Homologs in group_2452

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20615 FBDBKF_20615 23.0 Morganella morganii S1 - putative poly(Glycerol-phosphate) alpha-glucosyltransferase
EHELCC_19820 EHELCC_19820 23.0 Morganella morganii S2 - putative poly(Glycerol-phosphate) alpha-glucosyltransferase
NLDBIP_15040 NLDBIP_15040 23.0 Morganella morganii S4 - putative poly(Glycerol-phosphate) alpha-glucosyltransferase
LHKJJB_15570 LHKJJB_15570 23.0 Morganella morganii S3 - putative poly(Glycerol-phosphate) alpha-glucosyltransferase
HKOGLL_14690 HKOGLL_14690 23.0 Morganella morganii S5 - putative poly(Glycerol-phosphate) alpha-glucosyltransferase
F4V73_RS17340 F4V73_RS17340 66.4 Morganella psychrotolerans - glycosyltransferase family 4 protein

Distribution of the homologs in the orthogroup group_2452

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2452

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5T072 7.31e-23 102 26 11 317 1 wclR UDP-Gal:alpha-D-GlcNAc-diphosphoundecaprenol alpha-1,3-galactosyltransferase Escherichia coli
C3PK12 1.77e-21 98 26 11 319 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q8NTA6 1.99e-21 98 25 15 392 1 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QB40 1.99e-21 98 25 15 392 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium glutamicum (strain R)
D3Q051 6.08e-21 97 26 14 389 3 mshA D-inositol 3-phosphate glycosyltransferase Stackebrandtia nassauensis (strain DSM 44728 / CIP 108903 / NRRL B-16338 / NBRC 102104 / LLR-40K-21)
O05083 4.13e-20 93 24 11 353 3 HI_1698 Uncharacterized glycosyltransferase HI_1698 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B1VEI4 2.49e-19 92 25 14 361 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A0R043 1.46e-18 89 27 4 232 1 pimB GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6NJL3 1.51e-18 90 25 10 318 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q4JSW2 3.97e-18 88 25 10 304 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium jeikeium (strain K411)
Q81ST7 1.86e-17 86 24 8 294 1 bshA N-acetyl-alpha-D-glucosaminyl L-malate synthase Bacillus anthracis
Q8FSH1 2.79e-17 86 26 17 369 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9R9N2 3.74e-17 85 30 8 212 3 lpsB Lipopolysaccharide core biosynthesis mannosyltransferase LpsB Rhizobium meliloti (strain 1021)
P42982 5.65e-16 82 23 8 290 1 bshA N-acetyl-alpha-D-glucosaminyl L-malate synthase Bacillus subtilis (strain 168)
Q5YP47 5.97e-16 82 25 15 369 3 mshA D-inositol 3-phosphate glycosyltransferase Nocardia farcinica (strain IFM 10152)
Q65CC7 7.31e-16 81 26 3 190 1 kanE Alpha-D-kanosaminyltransferase Streptomyces kanamyceticus
D5USX8 3.82e-15 80 25 14 394 3 mshA D-inositol 3-phosphate glycosyltransferase Tsukamurella paurometabola (strain ATCC 8368 / DSM 20162 / CCUG 35730 / CIP 100753 / JCM 10117 / KCTC 9821 / NBRC 16120 / NCIMB 702349 / NCTC 13040)
A0JZ09 4.01e-15 79 27 7 220 3 mshA D-inositol 3-phosphate glycosyltransferase Arthrobacter sp. (strain FB24)
P71055 6.15e-15 79 24 8 327 2 epsF Putative glycosyltransferase EpsF Bacillus subtilis (strain 168)
A4FQ08 6.81e-15 79 26 8 234 3 mshA D-inositol 3-phosphate glycosyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B2HQV2 1.19e-14 78 29 9 241 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
C6WPK3 3.33e-14 77 24 14 394 3 mshA D-inositol 3-phosphate glycosyltransferase Actinosynnema mirum (strain ATCC 29888 / DSM 43827 / JCM 3225 / NBRC 14064 / NCIMB 13271 / NRRL B-12336 / IMRU 3971 / 101)
C7MSY6 4.19e-14 76 28 9 242 3 mshA D-inositol 3-phosphate glycosyltransferase Saccharomonospora viridis (strain ATCC 15386 / DSM 43017 / JCM 3036 / CCUG 5913 / NBRC 12207 / NCIMB 9602 / P101)
P46915 4.7e-14 76 23 16 374 1 cotSA Spore coat protein SA Bacillus subtilis (strain 168)
O68547 7.12e-14 75 25 4 242 3 lpcC Lipopolysaccharide core biosynthesis mannosyltransferase LpcC Rhizobium leguminosarum bv. viciae
Q9L1I4 1.03e-13 76 24 6 237 3 SCO2592 Exopolysaccharide phosphotransferase SCO2592 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
C8XA09 1.23e-13 75 28 9 224 3 mshA D-inositol 3-phosphate glycosyltransferase Nakamurella multipartita (strain ATCC 700099 / DSM 44233 / CIP 104796 / JCM 9543 / NBRC 105858 / Y-104)
A3PU84 1.41e-13 75 27 14 330 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium sp. (strain JLS)
A0PVZ1 1.57e-13 75 28 9 241 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium ulcerans (strain Agy99)
C7QKE8 1.63e-13 75 24 7 241 3 mshA2 D-inositol 3-phosphate glycosyltransferase 2 Catenulispora acidiphila (strain DSM 44928 / JCM 14897 / NBRC 102108 / NRRL B-24433 / ID139908)
A1R8N8 2.12e-13 74 28 8 204 3 mshA D-inositol 3-phosphate glycosyltransferase Paenarthrobacter aurescens (strain TC1)
P54138 2.19e-13 74 29 12 241 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium leprae (strain TN)
B8ZT88 2.19e-13 74 29 12 241 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium leprae (strain Br4923)
D2Q1C4 2.34e-13 74 25 10 293 3 mshA D-inositol 3-phosphate glycosyltransferase Kribbella flavida (strain DSM 17836 / JCM 10339 / NBRC 14399)
P9WMY7 2.9e-13 74 29 12 248 1 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY6 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
C6DT68 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium tuberculosis (strain KZN 1435 / MDR)
A5WJJ8 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium tuberculosis (strain F11)
A5TZL4 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AKG4 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KFW0 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P64708 2.9e-13 74 29 12 248 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q59002 3.04e-13 73 21 13 390 3 MJ1607 Uncharacterized glycosyltransferase MJ1607 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P9WMZ3 4.82e-13 73 23 3 217 1 pimB GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMZ2 4.82e-13 73 23 3 217 3 pimB GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
D6Z995 7.68e-13 73 28 6 230 3 mshA D-inositol 3-phosphate glycosyltransferase Segniliparus rotundus (strain ATCC BAA-972 / CDC 1076 / CIP 108378 / DSM 44985 / JCM 13578)
Q65CC1 8.14e-13 72 27 6 198 1 kanF 2-deoxystreptamine glucosyltransferase Streptomyces kanamyceticus
A8LZG1 8.77e-13 72 27 10 237 3 mshA D-inositol 3-phosphate glycosyltransferase Salinispora arenicola (strain CNS-205)
Q8NNK8 1.06e-12 72 28 6 212 1 pimB GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
D1BZ82 1.13e-12 72 24 15 389 3 mshA D-inositol 3-phosphate glycosyltransferase Xylanimonas cellulosilytica (strain DSM 15894 / JCM 12276 / CECT 5975 / KCTC 9989 / LMG 20990 / NBRC 107835 / XIL07)
A0QQZ8 1.66e-12 72 29 12 241 1 mshA D-inositol 3-phosphate glycosyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
D0L476 2.58e-12 71 27 9 242 3 mshA D-inositol 3-phosphate glycosyltransferase Gordonia bronchialis (strain ATCC 25592 / DSM 43247 / BCRC 13721 / JCM 3198 / KCTC 3076 / NBRC 16047 / NCTC 10667)
B1MHQ0 7.27e-12 70 27 10 241 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q8S4F6 8.07e-12 70 27 5 182 1 SQD2 Sulfoquinovosyl transferase SQD2 Arabidopsis thaliana
C4LLD6 8.65e-12 69 26 8 242 3 mshA D-inositol 3-phosphate glycosyltransferase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
B8HCF8 2.09e-11 68 28 6 203 3 mshA D-inositol 3-phosphate glycosyltransferase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A1T3B5 2.19e-11 68 24 13 313 3 mshA D-inositol 3-phosphate glycosyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A4X1R6 3.84e-11 67 24 9 248 3 mshA D-inositol 3-phosphate glycosyltransferase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
P26388 4.28e-11 67 29 4 174 3 wcaL Putative colanic acid biosynthesis glycosyltransferase WcaL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q73SU4 4.69e-11 67 23 13 387 3 mshA D-inositol 3-phosphate glycosyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q0SF06 8.56e-11 66 24 14 333 3 mshA D-inositol 3-phosphate glycosyltransferase Rhodococcus jostii (strain RHA1)
C7R101 9.82e-11 66 23 10 304 3 mshA D-inositol 3-phosphate glycosyltransferase Jonesia denitrificans (strain ATCC 14870 / DSM 20603 / BCRC 15368 / CIP 55.134 / JCM 11481 / NBRC 15587 / NCTC 10816 / Prevot 55134)
P71243 1e-10 66 31 6 169 3 wcaL Putative colanic acid biosynthesis glycosyltransferase WcaL Escherichia coli (strain K12)
A0QLK5 1.83e-10 65 26 7 238 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium avium (strain 104)
P71053 1.94e-10 65 24 4 212 2 epsD Putative glycosyltransferase EpsD Bacillus subtilis (strain 168)
D1A4Q3 3.28e-10 64 25 9 252 3 mshA D-inositol 3-phosphate glycosyltransferase Thermomonospora curvata (strain ATCC 19995 / DSM 43183 / JCM 3096 / KCTC 9072 / NBRC 15933 / NCIMB 10081 / Henssen B9)
A0QWG6 3.97e-10 64 24 12 340 1 pimA Phosphatidyl-myo-inositol mannosyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q58469 4.77e-10 64 27 4 176 3 MJ1069 Uncharacterized glycosyltransferase MJ1069 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P37287 4.88e-10 64 25 11 308 1 PIGA Phosphatidylinositol N-acetylglucosaminyltransferase subunit A Homo sapiens
Q1BEA6 5.06e-10 64 26 16 388 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium sp. (strain MCS)
A1UAM8 5.06e-10 64 26 16 388 3 mshA D-inositol 3-phosphate glycosyltransferase Mycobacterium sp. (strain KMS)
C1AZ64 5.77e-10 64 22 15 390 3 mshA D-inositol 3-phosphate glycosyltransferase Rhodococcus opacus (strain B4)
Q4H4F8 6.77e-10 63 20 8 319 3 btrM 2-deoxystreptamine N-acetyl-D-glucosaminyltransferase Niallia circulans
Q53U18 8.15e-10 63 26 8 193 1 neoD 2-deoxystreptamine N-acetyl-D-glucosaminyltransferase Streptomyces fradiae
C0ZUT0 8.8e-10 63 24 8 246 3 mshA D-inositol 3-phosphate glycosyltransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
P26470 9.54e-10 63 24 6 239 1 waaK Lipopolysaccharide 1,2-N-acetylglucosaminetransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04975 1.1e-09 63 37 1 94 4 vipC Vi polysaccharide biosynthesis protein VipC/TviE Salmonella typhi
A7TZT2 1.44e-09 62 25 7 270 1 mfpsA Mannosylfructose-phosphate synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
D4GU62 1.81e-09 62 27 6 183 3 agl9 Low-salt glycan biosynthesis hexosyltransferase Agl9 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P9WMZ5 1.93e-09 62 25 14 343 1 pimA Phosphatidyl-myo-inositol mannosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMZ4 1.93e-09 62 25 14 343 3 pimA Phosphatidyl-myo-inositol mannosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TY88 1.93e-09 62 25 14 343 3 pimA Phosphatidyl-myo-inositol mannosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O34413 2.15e-09 62 22 7 258 3 ytcC Putative glycosyltransferase YtcC Bacillus subtilis (strain 168)
A1SP12 2.5e-09 62 24 5 227 3 mshA D-inositol 3-phosphate glycosyltransferase Nocardioides sp. (strain ATCC BAA-499 / JS614)
D2S4K7 2.53e-09 62 25 9 235 3 mshA D-inositol 3-phosphate glycosyltransferase Geodermatophilus obscurus (strain ATCC 25078 / DSM 43160 / JCM 3152 / CCUG 61914 / KCC A-0152 / KCTC 9177 / NBRC 13315 / NRRL B-3577 / G-20)
Q46634 2.7e-09 61 27 4 168 3 amsD Amylovoran biosynthesis glycosyltransferase AmsD Erwinia amylovora
A0LQY9 4.01e-09 61 23 14 315 3 mshA D-inositol 3-phosphate glycosyltransferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
P25740 5.12e-09 60 22 13 359 1 waaG Lipopolysaccharide glucosyltransferase WaaG Escherichia coli (strain K12)
B8QSK0 5.66e-09 60 21 8 303 1 wclY O-antigen biosynthesis glycosyltransferase WclY Escherichia coli
D7AW65 6.14e-09 60 24 5 237 3 mshA D-inositol 3-phosphate glycosyltransferase Nocardiopsis dassonvillei (strain ATCC 23218 / DSM 43111 / CIP 107115 / JCM 7437 / KCTC 9190 / NBRC 14626 / NCTC 10488 / NRRL B-5397 / IMRU 509)
D1BD84 6.23e-09 60 22 7 250 3 mshA D-inositol 3-phosphate glycosyltransferase Sanguibacter keddieii (strain ATCC 51767 / DSM 10542 / NCFB 3025 / ST-74)
Q64323 6.29e-09 60 25 11 308 2 Piga Phosphatidylinositol N-acetylglucosaminyltransferase subunit A Mus musculus
P87172 6.9e-09 60 22 5 216 3 gpi3 Phosphatidylinositol N-acetylglucosaminyltransferase gpi3 subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0P9C7 8.67e-09 60 28 6 185 1 pglJ N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O07147 1.08e-08 60 24 10 307 3 pimA Phosphatidyl-myo-inositol mannosyltransferase Mycobacterium leprae (strain TN)
P39862 1.37e-08 59 21 9 316 3 capM Capsular polysaccharide biosynthesis glycosyltransferase CapM Staphylococcus aureus
O32272 1.44e-08 59 28 7 174 2 tuaC Putative teichuronic acid biosynthesis glycosyltransferase TuaC Bacillus subtilis (strain 168)
A4T324 2.71e-08 58 28 10 239 3 mshA D-inositol 3-phosphate glycosyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
Q58577 3.04e-08 58 28 4 147 3 MJ1178 Uncharacterized glycosyltransferase MJ1178 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A0R2E2 3.68e-08 58 24 8 250 1 glgM Alpha-maltose-1-phosphate synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0P9C9 4.15e-08 58 24 5 180 1 pglA N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9R9N1 4.36e-08 57 29 2 155 3 lpsE Lipopolysaccharide core biosynthesis glycosyltransferase LpsE Rhizobium meliloti (strain 1021)
Q46638 4.44e-08 58 27 6 194 3 amsK Amylovoran biosynthesis glycosyltransferase AmsK Erwinia amylovora
A6M9B7 4.68e-08 57 21 8 303 1 wclY O-antigen biosynthesis glycosyltransferase WclY Escherichia coli
Q58459 4.84e-08 58 30 1 93 3 MJ1059 Uncharacterized glycosyltransferase MJ1059 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q82G92 8.12e-08 57 24 8 242 3 mshA D-inositol 3-phosphate glycosyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
D6Y4U7 9.42e-08 57 24 8 245 3 mshA D-inositol 3-phosphate glycosyltransferase Thermobispora bispora (strain ATCC 19993 / DSM 43833 / CBS 139.67 / JCM 10125 / KCTC 9307 / NBRC 14880 / R51)
Q7LYW5 9.6e-08 57 25 9 241 1 treT Trehalose synthase Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q9HH00 9.6e-08 57 25 9 241 3 treT Trehalose synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C7Q4Y6 9.99e-08 57 27 12 252 3 mshA1 D-inositol 3-phosphate glycosyltransferase 1 Catenulispora acidiphila (strain DSM 44928 / JCM 14897 / NBRC 102108 / NRRL B-24433 / ID139908)
P0CF99 1.56e-07 56 26 5 161 1 pimC GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol dimannoside mannosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U3B9 1.56e-07 56 26 5 161 3 pimC GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol dimannoside mannosyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9HTC0 2.15e-07 55 25 13 278 1 wbpZ D-rhamnosyltransferase WbpZ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47KS6 2.47e-07 55 23 6 241 3 mshA D-inositol 3-phosphate glycosyltransferase Thermobifida fusca (strain YX)
A6W6D9 3.04e-07 55 28 8 182 3 mshA D-inositol 3-phosphate glycosyltransferase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B1VS68 4.94e-07 55 24 8 256 3 mshA D-inositol 3-phosphate glycosyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
D7C367 4.95e-07 55 24 9 242 3 mshA D-inositol 3-phosphate glycosyltransferase Streptomyces bingchenggensis (strain BCW-1)
P9WMZ1 6.06e-07 54 25 8 251 1 glgM Alpha-maltose-1-phosphate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMZ0 6.06e-07 54 25 8 251 3 glgM Alpha-maltose-1-phosphate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
C9ZH13 1.16e-06 53 22 11 326 3 mshA D-inositol 3-phosphate glycosyltransferase Streptomyces scabiei (strain 87.22)
A6ZW78 1.28e-06 53 20 10 309 3 SPT14 Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit Saccharomyces cerevisiae (strain YJM789)
Q93P60 1.61e-06 53 21 9 294 1 mgs Alpha-monoglucosyldiacylglycerol synthase Acholeplasma laidlawii
Q47594 1.85e-06 53 25 8 231 1 wbdB O-antigen chain mannosyltransferase B Escherichia coli
P32363 2.15e-06 53 21 12 315 1 SPT14 Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B5VSZ6 2.15e-06 53 21 12 315 3 SPT14 Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit Saccharomyces cerevisiae (strain AWRI1631)
B3LKQ3 2.15e-06 53 21 12 315 3 SPT14 Phosphatidylinositol N-acetylglucosaminyltransferase GPI3 subunit Saccharomyces cerevisiae (strain RM11-1a)
O58762 2.95e-06 52 27 6 181 1 treT Trehalose synthase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q94BX4 3.06e-06 52 26 3 150 2 PIGA Phosphatidylinositol N-acetylglucosaminyltransferase subunit A Arabidopsis thaliana
A8LDJ8 3.58e-06 52 24 15 315 3 mshA D-inositol 3-phosphate glycosyltransferase Parafrankia sp. (strain EAN1pec)
Q2JFV0 6.21e-06 51 26 9 242 3 mshA D-inositol 3-phosphate glycosyltransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
D2B9F4 1.37e-05 50 22 12 332 3 mshA D-inositol 3-phosphate glycosyltransferase Streptosporangium roseum (strain ATCC 12428 / DSM 43021 / JCM 3005 / KCTC 9067 / NCIMB 10171 / NRRL 2505 / NI 9100)
Q9FCG5 1.37e-05 50 23 8 254 2 mshA D-inositol 3-phosphate glycosyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P54490 1.45e-05 50 21 10 308 3 yqgM Uncharacterized glycosyltransferase YqgM Bacillus subtilis (strain 168)
P9WMY9 1.78e-05 50 25 11 250 1 Rv3032 Glycogen synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY8 1.78e-05 50 25 11 250 3 MT3116 Glycogen synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9AET5 3.11e-05 49 26 7 168 1 gtfA UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase GtfA subunit Streptococcus gordonii
Q0RS49 3.58e-05 49 26 12 283 3 mshA D-inositol 3-phosphate glycosyltransferase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q1ARU5 8.57e-05 48 23 14 309 1 treT Trehalose synthase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P49035 9.35e-05 48 37 2 64 2 None Sucrose synthase isoform 1 Daucus carota
P9WMY5 0.000166 47 26 5 150 1 mgtA GDP-mannose-dependent alpha-mannosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY4 0.000166 47 26 5 150 3 mgtA GDP-mannose-dependent alpha-mannosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O13933 0.000189 47 22 7 197 3 alg1 Chitobiosyldiphosphodolichol beta-mannosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8CWR6 0.000231 46 21 12 289 1 spr0982 Alpha-monoglucosyldiacylglycerol synthase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8NT41 0.000264 46 29 7 151 1 mgtA GDP-mannose-dependent alpha-mannosyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
D4H6M0 0.000338 46 44 1 50 1 Dacet_2944 Sucrose synthase Denitrovibrio acetiphilus (strain DSM 12809 / NBRC 114555 / N2460)
D7GDZ9 0.00037 45 28 3 115 1 pimA Phosphatidyl-myo-inositol mannosyltransferase Propionibacterium freudenreichii subsp. shermanii (strain ATCC 9614 / DSM 4902 / CIP 103027 / NCIMB 8099 / CIRM-BIA1)
Q7KWM5 0.000404 45 31 3 107 3 alg2 Alpha-1,3/1,6-mannosyltransferase ALG2 Dictyostelium discoideum
Q8L7M0 0.000567 45 26 2 101 2 TUN UDP-glycosyltransferase TURAN Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15620
Feature type CDS
Gene -
Product glycosyltransferase family 4 protein
Location 3470823 - 3471950 (strand: 1)
Length 1128 (nucleotides) / 375 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2452
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00534 Glycosyl transferases group 1
PF13439 Glycosyltransferase Family 4

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0438 Cell wall/membrane/envelope biogenesis (M) M Glycosyltransferase involved in cell wall bisynthesis

Protein Sequence

MSKSVLSILHTESSCGWGGQEIRILTESQGMVQRGHHVTLVCCPNSKIAKAAPDYGIEVVTLPIEKKRGSALMALRNWLKVHRQQFDVINTHSSTDAWLVALSCASLRHSPAIVRTRHVSTDVSRSLPTRWLYLSSSAHIVTTGEKLRQTLHQYNRFPLSQMTSVPTGIDLEKFSPQNKQQAREKIGVPNKPTLGIVATMRVWKGHKYLIEAWKTLHLQFPDWQLLLVGDGPQRKNLQPMVKLAGLEESVFFLGNRNDVPDCLNAMDLFALPSFGNEGVPQGIMQAMACGLPVVSTTVGAISEAVIDGKTGFTLAPQVQETLINYLAKLMASDELRQQMGQASLAHAKAQFGLDNMLDKMEKIFINAISLKDKSR

Flanking regions ( +/- flanking 50bp)

CTCTTTCGTTATACTAGTGCCCTTTTTATCTATCGAGTGAATAGTTGCAGATGAGTAAATCGGTGTTATCTATCTTACATACAGAGTCGTCTTGTGGTTGGGGTGGTCAAGAAATCCGCATTTTGACAGAATCTCAAGGCATGGTGCAAAGAGGGCACCATGTGACACTGGTTTGCTGTCCAAACTCAAAAATTGCCAAAGCAGCCCCTGACTATGGTATTGAGGTTGTCACATTACCGATTGAAAAAAAACGCGGATCTGCACTGATGGCATTGCGTAATTGGTTAAAAGTCCATCGTCAGCAATTTGATGTGATTAATACCCATAGCTCGACAGATGCTTGGTTAGTTGCGCTATCTTGTGCTTCATTACGCCACTCTCCCGCCATAGTACGTACTCGCCATGTATCTACCGATGTATCACGTTCACTGCCCACGCGTTGGCTCTATCTGTCTTCAAGTGCCCATATTGTCACTACTGGTGAAAAATTACGCCAAACCTTACATCAATATAATCGTTTTCCGCTTAGTCAAATGACCTCAGTTCCTACGGGGATCGATTTAGAAAAATTCTCGCCACAAAATAAACAGCAAGCACGAGAAAAAATAGGTGTGCCTAATAAACCTACATTAGGGATTGTGGCAACAATGCGGGTATGGAAAGGACATAAATACCTAATAGAAGCATGGAAAACATTGCATCTGCAATTTCCTGACTGGCAACTACTTCTCGTCGGAGATGGCCCACAACGTAAAAATTTACAACCAATGGTTAAACTTGCAGGGTTAGAAGAGAGCGTCTTTTTCTTAGGCAACCGCAATGATGTACCGGATTGCTTAAATGCAATGGATTTATTTGCCTTACCCTCTTTTGGTAACGAAGGGGTGCCACAAGGTATTATGCAAGCGATGGCTTGCGGATTACCGGTGGTATCAACCACAGTAGGTGCAATTAGTGAAGCGGTGATTGATGGTAAAACTGGTTTTACATTGGCACCTCAAGTACAAGAAACCCTAATCAATTACCTTGCTAAATTAATGGCCTCTGATGAGTTACGTCAACAAATGGGGCAAGCGTCATTAGCCCATGCCAAAGCTCAGTTTGGTTTAGATAACATGCTAGATAAAATGGAAAAAATATTTATTAACGCCATTAGCCTTAAAGATAAATCACGATAATTGATATCCTATAAAGTCGCTAAGGGCTAATTATCCTGTATCTGATGTTA