2.33e-95 286 52 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Stutzerimonas stutzeri (strain A1501)
A5W9U4 8.31e-95 285 51 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1WIF0 3.74e-94 283 48 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Verminephrobacter eiseniae (strain EF01-2)
Q88DB9 3.82e-94 283 51 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0VMD7 1.91e-92 279 50 3 288 3 psd Phosphatidylserine decarboxylase proenzyme Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C3KDM6 2.27e-92 278 51 2 278 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain SBW25)
Q2SBA8 2.68e-92 278 48 3 297 3 psd Phosphatidylserine decarboxylase proenzyme Hahella chejuensis (strain KCTC 2396)
C1DLP2 2.92e-92 278 52 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3KJ03 3.19e-92 278 51 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain Pf0-1)
A9IM91 2.84e-91 276 51 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7VYM4 8.17e-91 275 52 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W6I5 8.17e-91 275 52 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WIF7 1.29e-90 274 52 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1QUI2 1.62e-90 273 50 4 283 3 psd Phosphatidylserine decarboxylase proenzyme Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q83AQ4 1.95e-89 271 47 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAS0 1.95e-89 271 47 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J316 1.95e-89 271 47 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain CbuG_Q212)
B6J9C5 1.95e-89 271 47 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain CbuK_Q154)
A9KEZ8 5.78e-89 270 47 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain Dugway 5J108-111)
Q0AAC1 9.85e-89 269 49 3 275 3 psd Phosphatidylserine decarboxylase proenzyme Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2L0K8 1.09e-86 264 48 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella avium (strain 197N)
Q3J754 8.75e-86 262 47 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q608T0 7.97e-85 259 47 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5WSH5 1.55e-81 251 47 5 287 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Lens)
A5IIH5 1.69e-81 251 47 5 287 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Corby)
Q5ZRA9 2.52e-81 250 47 5 287 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6F6W3 2.87e-81 250 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5X0Q0 3e-81 250 46 5 287 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Paris)
B2I1N9 7.74e-80 246 46 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain ACICU)
B0VP52 9.31e-80 246 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain SDF)
B0V9W1 2.2e-79 245 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AYE)
B7I242 2.2e-79 245 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AB0057)
B7GUX2 2.2e-79 245 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AB307-0294)
A3MA23 3.18e-79 245 45 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0TZM7 1.77e-77 240 43 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1Q8K8 2.14e-76 237 46 4 278 3 psd Phosphatidylserine decarboxylase proenzyme Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8P7Q6 3.43e-76 237 46 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWE4 3.43e-76 237 46 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain 8004)
B0RR72 6.17e-76 236 46 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain B100)
Q31H64 6.65e-76 237 42 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3BRK2 3.02e-75 234 45 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A4IZN0 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHR3 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BN99 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain OSU18)
Q2A4Y0 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain LVS)
A7NAF0 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14J65 5.83e-75 234 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain FSC 198)
Q8PJ17 9.74e-75 233 44 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas axonopodis pv. citri (strain 306)
A0Q562 1.13e-74 233 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. novicida (strain U112)
B2SFB2 1.3e-74 233 43 4 282 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5GXQ3 6.93e-74 231 45 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0T0 7.47e-74 231 45 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4FQD5 1.72e-73 230 44 4 278 3 psd Phosphatidylserine decarboxylase proenzyme Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q87DS7 2.19e-72 228 45 4 277 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9I2 2.19e-72 228 45 4 277 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain M23)
B4SQW4 4.78e-72 226 43 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Stenotrophomonas maltophilia (strain R551-3)
B2FP04 9.56e-72 226 43 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Stenotrophomonas maltophilia (strain K279a)
B0U6J7 1.78e-70 223 43 2 276 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain M12)
Q9PDL4 1.42e-69 220 43 2 276 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain 9a5c)
Q1D614 1.92e-56 186 38 5 286 3 psd Phosphatidylserine decarboxylase proenzyme Myxococcus xanthus (strain DK1622)
A1WV88 4.53e-55 183 39 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Halorhodospira halophila (strain DSM 244 / SL1)
C0Z4E2 3.62e-53 178 37 5 283 3 psd Phosphatidylserine decarboxylase proenzyme Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B8JBF7 2.42e-49 168 38 7 288 3 psd Phosphatidylserine decarboxylase proenzyme Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UEL4 1.33e-48 166 37 7 288 3 psd Phosphatidylserine decarboxylase proenzyme Anaeromyxobacter sp. (strain K)
B8I6U9 2.78e-39 142 32 9 291 3 psd Phosphatidylserine decarboxylase proenzyme Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A5HXS0 4.33e-38 139 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQ59 4.33e-38 139 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain ATCC 19397 / Type A)
B1L1M1 6.28e-38 139 30 8 285 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Loch Maree / Type A3)
C1FPI8 7.12e-38 139 30 8 285 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Kyoto / Type A2)
A0Q3R9 8.62e-38 138 31 9 287 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium novyi (strain NT)
C3KXS2 8.71e-38 138 30 8 285 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain 657 / Type Ba4)
A8MJ83 1.17e-36 135 33 6 263 3 psd Phosphatidylserine decarboxylase proenzyme Alkaliphilus oremlandii (strain OhILAs)
A7G9C7 1.54e-36 135 29 8 285 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q899T7 2.31e-36 135 31 7 266 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium tetani (strain Massachusetts / E88)
Q46192 3.19e-36 134 30 8 288 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium pasteurianum
B2THF2 5.95e-36 134 30 8 276 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Eklund 17B / Type B)
Q8XPD5 7.63e-36 133 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain 13 / Type A)
A5N497 8.24e-36 133 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DXW5 8.24e-36 133 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium kluyveri (strain NBRC 12016)
Q0TV39 2.84e-35 132 30 8 285 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8RGF2 4.11e-35 131 32 8 276 3 psd Phosphatidylserine decarboxylase proenzyme Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q0SWT6 1.45e-34 130 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain SM101 / Type A)
A6LPC8 1.45e-33 127 30 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
P0CD79 2.29e-32 124 31 8 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKZ5 2.29e-32 124 31 8 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B8S5 2.29e-32 124 31 8 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B0BAF4 2.54e-32 124 31 8 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
Q5JN42 4.07e-32 128 31 8 243 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Oryza sativa subsp. japonica
B2UX63 6.5e-32 123 30 8 278 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Alaska E43 / Type E3)
D3ZAW2 2.17e-31 124 33 9 272 1 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Rattus norvegicus
A4GNA8 2.34e-31 126 32 8 243 1 PSD3 Phosphatidylserine decarboxylase proenzyme 3 Arabidopsis thaliana
Q5R8I8 2.58e-31 124 31 7 271 2 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Pongo abelii
Q9Z767 2.72e-31 121 33 9 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia pneumoniae
Q9UG56 5.23e-31 123 31 7 271 1 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Homo sapiens
Q97N08 5.77e-31 120 29 8 284 3 psd1 Phosphatidylserine decarboxylase proenzyme 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8BSF4 7.38e-31 122 33 9 272 2 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Mus musculus
Q58DH2 1.63e-30 122 33 9 272 2 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Bos taurus
P27465 1.91e-30 121 33 10 272 1 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Cricetulus griseus
B8FQ96 4.05e-30 118 29 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q24UV7 7.32e-30 117 29 8 284 3 psd Phosphatidylserine decarboxylase proenzyme Desulfitobacterium hafniense (strain Y51)
O14111 1.16e-29 122 32 9 276 3 psd3 Phosphatidylserine decarboxylase proenzyme 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10949 2.21e-29 118 31 6 259 3 psd-1 Phosphatidylserine decarboxylase proenzyme, mitochondrial Caenorhabditis elegans
Q5L4W1 2.37e-29 116 32 9 291 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia abortus (strain DSM 27085 / S26/3)
F4KAK5 3.62e-29 120 33 9 235 2 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Arabidopsis thaliana
B7GKA2 5.7e-29 114 29 5 268 3 psd Phosphatidylserine decarboxylase proenzyme Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q9PLM7 1.9e-28 114 30 8 282 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia muridarum (strain MoPn / Nigg)
Q256C9 4.19e-28 113 31 9 275 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia felis (strain Fe/C-56)
Q821L3 5.89e-28 112 31 8 276 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
P53037 7.69e-28 117 30 9 251 1 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9KDA3 3.85e-27 109 29 7 268 3 psd Phosphatidylserine decarboxylase proenzyme Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A7GT32 7.74e-27 108 27 5 265 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q634K5 1.27e-26 108 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ZK / E33L)
C5D4W6 1.29e-26 108 26 5 278 3 psd Phosphatidylserine decarboxylase proenzyme Geobacillus sp. (strain WCH70)
B6JNM7 1.89e-26 108 31 10 272 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain P12)
Q9ZJN0 2.26e-26 107 31 10 270 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain J99 / ATCC 700824)
C1ESN2 3.91e-26 107 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain 03BB102)
A0RIV4 3.91e-26 107 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus thuringiensis (strain Al Hakam)
Q81LP7 4.81e-26 107 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis
C3L5U2 4.81e-26 107 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P929 4.81e-26 107 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis (strain A0248)
B7HPN7 5.06e-26 106 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain AH187)
B7JNX0 5.06e-26 106 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain AH820)
B7IYJ1 6.83e-26 106 26 5 282 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain G9842)
Q818C6 8.95e-26 106 26 5 282 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCW5 8.95e-26 106 26 5 282 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain B4264)
Q6HDI5 1.88e-25 105 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q9PP76 1.92e-25 105 29 8 245 3 psd Phosphatidylserine decarboxylase proenzyme Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O25911 1.94e-25 105 30 10 270 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain ATCC 700392 / 26695)
Q730J7 2.11e-25 105 27 5 261 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1CRQ1 3.8e-25 104 30 10 272 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain HPAG1)
Q10T43 4.8e-25 107 28 7 329 2 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Oryza sativa subsp. japonica
Q84V22 5.41e-25 107 29 7 276 2 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Arabidopsis thaliana
Q5AK66 5.5e-25 108 30 7 256 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
A9VHW5 7.6e-25 103 26 6 292 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus mycoides (strain KBAB4)
B2UVC1 6e-24 101 30 10 270 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain Shi470)
C4R360 8.05e-24 105 30 9 274 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Komagataella phaffii (strain GS115 / ATCC 20864)
Q97KW7 2.23e-23 100 28 11 284 3 psd2 Phosphatidylserine decarboxylase proenzyme 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5KWX3 9.24e-23 98 26 4 266 3 psd Phosphatidylserine decarboxylase proenzyme Geobacillus kaustophilus (strain HTA426)
P39822 3.33e-22 96 26 4 252 1 psd Phosphatidylserine decarboxylase proenzyme Bacillus subtilis (strain 168)
P39006 3.37e-20 94 40 4 162 1 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39006 1.37e-09 62 30 1 89 1 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q1PCQ8 1.54e-18 88 25 7 290 1 PSD1mt Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Toxoplasma gondii (strain ATCC 50853 / GT1)
O14333 6.09e-17 84 24 11 365 3 psd1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UTB5 1.02e-15 80 34 4 160 3 psd2 Phosphatidylserine decarboxylase proenzyme 2, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UTB5 1.49e-07 56 33 1 84 3 psd2 Phosphatidylserine decarboxylase proenzyme 2, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B3L2V1 3.67e-15 78 24 5 237 1 PKH_072580 Phosphatidylserine decarboxylase proenzyme Plasmodium knowlesi (strain H)
Q9GPP8 3.46e-14 75 24 10 290 1 None Phosphatidylserine decarboxylase proenzyme Plasmodium falciparum
C4QX80 1.2e-13 74 25 10 339 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Komagataella phaffii (strain GS115 / ATCC 20864)
Q5ABC5 6.22e-13 72 23 5 259 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A286LEZ8 4.15e-12 69 24 12 292 1 psiD L-tryptophan decarboxylase Psilocybe cyanescens
F6N7K6 1.85e-11 68 26 12 273 1 PSD1pv Phosphatidylserine decarboxylase 2 proenzyme Toxoplasma gondii (strain ATCC 50853 / GT1)
A0A0C2SRU0 1.75e-10 64 22 8 283 2 iboD Decarboxylase iboD Amanita muscaria (strain Koide BX008)
P0DPA6 6.49e-10 63 30 7 159 1 psiD L-tryptophan decarboxylase Psilocybe cubensis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16685
Feature type CDS
Gene asd
Product archaetidylserine decarboxylase
Location 3681524 - 3682435 (strand: -1)
Length 912 (nucleotides) / 303 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1357
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02666 Phosphatidylserine decarboxylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0688 Lipid transport and metabolism (I) I Phosphatidylserine decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MDKLKIKLQYLLPKLWLTQLAGWFANKKAGSVTQFAIKMFARAYKVDMNEAKESQFQAYATFNEFFIRALKDGARPIVEGDNQLALPADGAVSQLGQIQDDQILQAKGHSYTLEALLAGNFTLADQFRHGQFITTYLSPRDYHRVHMPCDGLLKEMIYVPGDLFSVNPLTAANVPNLFARNERIICLFDTQFGPMIQILVGATIVGSIETVWCGMVTPPREGIIKRWTYPQADKVGAIFLKKGEEMGRFKLGSTVINLFPENSVQLNKDLMNGSVTLMGELLGSIINATGTDHKACDNNTINE

Flanking regions ( +/- flanking 50bp)

ATAGACCCCTTTTGTCGATTTTTTATCGTTCGATCCCAGAGGTTGCCATTTTGGACAAGCTAAAAATTAAACTACAGTATCTATTGCCTAAATTATGGCTAACACAGCTAGCTGGTTGGTTTGCCAATAAAAAAGCAGGTAGCGTTACTCAATTTGCTATCAAAATGTTTGCTCGCGCATATAAAGTTGATATGAATGAAGCGAAAGAGAGCCAATTTCAGGCTTATGCAACATTTAATGAGTTTTTTATTCGTGCATTAAAAGATGGCGCTCGCCCTATTGTTGAAGGAGATAACCAACTGGCTCTCCCCGCAGATGGCGCTGTCAGCCAGCTTGGTCAGATCCAAGACGATCAAATTTTACAAGCCAAAGGGCACTCTTACACCCTTGAAGCGTTGCTAGCAGGTAATTTTACCTTGGCCGACCAGTTCCGCCATGGGCAATTTATTACAACCTATCTTTCACCACGGGATTACCACCGTGTTCATATGCCTTGCGATGGGTTATTAAAAGAGATGATTTATGTCCCCGGCGATCTCTTTTCTGTTAATCCTTTAACTGCGGCAAATGTTCCTAACTTATTTGCTCGTAATGAACGTATTATTTGCCTTTTTGACACCCAATTTGGTCCCATGATACAAATTCTTGTTGGAGCGACCATTGTAGGGAGTATTGAAACGGTCTGGTGTGGCATGGTAACACCACCACGTGAAGGTATTATTAAACGTTGGACTTATCCTCAAGCGGATAAAGTTGGCGCTATATTTCTGAAAAAAGGTGAAGAGATGGGACGCTTTAAATTAGGCTCGACCGTTATTAACCTCTTCCCTGAAAATAGTGTTCAATTAAATAAAGATCTGATGAACGGCTCTGTAACATTAATGGGAGAACTACTAGGCTCTATCATTAATGCCACAGGCACTGATCATAAGGCCTGCGATAATAATACCATTAATGAATAATTCGTAATTCGGAGTAAACCTTGTGCGCCTGATAATCAGTCTACTTTTTA