Homologs in group_188

Help

8 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08195 FBDBKF_08195 81.1 Morganella morganii S1 rep DNA helicase Rep
EHELCC_13330 EHELCC_13330 81.1 Morganella morganii S2 rep DNA helicase Rep
NLDBIP_13670 NLDBIP_13670 81.1 Morganella morganii S4 rep DNA helicase Rep
LHKJJB_12885 LHKJJB_12885 81.1 Morganella morganii S3 rep DNA helicase Rep
HKOGLL_12145 HKOGLL_12145 81.1 Morganella morganii S5 rep DNA helicase Rep
F4V73_RS18740 F4V73_RS18740 79.8 Morganella psychrotolerans rep DNA helicase Rep
PMI_RS12040 PMI_RS12040 27.5 Proteus mirabilis HI4320 - ATP-dependent helicase
PMI_RS12245 PMI_RS12245 29.6 Proteus mirabilis HI4320 - UvrD-helicase domain-containing protein

Distribution of the homologs in the orthogroup group_188

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_188

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P09980 0.0 1101 78 1 669 1 rep ATP-dependent DNA helicase Rep Escherichia coli (strain K12)
Q9L6S1 0.0 1099 78 1 669 3 rep ATP-dependent DNA helicase Rep Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44804 0.0 951 67 2 669 3 rep ATP-dependent DNA helicase Rep Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P57654 0.0 713 52 0 641 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O51889 0.0 701 52 2 658 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89A21 0.0 646 49 5 659 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9S3Q0 4.29e-148 451 39 6 666 3 pcrA ATP-dependent DNA helicase PcrA Leuconostoc citreum
P56255 7.85e-144 439 41 9 643 1 pcrA ATP-dependent DNA helicase PcrA Geobacillus stearothermophilus
O34580 2.85e-143 438 40 11 655 1 pcrA ATP-dependent DNA helicase PcrA Bacillus subtilis (strain 168)
Q8NVT1 3.83e-138 424 38 10 653 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MW2)
Q6G828 3.83e-138 424 38 10 653 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MSSA476)
Q5HEL7 3.83e-138 424 38 10 653 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain COL)
Q53727 3.83e-138 424 38 10 653 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
P64319 4.74e-138 424 38 10 653 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain N315)
P64318 4.74e-138 424 38 10 653 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8CRT9 6.78e-138 424 37 12 667 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN29 1.5e-137 423 38 11 655 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GFF2 3.67e-137 422 37 10 653 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MRSA252)
P03018 4.94e-135 416 38 7 636 1 uvrD DNA helicase II Escherichia coli (strain K12)
Q05311 8.17e-135 416 38 7 636 3 uvrD DNA helicase II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02322 5.89e-127 395 39 10 643 1 uvrD DNA helicase II Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CD72 2.45e-126 395 36 11 673 3 uvrD ATP-dependent DNA helicase UvrD1 Mycobacterium leprae (strain TN)
P9WMQ1 5.4e-124 389 36 12 686 1 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMQ0 5.4e-124 389 36 12 686 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5A4 5.4e-124 389 36 12 686 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZD95 7.9e-122 380 35 11 650 3 uvrD Probable DNA helicase II homolog Rickettsia prowazekii (strain Madrid E)
Q68WT1 2.2e-121 379 35 13 652 3 uvrD DNA helicase II Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q92HZ6 5.58e-121 377 36 10 645 3 uvrD Probable DNA helicase II homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULN5 4.46e-120 375 36 10 645 3 uvrD Probable DNA helicase II homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RIP8 4.67e-120 375 37 12 646 3 uvrD Probable DNA helicase II homolog Rickettsia bellii (strain RML369-C)
P45612 5.65e-101 327 34 16 652 3 uvrD Probable DNA helicase II homolog Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q10213 2.9e-75 262 31 15 662 1 srs2 ATP-dependent DNA helicase srs2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O31626 5.82e-75 259 31 14 645 1 yjcD Putative ATP-dependent DNA helicase YjcD Bacillus subtilis (strain 168)
D1KF50 3.47e-64 234 28 19 699 1 SRS2 ATP-dependent DNA helicase SRS2-like protein At4g25120 Arabidopsis thaliana
P47486 1.01e-54 202 27 25 691 3 uvrD Probable DNA helicase II homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P12954 9.9e-54 203 27 21 725 1 SRS2 ATP-dependent DNA helicase SRS2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P75437 2.67e-50 190 28 27 694 3 uvrD Probable DNA helicase II homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P9WMP9 8.7e-47 179 28 16 644 1 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMP8 8.7e-47 179 28 16 644 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64321 8.7e-47 179 28 16 644 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P75438 6.59e-41 160 30 6 376 3 MPN_340 Probable DNA helicase MPN_340 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75438 2.99e-07 57 35 5 119 3 MPN_340 Probable DNA helicase MPN_340 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P53528 1.58e-34 143 29 5 403 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
P53528 1e-10 68 47 3 89 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
Q7A6H4 9.97e-24 110 25 25 597 1 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain N315)
Q7A6H4 8.83e-10 65 32 4 155 1 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain N315)
Q99VC3 9.97e-24 110 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99VC3 8.83e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRE5 9.97e-24 110 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH9)
A5IRE5 8.83e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH9)
A6U074 9.97e-24 110 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH1)
A6U074 8.83e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH1)
A7X0I2 9.97e-24 110 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu3 / ATCC 700698)
A7X0I2 8.83e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CPT9 2.45e-23 109 24 19 519 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CPT9 1.27e-09 65 32 3 153 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GAV9 3.98e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MSSA476)
Q6GAV9 8.46e-10 66 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MSSA476)
A8Z073 4.45e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300 / TCH1516)
A8Z073 8.76e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIA8 4.45e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300)
Q2FIA8 8.76e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300)
A6QFH8 4.49e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Newman)
A6QFH8 8.61e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Newman)
Q5HHB7 4.49e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain COL)
Q5HHB7 8.61e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain COL)
Q2FZT5 4.49e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FZT5 8.61e-10 65 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HQJ4 5.26e-23 108 24 19 519 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQJ4 1.23e-09 65 32 3 153 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NXE9 6.15e-23 108 25 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MW2)
Q8NXE9 8.32e-10 66 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MW2)
Q6GIC1 9.74e-23 107 25 25 594 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
Q6GIC1 1.41e-09 65 32 3 149 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
P15038 1.16e-22 106 28 10 352 1 helD DNA helicase IV Escherichia coli (strain K12)
Q2YWW4 1.86e-21 103 24 25 597 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YWW4 8.32e-10 66 32 4 155 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain bovine RF122 / ET3-1)
B1YKM8 3.01e-21 102 26 20 515 3 addA ATP-dependent helicase/nuclease subunit A Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B1YKM8 1.28e-07 58 31 3 138 3 addA ATP-dependent helicase/nuclease subunit A Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q033I1 1.18e-20 100 24 17 465 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. cremoris (strain SK11)
Q033I1 4.1e-05 50 28 3 137 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. cremoris (strain SK11)
Q71X99 1.41e-20 100 23 16 541 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4b (strain F2365)
Q71X99 1.81e-08 61 33 3 139 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4b (strain F2365)
Q49WA6 2.98e-20 99 23 22 587 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49WA6 6.85e-11 69 32 3 165 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A0AL18 4.17e-20 99 24 17 524 3 addA ATP-dependent helicase/nuclease subunit A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AL18 6.87e-07 56 34 4 127 3 addA ATP-dependent helicase/nuclease subunit A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9CJI9 1.02e-19 98 24 19 465 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. lactis (strain IL1403)
Q9CJI9 5.25e-05 50 27 2 137 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. lactis (strain IL1403)
A2RH77 1.06e-19 97 24 19 465 1 rexA Exonuclease/helicase subunit RexA Lactococcus lactis subsp. cremoris (strain MG1363)
A2RH77 3.93e-05 50 28 3 137 1 rexA Exonuclease/helicase subunit RexA Lactococcus lactis subsp. cremoris (strain MG1363)
Q3AA35 2.38e-19 96 25 16 461 3 addA ATP-dependent helicase/nuclease subunit A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3AA35 4.63e-05 50 27 5 161 3 addA ATP-dependent helicase/nuclease subunit A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8Y511 2.65e-19 96 23 16 516 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y511 9.25e-08 59 31 3 141 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B5XKR4 3.3e-19 96 23 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M49 (strain NZ131)
Q929A9 3.94e-19 96 24 17 545 3 addA ATP-dependent helicase/nuclease subunit A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q929A9 4.24e-09 63 35 4 139 3 addA ATP-dependent helicase/nuclease subunit A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B2IPX3 4.08e-19 96 25 17 469 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain CGSP14)
Q8DPR6 5.43e-19 95 25 19 473 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QP9 5.43e-19 95 25 19 473 3 rexA Exonuclease/helicase subunit RexA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04KF8 5.43e-19 95 25 19 473 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B8DF44 5.56e-19 95 23 15 512 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4a (strain HCC23)
B8DF44 1.06e-07 59 31 3 141 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4a (strain HCC23)
B9DIS2 6.52e-19 95 24 18 517 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus carnosus (strain TM300)
B9DIS2 3.76e-08 60 32 2 131 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus carnosus (strain TM300)
A3CNT9 7e-19 95 26 14 463 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus sanguinis (strain SK36)
B8ZQ32 8.73e-19 95 25 19 481 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IBR6 1.03e-18 94 24 15 464 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain Hungary19A-6)
Q1GAA9 1.84e-18 94 25 19 528 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q1GAA9 5.93e-11 69 32 1 137 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q04AN7 2.13e-18 94 25 15 456 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q04AN7 5.22e-11 70 32 1 137 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q9A0H3 3.03e-18 93 22 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M1
A8MJ41 3.08e-18 93 23 22 561 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus oremlandii (strain OhILAs)
A8MJ41 4.1e-09 63 28 2 138 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus oremlandii (strain OhILAs)
B5E4P5 3.62e-18 93 25 16 462 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 19F (strain G54)
Q5FJX0 5.37e-18 92 23 17 524 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q5FJX0 4.63e-09 63 33 3 130 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q043G6 6.27e-18 92 24 20 530 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q043G6 3.15e-09 64 31 2 137 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q1J7E4 8.1e-18 92 22 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M4 (strain MGAS10750)
A2RFA8 8.35e-18 92 22 14 523 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JMH5 8.83e-18 91 22 13 519 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q5XCW6 8.83e-18 91 22 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1JCJ8 9.54e-18 91 22 13 519 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8RCZ0 1.02e-17 91 24 19 497 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RCZ0 3.86e-07 57 30 3 138 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P0CZ53 1.08e-17 91 22 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ52 1.08e-17 91 22 13 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A8YVK0 1.11e-17 91 24 21 536 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus helveticus (strain DPC 4571)
A8YVK0 1.11e-07 59 32 2 129 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus helveticus (strain DPC 4571)
A4VUD2 1.24e-17 91 23 17 527 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 05ZYH33)
A4W0M7 1.24e-17 91 23 17 527 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 98HAH33)
Q48UB8 1.67e-17 90 22 13 519 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q8P1J2 1.73e-17 90 22 14 523 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8DT76 2.14e-17 90 24 15 459 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DT76 0.000435 47 32 5 146 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1JHM1 2.32e-17 90 22 14 523 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q38X69 3.22e-17 89 25 19 473 3 addA ATP-dependent helicase/nuclease subunit A Latilactobacillus sakei subsp. sakei (strain 23K)
Q38X69 3.49e-06 54 29 2 136 3 addA ATP-dependent helicase/nuclease subunit A Latilactobacillus sakei subsp. sakei (strain 23K)
A3DH19 4.2e-17 89 23 18 559 3 addA ATP-dependent helicase/nuclease subunit A Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DH19 1.81e-06 55 30 3 126 3 addA ATP-dependent helicase/nuclease subunit A Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q4L4Y3 5.3e-17 89 24 26 590 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
Q4L4Y3 1.8e-09 65 31 3 153 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
A8AY33 5.76e-17 89 24 18 535 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A6TVN2 1.02e-16 88 22 19 527 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus metalliredigens (strain QYMF)
A6TVN2 6.87e-08 59 29 3 126 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus metalliredigens (strain QYMF)
Q74JA6 1.1e-16 88 23 20 542 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74JA6 7.79e-09 62 30 2 133 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q04GY7 1.67e-16 87 23 16 528 3 addA ATP-dependent helicase/nuclease subunit A Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04GY7 0.000391 47 26 5 146 3 addA ATP-dependent helicase/nuclease subunit A Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8ERW5 1.43e-15 84 27 19 471 3 addA ATP-dependent helicase/nuclease subunit A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ERW5 1.09e-09 65 35 4 139 3 addA ATP-dependent helicase/nuclease subunit A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8E5T9 1.9e-15 84 23 15 460 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype III (strain NEM316)
Q8E061 2.13e-15 84 23 15 460 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1I4 2.17e-15 84 23 15 460 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B2G532 2.18e-15 84 23 22 559 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
B2G532 1.39e-08 62 32 3 134 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHK2 2.18e-15 84 23 22 559 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri (strain DSM 20016)
A5VHK2 1.39e-08 62 32 3 134 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus reuteri (strain DSM 20016)
Q8XPE2 2.78e-15 84 23 26 626 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain 13 / Type A)
Q8XPE2 1.1e-07 59 28 3 138 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain 13 / Type A)
A7Z368 3.16e-15 83 25 21 541 3 addA ATP-dependent helicase/nuclease subunit A Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A7Z368 2.12e-07 58 32 3 129 3 addA ATP-dependent helicase/nuclease subunit A Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B2A610 9.06e-15 82 22 21 552 3 addA ATP-dependent helicase/nuclease subunit A Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2A610 7.87e-07 56 26 5 215 3 addA ATP-dependent helicase/nuclease subunit A Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q12039 9.42e-15 81 21 25 681 1 HMI1 ATP-dependent DNA helicase HMI1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0TV46 9.68e-15 82 23 26 626 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TV46 1.29e-07 58 28 3 138 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SWW4 1.11e-14 82 23 26 625 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain SM101 / Type A)
Q0SWW4 1.34e-07 58 28 3 138 3 addA ATP-dependent helicase/nuclease subunit A Clostridium perfringens (strain SM101 / Type A)
A4IKW7 1.49e-14 81 22 17 527 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
A4IKW7 4.93e-06 53 30 3 123 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
Q03W49 4.22e-14 80 23 17 536 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03W49 3.84e-07 57 29 4 165 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B7HGP9 1.1e-13 78 24 16 439 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain B4264)
B7HGP9 3.71e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain B4264)
A7GM37 1.17e-13 78 24 14 438 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GM37 7.87e-08 59 33 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5LY80 1.22e-13 78 25 18 468 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain CNRZ 1066)
Q81GP9 1.24e-13 78 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GP9 3.84e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5M2T7 1.37e-13 78 25 18 468 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03IZ8 1.43e-13 78 25 18 468 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
B2UX57 1.6e-13 78 22 21 562 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Alaska E43 / Type E3)
B2UX57 6.71e-07 56 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Alaska E43 / Type E3)
A9VJ02 1.7e-13 78 24 17 441 3 addA ATP-dependent helicase/nuclease subunit A Bacillus mycoides (strain KBAB4)
A9VJ02 6.2e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus mycoides (strain KBAB4)
J8HQ06 2.33e-13 76 28 14 284 1 gajB Gabija protein GajB Bacillus cereus (strain VD045)
B7IL84 2.7e-13 77 24 15 438 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain G9842)
B7IL84 4.18e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain G9842)
A0RAX7 2.77e-13 77 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis (strain Al Hakam)
A0RAX7 3.91e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis (strain Al Hakam)
Q63EM2 2.79e-13 77 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ZK / E33L)
Q63EM2 3.91e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ZK / E33L)
B7HZR5 2.89e-13 77 24 17 438 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH187)
B7HZR5 5.89e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH187)
B9ITE9 2.97e-13 77 24 17 438 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain Q1)
B9ITE9 5.99e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain Q1)
Q73C23 2.97e-13 77 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73C23 5.74e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81TW1 2.99e-13 77 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus anthracis
Q81TW1 1.83e-08 61 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus anthracis
B7JDU4 3.64e-13 77 24 16 438 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH820)
B7JDU4 4.37e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH820)
Q6HM43 4.36e-13 76 24 16 436 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HM43 5.89e-08 60 32 3 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus thuringiensis subsp. konkukian (strain 97-27)
P23478 4.83e-13 76 24 18 536 1 addA ATP-dependent helicase/nuclease subunit A Bacillus subtilis (strain 168)
P23478 3.16e-06 54 30 4 140 1 addA ATP-dependent helicase/nuclease subunit A Bacillus subtilis (strain 168)
B7GM51 5.01e-13 76 23 19 519 3 addA ATP-dependent helicase/nuclease subunit A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B7GM51 3.45e-08 60 32 4 138 3 addA ATP-dependent helicase/nuclease subunit A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B2THC8 5.18e-13 76 23 22 561 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Eklund 17B / Type B)
B2THC8 6e-07 57 32 4 128 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Eklund 17B / Type B)
B4U2H1 6.26e-13 76 23 18 453 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MGY6 9.21e-13 75 23 17 453 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain H70)
Q5L263 9.28e-13 75 21 14 521 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
Q5L263 1.29e-06 55 30 2 123 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
Q65LJ9 9.74e-13 75 24 18 526 3 addA ATP-dependent helicase/nuclease subunit A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65LJ9 2.49e-07 58 30 2 139 3 addA ATP-dependent helicase/nuclease subunit A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q1WRS0 1.4e-12 75 34 2 145 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
Q1WRS0 1.74e-10 68 20 17 469 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
Q836J8 1.46e-12 75 23 19 538 3 addA ATP-dependent helicase/nuclease subunit A Enterococcus faecalis (strain ATCC 700802 / V583)
Q836J8 7.7e-08 59 31 5 151 3 addA ATP-dependent helicase/nuclease subunit A Enterococcus faecalis (strain ATCC 700802 / V583)
Q03D71 4.37e-12 73 25 27 543 3 addA ATP-dependent helicase/nuclease subunit A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q03D71 1.57e-05 52 27 2 140 3 addA ATP-dependent helicase/nuclease subunit A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B1IEN0 6.66e-12 72 20 24 666 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Okra / Type B1)
A8FBR1 7.3e-12 72 24 22 538 3 addA ATP-dependent helicase/nuclease subunit A Bacillus pumilus (strain SAFR-032)
A8FBR1 8.57e-07 56 34 5 132 3 addA ATP-dependent helicase/nuclease subunit A Bacillus pumilus (strain SAFR-032)
A7GAJ8 1.14e-11 72 20 24 666 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GAJ8 3.84e-08 60 31 4 136 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7FPG0 1.16e-11 72 20 22 661 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain ATCC 19397 / Type A)
A5HYY0 1.37e-11 72 20 22 661 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
Q97GV3 1.63e-11 71 21 19 544 3 addA ATP-dependent helicase/nuclease subunit A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97GV3 7.67e-09 62 30 4 158 3 addA ATP-dependent helicase/nuclease subunit A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C1FSA8 1.65e-11 71 20 22 661 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Kyoto / Type A2)
B1MZM2 3.13e-11 70 23 21 523 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc citreum (strain KM20)
B1MZM2 1.54e-07 58 31 3 143 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc citreum (strain KM20)
B1HN90 3.3e-11 70 23 19 547 3 addA ATP-dependent helicase/nuclease subunit A Lysinibacillus sphaericus (strain C3-41)
B1HN90 1.91e-06 55 30 4 138 3 addA ATP-dependent helicase/nuclease subunit A Lysinibacillus sphaericus (strain C3-41)
B9DRV0 5.3e-11 70 22 16 525 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A6LPC4 5.42e-11 70 21 18 547 3 addA ATP-dependent helicase/nuclease subunit A Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LPC4 3.88e-10 67 31 4 160 3 addA ATP-dependent helicase/nuclease subunit A Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B8I2Y2 7.08e-11 69 24 10 300 3 addA ATP-dependent helicase/nuclease subunit A Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B8I2Y2 0.000146 48 30 3 126 3 addA ATP-dependent helicase/nuclease subunit A Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A0PY67 1.07e-10 68 21 20 549 3 addA ATP-dependent helicase/nuclease subunit A Clostridium novyi (strain NT)
A0PY67 5.83e-10 66 32 4 139 3 addA ATP-dependent helicase/nuclease subunit A Clostridium novyi (strain NT)
C3L047 1.21e-10 68 20 24 660 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain 657 / Type Ba4)
A5N628 1.78e-10 68 20 17 536 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5N628 5.64e-08 60 33 4 130 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZK4 2.06e-10 68 20 17 536 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
B9DZK4 5.94e-08 60 33 4 130 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
Q8K9A9 3.95e-10 67 23 19 502 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q18AN9 5.54e-10 66 33 4 139 3 addA ATP-dependent helicase/nuclease subunit A Clostridioides difficile (strain 630)
Q18AN9 0.000345 47 29 9 157 3 addA ATP-dependent helicase/nuclease subunit A Clostridioides difficile (strain 630)
B1I493 1.16e-09 65 22 22 608 3 addA ATP-dependent helicase/nuclease subunit A Desulforudis audaxviator (strain MP104C)
B1I493 5.27e-06 53 31 4 129 3 addA ATP-dependent helicase/nuclease subunit A Desulforudis audaxviator (strain MP104C)
Q9PLT8 2.78e-09 64 26 2 145 3 recB RecBCD enzyme subunit RecB Chlamydia muridarum (strain MoPn / Nigg)
B0K213 2.98e-09 64 33 4 146 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter sp. (strain X514)
B0K213 6.99e-07 56 22 9 279 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter sp. (strain X514)
B0KDB7 3.06e-09 64 33 4 146 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KDB7 3.81e-07 57 22 9 279 3 addA ATP-dependent helicase/nuclease subunit A Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q03NA7 3.98e-09 63 30 7 191 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03NA7 6.7e-09 63 24 19 483 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q0AXU8 1.59e-08 62 31 5 151 3 addA ATP-dependent helicase/nuclease subunit A Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0AXU8 6.57e-08 60 28 1 135 3 addA ATP-dependent helicase/nuclease subunit A Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A5D1P3 2.99e-08 61 21 9 314 3 addA ATP-dependent helicase/nuclease subunit A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5D1P3 2.11e-05 51 26 5 171 3 addA ATP-dependent helicase/nuclease subunit A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
O84645 3.05e-08 60 26 2 138 3 recB RecBCD enzyme subunit RecB Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A0QS29 8.43e-08 59 21 19 468 3 recB RecBCD enzyme subunit RecB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A9KTE6 1.17e-07 59 23 11 352 3 addA ATP-dependent helicase/nuclease subunit A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9KTE6 1.09e-06 55 29 3 141 3 addA ATP-dependent helicase/nuclease subunit A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A9KTE6 0.000165 48 28 6 150 3 addA ATP-dependent helicase/nuclease subunit A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B2GEY4 1.58e-07 58 24 10 286 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2GEY4 5.49e-06 53 30 5 159 3 addA ATP-dependent helicase/nuclease subunit A Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A4J4E3 1.9e-07 58 23 11 319 3 addA ATP-dependent helicase/nuclease subunit A Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A4J4E3 0.000193 48 30 9 180 3 addA ATP-dependent helicase/nuclease subunit A Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B0TDI0 1.42e-06 55 25 10 251 3 addA ATP-dependent helicase/nuclease subunit A Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q88U41 1.48e-06 55 28 4 173 3 addA ATP-dependent helicase/nuclease subunit A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88U41 3.92e-06 54 22 22 481 3 addA ATP-dependent helicase/nuclease subunit A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B8FXD7 2.64e-06 54 28 5 145 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B8FXD7 5.68e-06 53 28 6 210 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q24WW8 2.85e-06 54 28 5 145 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain Y51)
Q24WW8 5.92e-06 53 28 6 210 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain Y51)
Q89AB3 2.85e-06 54 21 16 489 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P9WMQ3 6.99e-06 53 20 12 463 1 recB RecBCD enzyme subunit RecB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMQ2 6.99e-06 53 20 12 463 3 recB RecBCD enzyme subunit RecB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P08394 1.02e-05 52 27 6 162 1 recB RecBCD enzyme subunit RecB Escherichia coli (strain K12)
P57529 6.98e-05 50 29 4 124 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q67MD5 8.28e-05 50 28 4 142 3 addA ATP-dependent helicase/nuclease subunit A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q2RL77 9.69e-05 49 28 11 227 3 addA ATP-dependent helicase/nuclease subunit A Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q038V7 0.000119 49 27 2 143 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEJ1 0.000121 49 27 2 143 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus casei (strain BL23)
O51578 0.000138 49 30 1 90 3 recB RecBCD enzyme subunit RecB Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9Z7G7 0.000153 48 29 2 88 3 recB RecBCD enzyme subunit RecB Chlamydia pneumoniae
B1KUZ8 0.000195 48 30 4 156 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Loch Maree / Type A3)
P45157 0.000254 48 21 20 474 3 recB RecBCD enzyme subunit RecB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4L4Y2 0.000277 48 21 3 208 3 addB ATP-dependent helicase/deoxyribonuclease subunit B Staphylococcus haemolyticus (strain JCSC1435)
P0DW48 0.000712 46 36 2 68 3 gajB Gabija protein GajB Bacillus cereus (strain HuB5-5)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16455
Feature type CDS
Gene rep
Product DNA helicase Rep
Location 3627528 - 3629549 (strand: 1)
Length 2022 (nucleotides) / 673 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_188
Orthogroup size 9
N. genomes 7

Actions

Genomic region

Domains

PF00580 UvrD/REP helicase N-terminal domain
PF13361 UvrD-like helicase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0210 Replication, recombination and repair (L) L Superfamily I DNA or RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03656 ATP-dependent DNA helicase Rep [EC:5.6.2.4] - -

Protein Sequence

MRLNPGQQKAVEYVSGPCLVLAGAGSGKTRVITNKIAYLIRQCRYSAKQIAAVTFTNKAAREMKERVAQTLGKQEAKGLMISTFHTLGLEIIKREYKALGIKSNFSLFDDQDQSALLKELTVDLLEEDKDLLSQLKSQISNWKNDMLTPEQVIGRAQSQQDHTFAECFRRYEQHLLSCNVLDFDDLISKPTLLLRTNEEVRARWQQRIRYLLVDEYQDTNTSQYELVKWLVGERARFTVVGDDDQSIYSWRGARPQNLVLLQKDFPQLNVIKLEQNYRSSGRILKSANILIENNPHVFEKRLFSELGYGDELRVLTANNEEHEAERVAGELIAHHFINKTNYKDYAILYRGNHQSRIFEKYLMQNRIPYRISGETSFFSREEIKDILAYLRVITNPDDDAAFLRIVNKPRREIGPMTIQKLGEWAKVRDKSLFNACFDLGLSQTLTGRGLSALQAFSQWMARIVQQSEREPLLAVRDLLHEMDYESWLYETSSSAKAAEMRMKNINQLFSWMSEMLEGDELHEPMTLSQVVNRFTLRDMMERGETDEELDQVQLMTLHASKGLEFPHVFLVGMEEGILPHQSSIDEDNVEEERRLAYVGITRAQKTLTFTLCKERRQYGELIRPEPSRFLYELPQDDLHWDTNKKKVLSAQEKQEKGQKGVAGLKAMLARHKP

Flanking regions ( +/- flanking 50bp)

GCTACAATGACTCCCCGTGATATTCTTGGTTAATGAAGTTTGGAAAAAGTATGCGATTAAATCCCGGTCAGCAAAAAGCAGTTGAATATGTGTCAGGTCCTTGTCTGGTCTTGGCGGGAGCCGGCTCGGGTAAAACACGGGTGATAACCAATAAAATTGCTTATCTTATTCGTCAATGCCGTTATTCTGCTAAGCAGATTGCTGCGGTGACTTTTACCAATAAAGCGGCGCGTGAAATGAAAGAGCGTGTTGCTCAAACATTGGGAAAACAAGAGGCAAAAGGATTAATGATCTCGACCTTCCATACATTAGGATTGGAGATTATTAAGCGAGAATACAAAGCATTAGGCATAAAATCCAACTTTTCTTTGTTTGATGATCAAGACCAATCCGCATTATTAAAAGAATTAACGGTAGATTTATTAGAAGAAGATAAAGATTTGCTATCACAGTTAAAGAGTCAAATCTCTAACTGGAAAAATGACATGCTCACACCTGAGCAAGTGATTGGTAGAGCACAATCGCAGCAAGATCATACTTTTGCCGAGTGCTTTCGACGTTATGAGCAACATTTACTAAGCTGTAATGTATTGGATTTTGATGACTTAATCAGTAAGCCTACCTTGCTATTACGTACTAATGAAGAAGTAAGGGCGCGCTGGCAACAGCGTATTCGTTATCTGCTGGTGGATGAATATCAAGATACCAATACAAGCCAATATGAGTTGGTGAAATGGTTAGTGGGTGAAAGAGCCCGTTTCACTGTGGTGGGGGATGATGATCAGTCTATTTATTCATGGCGTGGTGCGCGTCCCCAAAATCTGGTGTTATTGCAAAAAGATTTCCCACAGCTAAATGTGATCAAACTGGAACAAAATTATCGGTCATCAGGGCGTATTTTAAAATCAGCTAATATTTTAATTGAAAATAATCCCCATGTATTTGAAAAACGGCTGTTTTCAGAATTAGGTTATGGGGATGAGCTACGAGTATTAACCGCTAATAATGAAGAGCATGAAGCTGAGCGTGTAGCGGGGGAACTGATTGCCCATCATTTTATTAATAAAACTAATTATAAAGATTACGCAATACTCTATCGAGGTAATCACCAGTCGCGTATTTTTGAAAAGTATTTGATGCAAAATCGCATTCCTTATCGCATTTCGGGTGAAACCTCGTTTTTTTCCCGTGAAGAGATCAAGGATATTTTGGCTTACTTAAGAGTGATCACTAATCCGGATGATGATGCTGCATTCTTACGTATCGTCAATAAGCCTCGTCGTGAAATAGGCCCGATGACTATCCAAAAGTTGGGGGAGTGGGCTAAAGTCCGTGATAAAAGCTTATTTAATGCCTGTTTTGACTTGGGATTAAGCCAAACGTTAACAGGGCGAGGTTTAAGTGCATTACAGGCTTTTTCACAGTGGATGGCGCGAATTGTACAACAATCAGAGCGTGAGCCTTTGCTCGCTGTACGTGATTTGCTTCATGAAATGGATTATGAAAGTTGGTTATATGAAACCTCTAGTAGCGCGAAAGCGGCTGAAATGAGAATGAAAAATATTAACCAGCTTTTTTCTTGGATGAGTGAAATGCTTGAGGGGGATGAGCTACATGAACCCATGACGCTCTCTCAAGTGGTCAACCGTTTTACTCTGCGCGATATGATGGAGCGTGGTGAAACCGATGAAGAGTTAGATCAAGTGCAATTAATGACACTTCACGCCTCAAAAGGACTGGAATTTCCACATGTTTTTCTGGTTGGCATGGAAGAGGGGATCTTGCCTCATCAAAGTAGTATCGATGAAGATAACGTTGAAGAAGAGCGGCGTTTAGCTTATGTCGGTATTACTCGAGCACAAAAGACATTAACTTTCACATTATGTAAAGAGCGACGTCAATACGGTGAATTAATTCGTCCAGAGCCCAGTCGTTTTCTATATGAATTGCCTCAAGACGATCTCCATTGGGATACCAATAAAAAGAAAGTGTTAAGTGCTCAAGAAAAGCAAGAAAAAGGGCAAAAAGGGGTCGCTGGGCTTAAAGCGATGCTGGCGAGACATAAACCTTAGCTGTCTGTCAGTAAAAAATAAAATCCCTTACTTGCATGATAAGTAAGGGA