Homologs in group_1328

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08220 FBDBKF_08220 74.2 Morganella morganii S1 wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
EHELCC_13305 EHELCC_13305 74.2 Morganella morganii S2 wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
NLDBIP_13645 NLDBIP_13645 74.2 Morganella morganii S4 wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
LHKJJB_12910 LHKJJB_12910 74.2 Morganella morganii S3 wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
HKOGLL_12120 HKOGLL_12120 74.2 Morganella morganii S5 wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
F4V73_RS18770 F4V73_RS18770 74.2 Morganella psychrotolerans wecA UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase

Distribution of the homologs in the orthogroup group_1328

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1328

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZAE1 0.0 554 79 0 363 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Yersinia pestis
Q8XAS7 0.0 511 76 0 349 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Escherichia coli O157:H7
P0AC80 0.0 510 76 0 349 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Shigella flexneri
P0AC78 0.0 510 76 0 349 1 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Escherichia coli (strain K12)
P0AC79 0.0 510 76 0 349 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9L6R7 3e-177 499 72 0 349 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z386 2.35e-176 497 72 0 348 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Salmonella typhi
P45341 5.67e-133 387 56 2 353 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNG8 3.47e-129 377 57 2 338 3 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Pasteurella multocida (strain Pm70)
O34753 2.12e-35 135 30 3 279 1 tagO Probable undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase Bacillus subtilis (strain 168)
P9WMW5 4.04e-22 99 27 10 330 1 wecA Decaprenyl-phosphate N-acetylglucosaminephosphotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMW4 4.04e-22 99 27 10 330 3 wecA Decaprenyl-phosphate N-acetylglucosaminephosphotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0R211 1.2e-21 98 29 9 318 1 wecA Decaprenyl-phosphate N-acetylglucosaminephosphotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P45830 5.32e-21 96 27 10 326 3 wecA Decaprenyl-phosphate N-acetylglucosaminephosphotransferase Mycobacterium leprae (strain TN)
Q9X1N5 1.37e-16 82 27 10 313 1 wecA Undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q03QH3 1.56e-11 68 30 9 207 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C5D8M1 4.76e-11 66 29 10 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Geobacillus sp. (strain WCH70)
Q6HEQ1 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q636B3 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain ZK / E33L)
B9IVZ0 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain Q1)
B7HM34 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain AH187)
C1EPS7 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain 03BB102)
B7IUS3 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain G9842)
Q732F5 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JK01 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain AH820)
A0RHT4 5.57e-11 66 30 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus thuringiensis (strain Al Hakam)
Q5L0X8 2e-10 64 27 8 212 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Geobacillus kaustophilus (strain HTA426)
Q1WT98 2.03e-10 64 31 11 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Ligilactobacillus salivarius (strain UCC118)
A4IM06 2.59e-10 64 27 9 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Geobacillus thermodenitrificans (strain NG80-2)
A9VU75 3.06e-10 64 29 9 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus mycoides (strain KBAB4)
A0AKD7 3.57e-10 63 34 1 108 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y5M0 3.74e-10 63 34 1 108 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q819Q1 4.03e-10 63 30 9 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H6P9 4.03e-10 63 30 9 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cereus (strain B4264)
Q71XX6 4.14e-10 63 34 1 108 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Listeria monocytogenes serotype 4b (strain F2365)
C1KWZ0 4.14e-10 63 34 1 108 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q929Y0 5.11e-10 63 34 1 108 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7GRN9 5.21e-10 63 28 8 212 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q81WC8 5.45e-10 63 29 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus anthracis
C3L712 5.45e-10 63 29 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P683 5.45e-10 63 29 8 209 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus anthracis (strain A0248)
Q7V9F5 2.17e-09 62 32 5 156 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q03EY0 2.88e-08 58 26 7 205 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8KGD1 3.84e-08 58 25 6 233 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B7GGI5 4.55e-08 57 32 1 99 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q3AVL6 6.82e-08 57 27 8 243 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus sp. (strain CC9902)
Q2YXE0 1.01e-07 56 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
C1CPL3 1.07e-07 56 33 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain Taiwan19F-14)
Q03J12 1.07e-07 56 29 7 226 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LY94 1.07e-07 56 29 7 226 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus thermophilus (strain CNRZ 1066)
B0JFF7 1.14e-07 56 29 5 199 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B1MXV8 1.19e-07 56 27 7 244 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Leuconostoc citreum (strain KM20)
Q88V79 1.25e-07 56 26 9 243 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7U3B6 1.49e-07 56 26 7 221 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Parasynechococcus marenigrum (strain WH8102)
Q5GRZ3 2.59e-07 55 25 17 336 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Wolbachia sp. subsp. Brugia malayi (strain TRS)
P0C1R8 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus
A8Z3M3 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GHQ3 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain MRSA252)
P68783 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain N315)
P68782 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QG82 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain Newman)
Q5HGP9 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain COL)
A5IS68 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain JH9)
Q2FZ93 2.77e-07 55 26 8 210 1 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHQ5 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain USA300)
A6U102 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain JH1)
A7X1C2 2.77e-07 55 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5M2U9 2.84e-07 55 29 7 226 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8DVM4 3.71e-07 55 28 6 226 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q49WW4 4.21e-07 54 40 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B2ISQ5 5.34e-07 54 31 3 145 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain CGSP14)
B8ZL54 5.34e-07 54 31 3 145 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q7NEY9 5.93e-07 54 32 4 131 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8NX36 5.98e-07 54 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain MW2)
Q6GA30 5.98e-07 54 26 8 210 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus aureus (strain MSSA476)
B2GB76 6.73e-07 53 38 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
O07107 6.98e-07 53 32 4 130 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q039R9 8.51e-07 53 37 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q04ES8 9.05e-07 53 28 6 166 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8CPK7 9.23e-07 53 40 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQ10 9.23e-07 53 40 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2G6K3 9.39e-07 53 41 2 79 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ31 9.39e-07 53 41 2 79 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Limosilactobacillus reuteri (strain DSM 20016)
B9DPR2 9.66e-07 53 37 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus carnosus (strain TM300)
C0R4W3 1.01e-06 53 27 11 244 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q73G61 1.1e-06 53 33 7 140 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Wolbachia pipientis wMel
B1I956 1.1e-06 53 32 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain Hungary19A-6)
A8YUN7 1.55e-06 53 37 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus helveticus (strain DPC 4571)
Q7UZF8 1.71e-06 53 27 4 165 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q55986 1.74e-06 53 28 7 184 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5WFG7 1.8e-06 52 27 7 203 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Shouchella clausii (strain KSM-K16)
O07668 2.32e-06 52 34 2 93 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Enterococcus hirae
Q5FKV4 2.39e-06 52 37 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q0I604 2.39e-06 52 27 6 165 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus sp. (strain CC9311)
Q5XAL6 3.09e-06 52 29 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1RI79 3.28e-06 52 22 14 323 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Rickettsia bellii (strain RML369-C)
A5GPT3 3.29e-06 52 27 9 221 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus sp. (strain WH7803)
A8GVM4 3.37e-06 52 22 14 323 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Rickettsia bellii (strain OSU 85-389)
Q9K9S6 3.66e-06 52 25 7 201 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q04B74 3.91e-06 51 26 9 205 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAT7 3.91e-06 51 26 9 205 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B5E6Z5 5.03e-06 51 32 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae serotype 19F (strain G54)
Q46I69 5.71e-06 51 35 3 98 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prochlorococcus marinus (strain NATL2A)
Q0SNK7 6.53e-06 51 23 10 292 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borreliella afzelii (strain PKo)
P0CB59 6.53e-06 51 31 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CBB5 6.53e-06 51 31 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain 70585)
A4XI01 7.26e-06 50 22 7 261 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
C1CIK1 7.41e-06 50 31 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain P1031)
Q1J5G1 7.66e-06 50 29 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
B4S6R2 8.24e-06 50 24 7 247 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
C1CW54 1.04e-05 50 26 13 271 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
P39465 1.14e-05 50 26 13 307 3 gnpTA Putative UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q7V3S7 1.2e-05 50 25 7 231 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prochlorococcus marinus (strain MIT 9313)
Q4L5N3 1.32e-05 50 40 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Staphylococcus haemolyticus (strain JCSC1435)
B7J1N1 1.38e-05 50 24 10 293 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borreliella burgdorferi (strain ZS7)
Q44776 1.38e-05 50 24 10 293 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q3B126 1.64e-05 50 24 7 235 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8DR69 1.75e-05 49 31 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04MC4 1.75e-05 49 31 4 146 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A2RD43 1.8e-05 49 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M5 (strain Manfredo)
A1BJY1 2.3e-05 49 24 7 237 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B9DV75 2.38e-05 49 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8A255 2.51e-05 49 34 2 101 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q661W1 2.85e-05 49 23 8 280 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
B3EIL1 2.98e-05 49 25 7 236 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q38XN0 3.28e-05 48 34 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Latilactobacillus sakei subsp. sakei (strain 23K)
A4VX68 3.8e-05 48 27 3 152 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus suis (strain 05ZYH33)
A4W3H1 3.8e-05 48 27 3 152 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus suis (strain 98HAH33)
A7Z4E2 4.35e-05 48 27 4 174 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q2G998 4.49e-05 48 27 7 196 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q03521 5.2e-05 48 27 4 174 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus subtilis (strain 168)
P0DB43 5.3e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB42 5.3e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B0BZI7 6e-05 48 26 9 236 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Acaryochloris marina (strain MBIC 11017)
B1XNS2 6.03e-05 48 29 3 134 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3ANV6 6.4e-05 48 21 7 251 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobium chlorochromatii (strain CaD3)
Q48RZ3 6.46e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JFL1 6.46e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JKM0 6.46e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JAG8 6.46e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q99YK2 6.46e-05 48 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M1
Q182Y8 6.47e-05 48 24 12 293 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Clostridioides difficile (strain 630)
Q74JY6 6.82e-05 47 34 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A2BZ97 6.86e-05 48 29 5 157 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Prochlorococcus marinus (strain MIT 9515)
C0MGW1 6.91e-05 47 27 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus equi subsp. zooepidemicus (strain H70)
B4U4K1 6.91e-05 47 27 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B9K6P4 7.21e-05 47 29 9 202 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q7VGZ9 7.23e-05 48 25 9 252 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q65JY3 7.51e-05 47 23 12 299 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q042P7 8.38e-05 47 34 1 75 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q01Q45 8.77e-05 47 33 4 114 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Solibacter usitatus (strain Ellin6076)
A8EW04 8.98e-05 47 25 9 231 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Aliarcobacter butzleri (strain RM4018)
B5XML0 8.99e-05 47 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M49 (strain NZ131)
A6LEU6 0.0001 47 33 2 101 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
C5CA33 0.000101 47 27 18 304 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A6L074 0.000103 47 35 2 101 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q8NZY2 0.000104 47 28 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q6AJ51 0.000105 47 24 12 326 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A4SH05 0.000106 47 25 7 225 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3AG75 0.000114 47 33 2 98 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus sp. (strain CC9605)
Q03W33 0.000119 47 27 4 181 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q64ZL8 0.000134 47 34 2 101 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacteroides fragilis (strain YCH46)
Q5LIJ4 0.000134 47 34 2 101 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
C0M7A5 0.000138 47 27 6 214 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Streptococcus equi subsp. equi (strain 4047)
Q255W8 0.000142 47 33 0 89 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlamydia felis (strain Fe/C-56)
B7JVF4 0.000145 47 29 7 189 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Rippkaea orientalis (strain PCC 8801 / RF-1)
A0LTM0 0.000146 47 27 9 177 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A5FIY0 0.000181 47 33 2 109 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A8MH33 0.0002 46 25 5 198 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Alkaliphilus oremlandii (strain OhILAs)
A1QZ99 0.000214 46 23 10 308 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borrelia turicatae (strain 91E135)
P96000 0.00025 46 25 13 323 3 gnpTA Putative UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B2TS25 0.00027 46 22 10 291 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Clostridium botulinum (strain Eklund 17B / Type B)
Q3MDP5 0.000282 46 34 3 96 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B5RRC2 0.000282 46 25 13 305 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borrelia recurrentis (strain A1)
A5IKI6 0.000312 45 27 12 223 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L9R8 0.000335 45 27 12 223 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Thermotoga sp. (strain RQ2)
Q8YP83 0.000353 45 34 3 96 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3ER47 0.000379 45 32 2 106 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Amoebophilus asiaticus (strain 5a2)
B5RLC9 0.000429 45 25 15 334 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Borrelia duttonii (strain Ly)
B2V4V5 0.000458 45 22 10 291 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Clostridium botulinum (strain Alaska E43 / Type E3)
A8FCX8 0.000458 45 27 4 174 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Bacillus pumilus (strain SAFR-032)
A0RQL9 0.000484 45 25 11 239 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Campylobacter fetus subsp. fetus (strain 82-40)
Q9RTD0 0.000538 45 23 11 279 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9WY77 0.000544 45 26 11 223 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A0Q060 0.000563 45 30 2 96 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Clostridium novyi (strain NT)
A9BGS8 0.000664 44 26 11 242 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Petrotoga mobilis (strain DSM 10674 / SJ95)
B5YFT8 0.000677 45 30 2 114 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
O66465 0.000692 45 24 7 224 1 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Aquifex aeolicus (strain VF5)
Q31RY5 0.00072 45 31 2 92 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5N2C7 0.00073 44 31 2 92 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A1VBE5 0.000832 44 27 8 218 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Nitratidesulfovibrio vulgaris (strain DP4)
Q728U5 0.000832 44 27 8 218 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B3QLW7 0.000872 44 23 6 217 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B4SHE7 0.001 44 22 10 290 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B8G5X7 0.001 44 25 3 164 3 mraY Phospho-N-acetylmuramoyl-pentapeptide-transferase Chloroflexus aggregans (strain MD-66 / DSM 9485)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16480
Feature type CDS
Gene wecA
Product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase
Location 3635096 - 3636187 (strand: 1)
Length 1092 (nucleotides) / 363 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1328
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00953 Glycosyl transferase family 4

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0472 Cell wall/membrane/envelope biogenesis (M) M UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02851 UDP-GlcNAc:undecaprenyl-phosphate/decaprenyl-phosphate GlcNAc-1-phosphate transferase [EC:2.7.8.33 2.7.8.35] O-Antigen repeat unit biosynthesis
Exopolysaccharide biosynthesis
Teichoic acid biosynthesis
Arabinogalactan biosynthesis - Mycobacterium
Metabolic pathways		 -

Protein Sequence

MDILKMSTNVFYVFLFSFAFLFVARKVAKKIGLVDKPNYRKRHHGLIPLVGGISVYFGIVFAFYVSDIYIPHKELYLICAGILVFIGALDDRYDISVKIRATIQALVGIAMMVFGGLKLESLGHAFGPWDMHLGPFGYIVTLFAVWAAINAFNMVDGIDGLLGGLSCVSFGALGILLYQSGSSALAFWCFSFIAAILPYIMLNLGVCGKKFKVFMGDAGSTLIGFTIIWLLISSTQVDPHPINAVTALWIIAIPLMDMVAIMYRRLRKGMSPFSPDRQHIHHLIMRAGFTPRQAFVLITLAAAVLAAIGIIGENLSFVPEWVMLALFLLAFVMYGYCIKRAWRVARFIKRYKRRLRKATQLKH

Flanking regions ( +/- flanking 50bp)

ACACATGGATGGGTAAATAACCAGCTATATTTATTATAGAGAACAGTACTGTGGATATACTAAAAATGAGCACAAATGTTTTTTACGTGTTCCTATTTTCTTTCGCTTTCCTATTTGTAGCTCGTAAGGTGGCAAAGAAGATTGGACTCGTAGATAAACCTAACTATCGTAAACGACATCATGGGTTGATCCCCCTTGTAGGTGGGATTTCAGTCTATTTTGGTATTGTTTTCGCTTTTTATGTTTCAGATATCTACATTCCTCACAAAGAGCTGTATTTGATTTGTGCGGGGATACTTGTTTTTATCGGTGCGCTTGATGATCGTTATGATATCAGTGTCAAAATCAGGGCAACTATCCAAGCGTTAGTGGGTATTGCTATGATGGTATTCGGTGGTTTAAAACTTGAATCACTTGGTCATGCTTTTGGGCCTTGGGATATGCATTTAGGGCCTTTTGGTTATATCGTCACGCTATTTGCTGTTTGGGCTGCAATCAATGCCTTTAATATGGTGGATGGTATTGATGGTTTATTAGGCGGTCTTTCTTGCGTTTCGTTTGGTGCGCTGGGTATTTTACTTTACCAAAGTGGAAGCTCTGCACTTGCGTTTTGGTGCTTCTCATTTATTGCCGCGATTTTACCTTATATCATGTTAAACCTTGGTGTTTGTGGTAAAAAATTTAAAGTCTTTATGGGCGATGCGGGAAGTACGCTAATAGGCTTTACTATTATTTGGCTATTAATTTCCTCTACTCAAGTTGATCCTCATCCAATCAATGCGGTTACTGCATTATGGATCATTGCTATTCCTCTTATGGATATGGTGGCAATTATGTACCGCCGTTTACGTAAAGGAATGAGTCCTTTTTCACCAGACCGTCAACATATCCACCATTTAATTATGCGAGCAGGTTTTACCCCTCGCCAAGCTTTTGTTTTGATCACGCTTGCAGCCGCGGTGTTGGCCGCTATTGGTATTATTGGTGAAAACTTATCTTTTGTACCAGAATGGGTAATGTTGGCATTGTTTTTGCTTGCTTTTGTTATGTACGGTTATTGCATTAAACGCGCGTGGCGAGTCGCTCGTTTTATTAAACGATATAAACGTCGCCTACGTAAAGCGACACAACTTAAGCATTAAATAAGCAGAGGTCTTTTAACGTGATGAACTCGGAAAATAACGTCTCCCGA