Homologs in group_1413

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08410 FBDBKF_08410 89.7 Morganella morganii S1 asd archaetidylserine decarboxylase
EHELCC_13115 EHELCC_13115 89.7 Morganella morganii S2 asd archaetidylserine decarboxylase
NLDBIP_13455 NLDBIP_13455 89.7 Morganella morganii S4 asd archaetidylserine decarboxylase
LHKJJB_13100 LHKJJB_13100 89.7 Morganella morganii S3 asd archaetidylserine decarboxylase
HKOGLL_11930 HKOGLL_11930 89.7 Morganella morganii S5 asd archaetidylserine decarboxylase
PMI_RS16685 PMI_RS16685 75.6 Proteus mirabilis HI4320 asd archaetidylserine decarboxylase

Distribution of the homologs in the orthogroup group_1413

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1413

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYS6 2.23e-162 456 73 0 292 3 psd Phosphatidylserine decarboxylase proenzyme Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JMP9 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FC4 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRP9 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis (strain Pestoides F)
Q1CEE6 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYP0 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIX1 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis
B2K1Z5 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C0Z1 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMY9 1.1e-152 432 71 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JIQ6 5.16e-150 425 70 0 286 3 psd Phosphatidylserine decarboxylase proenzyme Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5Y342 1.15e-144 412 66 1 302 3 psd Phosphatidylserine decarboxylase proenzyme Klebsiella pneumoniae (strain 342)
A7MMA5 9.3e-142 405 69 0 280 3 psd Phosphatidylserine decarboxylase proenzyme Cronobacter sakazakii (strain ATCC BAA-894)
Q9EV04 6.05e-140 400 66 2 300 3 psd Phosphatidylserine decarboxylase proenzyme Dickeya dadantii (strain 3937)
A6TH77 7.72e-140 400 68 0 280 3 psd Phosphatidylserine decarboxylase proenzyme Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7LLU4 1.26e-138 397 64 1 295 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NTL9 2.23e-138 397 62 3 312 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LC21 2.46e-138 397 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain 55989 / EAEC)
A9MFQ0 2.68e-138 397 65 0 288 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AMN8 2.8e-138 397 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P0A8K4 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella flexneri
Q0SXB9 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella flexneri serotype 5b (strain 8401)
Q328E0 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella dysenteriae serotype 1 (strain Sd197)
Q31T93 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella boydii serotype 4 (strain Sb227)
B2TY38 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LQI3 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain SMS-3-5 / SECEC)
B6I267 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain SE11)
B7NG97 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8K1 2.99e-138 396 66 0 283 1 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12)
B1IT43 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8K2 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T9N1 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1XDR4 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12 / DH10B)
C5A1F4 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain K12 / MC4100 / BW2952)
B7M8S3 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O8 (strain IAI1)
B7MSX5 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O81 (strain ED1a)
B5Z2G9 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A8K3 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O157:H7
A7ZV31 2.99e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R397 4.73e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli (strain UTI89 / UPEC)
B7MKW7 4.73e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPY0 4.95e-138 396 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C0Q6C0 5e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi C (strain RKS4594)
Q8Z194 5.28e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella typhi
Q8ZKB1 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TSE2 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella schwarzengrund (strain CVM19633)
B5BKH1 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi A (strain AKU_12601)
A9N419 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLG9 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T2Q7 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella newport (strain SL254)
B4TF96 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella heidelberg (strain SL476)
B5R9A9 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R023 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella enteritidis PT4 (strain P125109)
B5FRL8 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella dublin (strain CT_02021853)
Q57GM9 5.34e-138 396 66 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella choleraesuis (strain SC-B67)
B5F377 1.61e-137 395 65 0 284 3 psd Phosphatidylserine decarboxylase proenzyme Salmonella agona (strain SL483)
A8A7Q7 1.8e-137 394 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Escherichia coli O9:H4 (strain HS)
Q3YUI0 9.79e-137 392 66 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Shigella sonnei (strain Ss046)
Q2NW88 4.18e-134 385 64 0 287 3 psd Phosphatidylserine decarboxylase proenzyme Sodalis glossinidius (strain morsitans)
Q6D035 6.5e-133 384 61 3 316 3 psd Phosphatidylserine decarboxylase proenzyme Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VCV2 7.65e-133 382 62 1 298 3 psd Phosphatidylserine decarboxylase proenzyme Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C4K3T9 1.48e-129 373 63 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q87KZ9 1.21e-125 363 59 1 285 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MGZ5 2.69e-123 357 59 1 279 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio vulnificus (strain YJ016)
Q8DCV8 2.69e-123 357 59 1 279 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio vulnificus (strain CMCP6)
B6EMR5 2.82e-123 357 59 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio salmonicida (strain LFI1238)
C3LR71 1.02e-122 355 59 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain M66-2)
Q9KV19 1.02e-122 355 59 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3N7 1.02e-122 355 59 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MZ50 2.06e-122 355 59 1 279 3 psd Phosphatidylserine decarboxylase proenzyme Vibrio campbellii (strain ATCC BAA-1116)
B5FBS2 1.21e-121 353 59 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio fischeri (strain MJ11)
Q5E2C0 4.8e-121 352 59 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65RD9 8.3e-121 351 59 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6LM21 7.89e-118 343 58 1 291 3 psd Phosphatidylserine decarboxylase proenzyme Photobacterium profundum (strain SS9)
B0BR01 2.79e-117 342 57 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2F9 2.79e-117 342 57 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q0I4T3 2.87e-117 342 58 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Histophilus somni (strain 129Pt)
P43789 3.05e-117 342 58 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A3N255 3.26e-117 342 57 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9CJU2 8.49e-117 341 59 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Pasteurella multocida (strain Pm70)
Q4QP27 1.16e-116 340 58 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus influenzae (strain 86-028NP)
Q5QVW0 1.96e-116 340 55 1 289 3 psd Phosphatidylserine decarboxylase proenzyme Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B0UWL4 7.05e-116 338 58 1 282 3 psd Phosphatidylserine decarboxylase proenzyme Histophilus somni (strain 2336)
B8F658 5.58e-115 337 58 2 277 3 psd Phosphatidylserine decarboxylase proenzyme Glaesserella parasuis serovar 5 (strain SH0165)
Q7VNA7 1.07e-111 328 55 1 283 3 psd Phosphatidylserine decarboxylase proenzyme Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A9C3H8 6.86e-111 325 57 3 288 3 psd Phosphatidylserine decarboxylase proenzyme Delftia acidovorans (strain DSM 14801 / SPH-1)
A1VUQ1 1.5e-109 322 54 3 290 3 psd Phosphatidylserine decarboxylase proenzyme Polaromonas naphthalenivorans (strain CJ2)
Q3IFN3 6.13e-108 318 58 1 256 3 psd Phosphatidylserine decarboxylase proenzyme Pseudoalteromonas translucida (strain TAC 125)
Q47C25 2.18e-107 317 55 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Dechloromonas aromatica (strain RCB)
Q07XV9 4.18e-107 316 54 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella frigidimarina (strain NCIMB 400)
Q121P6 1.38e-106 315 56 2 275 3 psd Phosphatidylserine decarboxylase proenzyme Polaromonas sp. (strain JS666 / ATCC BAA-500)
B4S0J5 2.65e-106 315 51 3 298 3 psd Phosphatidylserine decarboxylase proenzyme Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A2SJL1 4.07e-106 313 53 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q15Q53 4.22e-105 311 53 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q221E5 2.69e-104 309 54 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A3QAD1 7.12e-104 308 53 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1KBF9 7.45e-104 308 54 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Azoarcus sp. (strain BH72)
B9MAC0 1.02e-103 307 53 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Acidovorax ebreus (strain TPSY)
C5CU16 3.9e-103 306 54 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Variovorax paradoxus (strain S110)
A1SZV9 8.47e-103 305 50 1 287 3 psd Phosphatidylserine decarboxylase proenzyme Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q47VZ2 1.06e-102 305 51 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4G529 1.73e-102 305 53 2 287 3 psd Phosphatidylserine decarboxylase proenzyme Herminiimonas arsenicoxydans
A8H8H5 2.03e-102 304 51 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3D015 2.86e-102 304 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8ECB2 2.86e-102 304 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS223)
Q1LSP9 2.95e-102 304 59 0 249 3 psd Phosphatidylserine decarboxylase proenzyme Baumannia cicadellinicola subsp. Homalodisca coagulata
A9L3W8 3.36e-102 304 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS195)
A6WSW1 3.36e-102 304 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella baltica (strain OS185)
Q1GZE8 3.44e-102 303 58 2 255 3 psd Phosphatidylserine decarboxylase proenzyme Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A8FRC6 3.82e-102 303 52 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sediminis (strain HAW-EB3)
A0KSQ8 7.45e-102 303 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain ANA-3)
Q0HR33 7.62e-102 303 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain MR-7)
A1SA30 9.55e-102 302 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KHV8 1.11e-101 302 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella woodyi (strain ATCC 51908 / MS32)
B0TU73 1.61e-101 302 52 3 287 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella halifaxensis (strain HAW-EB4)
Q2YB83 1.94e-101 302 56 5 287 3 psd Phosphatidylserine decarboxylase proenzyme Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0HMP8 3.66e-101 301 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain MR-4)
Q12J86 4.65e-101 301 54 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A4YAL8 8.94e-101 300 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RFQ8 1.11e-100 300 51 2 284 3 psd Phosphatidylserine decarboxylase proenzyme Shewanella sp. (strain W3-18-1)
Q7P0H6 1.27e-100 299 55 3 277 3 psd Phosphatidylserine decarboxylase proenzyme Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7VQP8 1.81e-97 292 47 2 292 3 psd Phosphatidylserine decarboxylase proenzyme Blochmanniella floridana
Q493W4 4.32e-97 291 48 1 287 3 psd Phosphatidylserine decarboxylase proenzyme Blochmanniella pennsylvanica (strain BPEN)
Q02F61 9.65e-97 290 53 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V346 1.01e-96 290 53 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain LESB58)
B1JAE9 1.74e-96 289 52 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain W619)
Q9HUK8 3.85e-96 288 52 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C1DLP2 4.06e-96 288 53 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A6VD70 5.4e-96 288 52 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas aeruginosa (strain PA7)
A4XPX3 1.47e-95 287 52 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas mendocina (strain ymp)
Q4KJ87 3.35e-94 283 53 2 273 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B0KL10 1.48e-93 281 51 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain GB-1)
Q1I433 1.49e-93 281 51 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas entomophila (strain L48)
A1WIF0 1.76e-93 281 49 4 289 3 psd Phosphatidylserine decarboxylase proenzyme Verminephrobacter eiseniae (strain EF01-2)
A5W9U4 3.76e-93 281 50 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1QUI2 7.15e-93 280 49 4 284 3 psd Phosphatidylserine decarboxylase proenzyme Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A1U4D6 9.81e-93 280 50 3 281 3 psd Phosphatidylserine decarboxylase proenzyme Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3J754 1.47e-92 280 48 1 280 3 psd Phosphatidylserine decarboxylase proenzyme Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q88DB9 1.62e-92 279 50 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0VMD7 4.87e-92 278 51 3 284 3 psd Phosphatidylserine decarboxylase proenzyme Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q21H90 6.53e-92 277 49 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8D2C6 1.59e-90 274 45 0 283 3 psd Phosphatidylserine decarboxylase proenzyme Wigglesworthia glossinidia brevipalpis
A9IM91 5.55e-90 273 50 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q3KJ03 5.61e-90 273 50 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain Pf0-1)
Q2L0K8 5.66e-90 273 50 4 283 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella avium (strain 197N)
A4VR22 9.13e-90 272 49 2 279 3 psd Phosphatidylserine decarboxylase proenzyme Stutzerimonas stutzeri (strain A1501)
C3KDM6 1.1e-89 272 49 2 282 3 psd Phosphatidylserine decarboxylase proenzyme Pseudomonas fluorescens (strain SBW25)
Q7VYM4 4.01e-89 271 50 4 284 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W6I5 4.01e-89 271 50 4 284 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WIF7 6.4e-89 270 50 4 284 3 psd Phosphatidylserine decarboxylase proenzyme Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0AAC1 1.29e-88 269 50 3 278 3 psd Phosphatidylserine decarboxylase proenzyme Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q2SBA8 6.24e-87 265 47 2 280 3 psd Phosphatidylserine decarboxylase proenzyme Hahella chejuensis (strain KCTC 2396)
Q608T0 1.44e-85 261 48 1 272 3 psd Phosphatidylserine decarboxylase proenzyme Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6F6W3 1.64e-81 251 46 3 277 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q83AQ4 2.25e-81 250 47 2 261 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAS0 2.25e-81 250 47 2 261 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J316 2.25e-81 250 47 2 261 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain CbuG_Q212)
B6J9C5 2.25e-81 250 47 2 261 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain CbuK_Q154)
A9KEZ8 4.6e-81 249 47 2 261 3 psd Phosphatidylserine decarboxylase proenzyme Coxiella burnetii (strain Dugway 5J108-111)
Q31H64 5.95e-80 247 42 2 299 3 psd Phosphatidylserine decarboxylase proenzyme Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q87DS7 6.82e-80 247 44 2 290 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9I2 6.82e-80 247 44 2 290 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain M23)
B2I1N9 1.59e-78 243 45 3 283 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain ACICU)
B0V9W1 2.82e-78 243 46 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AYE)
B7I242 2.82e-78 243 46 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AB0057)
B7GUX2 2.82e-78 243 46 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain AB307-0294)
B0U6J7 3.36e-78 243 44 2 290 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain M12)
A3MA23 4.55e-78 242 46 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VP52 7.67e-78 241 46 3 280 3 psd Phosphatidylserine decarboxylase proenzyme Acinetobacter baumannii (strain SDF)
Q5ZRA9 1.39e-77 241 47 6 285 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WSH5 1.66e-77 241 47 5 283 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Lens)
A5IIH5 2.59e-77 240 47 6 285 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Corby)
Q5X0Q0 3.78e-77 239 47 5 283 3 psd Phosphatidylserine decarboxylase proenzyme Legionella pneumophila (strain Paris)
Q9PDL4 5.58e-77 239 44 2 290 3 psd Phosphatidylserine decarboxylase proenzyme Xylella fastidiosa (strain 9a5c)
B0RR72 1.01e-76 239 45 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain B100)
Q8P7Q6 1.46e-76 238 45 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UWE4 1.46e-76 238 45 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas campestris pv. campestris (strain 8004)
Q5GXQ3 5.59e-76 237 46 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P0T0 7.02e-76 236 46 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4FQD5 9.06e-76 236 43 3 277 3 psd Phosphatidylserine decarboxylase proenzyme Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3BRK2 1.66e-75 235 46 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PJ17 2.5e-75 235 45 2 283 3 psd Phosphatidylserine decarboxylase proenzyme Xanthomonas axonopodis pv. citri (strain 306)
A4IZN0 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHR3 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BN99 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain OSU18)
Q2A4Y0 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain LVS)
A7NAF0 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14J65 6.41e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q562 6.77e-75 234 44 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. novicida (strain U112)
Q1Q8K8 1.08e-74 233 42 3 278 3 psd Phosphatidylserine decarboxylase proenzyme Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B2SFB2 1.96e-74 233 43 2 265 3 psd Phosphatidylserine decarboxylase proenzyme Francisella tularensis subsp. mediasiatica (strain FSC147)
B0TZM7 1.58e-73 230 42 2 272 3 psd Phosphatidylserine decarboxylase proenzyme Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B4SQW4 1.65e-67 215 41 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Stenotrophomonas maltophilia (strain R551-3)
B2FP04 3.02e-67 214 41 2 281 3 psd Phosphatidylserine decarboxylase proenzyme Stenotrophomonas maltophilia (strain K279a)
C0Z4E2 3.87e-55 183 37 5 279 3 psd Phosphatidylserine decarboxylase proenzyme Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q1D614 1.7e-53 179 38 5 281 3 psd Phosphatidylserine decarboxylase proenzyme Myxococcus xanthus (strain DK1622)
A1WV88 1.88e-51 174 38 3 288 3 psd Phosphatidylserine decarboxylase proenzyme Halorhodospira halophila (strain DSM 244 / SL1)
B8JBF7 1.89e-47 163 36 6 284 3 psd Phosphatidylserine decarboxylase proenzyme Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UEL4 3.16e-47 163 36 6 281 3 psd Phosphatidylserine decarboxylase proenzyme Anaeromyxobacter sp. (strain K)
Q8XPD5 5.8e-36 134 31 9 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain 13 / Type A)
Q0TV39 1.48e-35 133 30 9 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SWT6 2.58e-35 132 31 9 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium perfringens (strain SM101 / Type A)
B8I6U9 4.73e-34 129 33 7 265 3 psd Phosphatidylserine decarboxylase proenzyme Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A8MJ83 4.97e-33 126 31 5 253 3 psd Phosphatidylserine decarboxylase proenzyme Alkaliphilus oremlandii (strain OhILAs)
C3KXS2 7.02e-33 125 30 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain 657 / Type Ba4)
Q9PLM7 7.2e-33 126 32 9 287 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia muridarum (strain MoPn / Nigg)
A0Q3R9 1.26e-32 125 29 10 289 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium novyi (strain NT)
Q899T7 1.84e-32 125 30 7 265 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium tetani (strain Massachusetts / E88)
B2THF2 4.16e-32 124 29 12 291 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Eklund 17B / Type B)
Q81LP7 5.18e-32 122 29 5 271 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis
C3L5U2 5.18e-32 122 29 5 271 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P929 5.18e-32 122 29 5 271 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus anthracis (strain A0248)
B7GKA2 5.73e-32 122 30 6 265 3 psd Phosphatidylserine decarboxylase proenzyme Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A5HXS0 5.86e-32 123 29 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQ59 5.86e-32 123 29 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain ATCC 19397 / Type A)
B7IYJ1 7.32e-32 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain G9842)
C1ESN2 8.05e-32 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain 03BB102)
A0RIV4 8.05e-32 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus thuringiensis (strain Al Hakam)
B7HPN7 1.01e-31 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain AH187)
B7JNX0 1.01e-31 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain AH820)
Q818C6 1.05e-31 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HCW5 1.05e-31 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain B4264)
Q634K5 1.08e-31 122 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ZK / E33L)
C1FPI8 2.09e-31 122 29 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Kyoto / Type A2)
A6LPC8 2.23e-31 122 30 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q10949 2.29e-31 124 31 7 280 3 psd-1 Phosphatidylserine decarboxylase proenzyme, mitochondrial Caenorhabditis elegans
P0CD79 2.3e-31 122 31 9 276 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKZ5 2.3e-31 122 31 9 276 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0B8S5 2.3e-31 122 31 9 276 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
B1L1M1 2.72e-31 121 29 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Loch Maree / Type A3)
A7GT32 3.08e-31 120 30 5 272 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6HDI5 3.39e-31 120 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus thuringiensis subsp. konkukian (strain 97-27)
A7G9C7 3.57e-31 121 28 8 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q730J7 4.59e-31 120 28 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8BSF4 1.04e-30 122 30 8 305 2 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Mus musculus
Q9UG56 1.14e-30 122 31 8 298 1 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Homo sapiens
Q5R8I8 1.37e-30 122 31 8 298 2 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Pongo abelii
B0BAF4 1.72e-30 119 31 9 276 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
A9VHW5 2.78e-30 118 27 5 273 3 psd Phosphatidylserine decarboxylase proenzyme Bacillus mycoides (strain KBAB4)
P27465 7.4e-30 120 31 8 298 1 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Cricetulus griseus
Q58DH2 1.1e-29 119 29 7 304 2 PISD Phosphatidylserine decarboxylase proenzyme, mitochondrial Bos taurus
Q9PP76 3.02e-29 115 31 10 272 3 psd Phosphatidylserine decarboxylase proenzyme Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A5N497 1.57e-28 114 28 9 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DXW5 1.57e-28 114 28 9 286 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium kluyveri (strain NBRC 12016)
D3ZAW2 1.63e-28 116 30 8 305 1 Pisd Phosphatidylserine decarboxylase proenzyme, mitochondrial Rattus norvegicus
Q97N08 1.71e-28 114 29 8 274 3 psd1 Phosphatidylserine decarboxylase proenzyme 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q46192 1.84e-28 114 28 9 288 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium pasteurianum
Q8RGF2 4.64e-28 113 29 10 284 3 psd Phosphatidylserine decarboxylase proenzyme Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B2UX63 9.51e-28 112 28 11 291 3 psd Phosphatidylserine decarboxylase proenzyme Clostridium botulinum (strain Alaska E43 / Type E3)
Q9KDA3 1.99e-27 110 27 5 252 3 psd Phosphatidylserine decarboxylase proenzyme Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C5D4W6 3.11e-27 110 27 5 276 3 psd Phosphatidylserine decarboxylase proenzyme Geobacillus sp. (strain WCH70)
Q9Z767 2.05e-26 108 32 9 257 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia pneumoniae
Q5JN42 4.29e-26 111 30 12 272 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Oryza sativa subsp. japonica
Q84V22 8.15e-26 109 28 8 307 2 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Arabidopsis thaliana
P53037 1.34e-25 110 28 8 264 1 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F4KAK5 3.95e-25 108 28 8 273 2 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Arabidopsis thaliana
A4GNA8 4.18e-25 108 28 8 273 1 PSD3 Phosphatidylserine decarboxylase proenzyme 3 Arabidopsis thaliana
O14111 4.51e-25 108 29 8 276 3 psd3 Phosphatidylserine decarboxylase proenzyme 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5KWX3 7.34e-25 103 28 4 266 3 psd Phosphatidylserine decarboxylase proenzyme Geobacillus kaustophilus (strain HTA426)
P39822 3.74e-24 102 27 4 252 1 psd Phosphatidylserine decarboxylase proenzyme Bacillus subtilis (strain 168)
Q10T43 4e-24 104 29 8 317 2 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Oryza sativa subsp. japonica
Q9ZJN0 4.57e-24 101 30 8 250 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain J99 / ATCC 700824)
B6JNM7 5.61e-24 101 30 8 250 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain P12)
O25911 1.25e-23 100 30 8 250 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain ATCC 700392 / 26695)
Q24UV7 4.6e-23 99 29 9 269 3 psd Phosphatidylserine decarboxylase proenzyme Desulfitobacterium hafniense (strain Y51)
Q1CRQ1 4.98e-23 99 29 8 250 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain HPAG1)
B8FQ96 4.99e-23 99 28 9 274 3 psd Phosphatidylserine decarboxylase proenzyme Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q821L3 2.4e-22 97 30 8 263 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q256C9 3.09e-22 97 30 10 274 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia felis (strain Fe/C-56)
B2UVC1 1.98e-21 94 29 8 250 3 psd Phosphatidylserine decarboxylase proenzyme Helicobacter pylori (strain Shi470)
C4R360 6.33e-21 96 28 8 267 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Komagataella phaffii (strain GS115 / ATCC 20864)
Q5AK66 1.05e-20 96 29 7 251 3 PSD2 Phosphatidylserine decarboxylase proenzyme 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5L4W1 1.79e-20 92 30 8 257 3 psd Phosphatidylserine decarboxylase proenzyme Chlamydia abortus (strain DSM 27085 / S26/3)
Q97KW7 3.14e-18 86 27 12 281 3 psd2 Phosphatidylserine decarboxylase proenzyme 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O14333 8.88e-17 83 37 5 159 3 psd1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14333 7.04e-07 53 34 2 99 3 psd1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1PCQ8 1.98e-16 82 26 5 236 1 PSD1mt Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Toxoplasma gondii (strain ATCC 50853 / GT1)
P39006 2.3e-16 82 40 3 140 1 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39006 4.43e-09 60 30 2 110 1 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UTB5 4.2e-15 79 33 5 162 3 psd2 Phosphatidylserine decarboxylase proenzyme 2, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UTB5 2.47e-07 55 34 1 83 3 psd2 Phosphatidylserine decarboxylase proenzyme 2, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F6N7K6 1.35e-13 74 27 9 272 1 PSD1pv Phosphatidylserine decarboxylase 2 proenzyme Toxoplasma gondii (strain ATCC 50853 / GT1)
Q9GPP8 2.13e-12 70 23 6 255 1 None Phosphatidylserine decarboxylase proenzyme Plasmodium falciparum
B3L2V1 7.56e-12 68 23 4 210 1 PKH_072580 Phosphatidylserine decarboxylase proenzyme Plasmodium knowlesi (strain H)
C4QX80 5.21e-11 66 30 5 194 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Komagataella phaffii (strain GS115 / ATCC 20864)
C4QX80 2.99e-09 61 31 3 115 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Komagataella phaffii (strain GS115 / ATCC 20864)
Q5ABC5 2.54e-09 61 29 2 108 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5ABC5 9.52e-08 57 26 2 182 3 PSD1 Phosphatidylserine decarboxylase proenzyme 1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A0C2SRU0 1.38e-08 58 21 6 270 2 iboD Decarboxylase iboD Amanita muscaria (strain Koide BX008)
P0DPA6 2.45e-08 58 25 8 219 1 psiD L-tryptophan decarboxylase Psilocybe cubensis
A0A286LEZ8 2.81e-08 58 22 12 301 1 psiD L-tryptophan decarboxylase Psilocybe cyanescens
Q44558 0.000207 42 41 0 46 3 psd Phosphatidylserine decarboxylase proenzyme (Fragment) Azotobacter vinelandii

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09620
Feature type CDS
Gene asd
Product archaetidylserine decarboxylase
Location 27623 - 28555 (strand: -1)
Length 933 (nucleotides) / 310 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000002
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1413
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02666 Phosphatidylserine decarboxylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0688 Lipid transport and metabolism (I) I Phosphatidylserine decarboxylase

Kegg Ortholog Annotation(s)

Protein Sequence

MDTLKIRLQYLLPKQWLTQLAGRFANKKLGWLTQLVIKAFAKAYKVDMNEAKESAFIAYSTFNEFFIRTLKEDVRPVVKGSDTLALPADGTISQLGLIRDDQILQAKKHNYSLEALLAGNWQLASLFRNGQFATIYLSPRDYHRVHMPCDGHLREMIYVPGDLFSVNPLTAANVPNLFARNERLICVFDTDFGPMVQILVGATIVGSMETVWCGMVTPPREGIIKRWTYPAKDSVCAVNLKKGEEMGRFKLGSTVINLFPADTVTLNSALANGVSTRMGELMATRISADNETHAPEETVADSQPDATATN

Flanking regions ( +/- flanking 50bp)

ATTTCGCCGGAAAAACCGGCTGATAATAAACAATACCAGAGGTCGATGTGCTGGATACTCTTAAAATAAGATTGCAATATTTGTTGCCTAAACAGTGGCTTACTCAACTGGCGGGGCGTTTTGCCAATAAAAAACTTGGCTGGCTGACACAACTGGTTATCAAAGCATTCGCCAAAGCCTACAAAGTGGATATGAATGAAGCGAAAGAGAGCGCGTTTATCGCTTACAGCACCTTCAACGAATTTTTTATCCGCACGCTGAAAGAGGATGTCCGCCCGGTAGTAAAAGGCAGCGATACACTGGCACTGCCGGCTGACGGAACCATCAGCCAATTGGGGCTTATCCGCGACGACCAGATTTTGCAGGCGAAAAAGCACAATTATTCGCTGGAAGCACTTCTGGCGGGTAACTGGCAGTTAGCTTCACTGTTTCGTAACGGGCAGTTTGCAACCATTTACTTATCACCGCGTGACTACCACCGTGTCCACATGCCATGTGACGGACATCTGCGCGAAATGATTTATGTGCCGGGCGATCTGTTCTCCGTGAACCCGTTAACGGCTGCAAACGTACCAAATCTGTTTGCCCGTAACGAACGCCTGATTTGTGTGTTTGATACCGATTTCGGTCCGATGGTGCAAATTCTGGTCGGCGCAACCATTGTCGGCAGTATGGAAACTGTCTGGTGCGGCATGGTAACGCCGCCGCGTGAAGGTATTATCAAGCGCTGGACGTATCCTGCCAAAGACAGTGTCTGCGCGGTGAACCTGAAAAAAGGGGAAGAAATGGGGCGCTTTAAACTCGGCTCCACGGTAATCAACCTGTTTCCGGCTGATACCGTCACGCTGAACAGCGCACTGGCAAACGGGGTTTCAACCCGTATGGGTGAACTGATGGCAACCCGCATCAGCGCCGACAATGAAACACACGCGCCGGAAGAAACCGTCGCTGACTCACAACCGGACGCCACTGCGACCAACTGAGGACTCTCCCCTGTGCGCCTGATCATCTCATTTTTACTGGCGGTTTTTCT