Homologs in group_2184

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16145 FBDBKF_16145 63.7 Morganella morganii S1 selB selenocysteine-specific translation elongation factor
EHELCC_16180 EHELCC_16180 63.7 Morganella morganii S2 selB selenocysteine-specific translation elongation factor
NLDBIP_17160 NLDBIP_17160 63.7 Morganella morganii S4 selB selenocysteine-specific translation elongation factor
LHKJJB_17080 LHKJJB_17080 63.7 Morganella morganii S3 selB selenocysteine-specific translation elongation factor
HKOGLL_16760 HKOGLL_16760 63.7 Morganella morganii S5 selB selenocysteine-specific translation elongation factor
F4V73_RS17470 F4V73_RS17470 63.2 Morganella psychrotolerans selB selenocysteine-specific translation elongation factor

Distribution of the homologs in the orthogroup group_2184

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2184

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P14081 0.0 709 56 4 620 1 selB Selenocysteine-specific elongation factor Escherichia coli (strain K12)
P43927 0.0 543 44 8 629 3 selB Selenocysteine-specific elongation factor Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46497 1.08e-84 280 30 8 635 3 selB Selenocysteine-specific elongation factor Desulfomicrobium baculatum
Q46455 1.96e-80 269 30 11 645 1 selB Selenocysteine-specific elongation factor Moorella thermoacetica
O21245 3.58e-32 132 28 12 381 3 TUFA Elongation factor Tu, mitochondrial Reclinomonas americana
A4FPM7 1.48e-31 130 29 14 390 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q47LJ1 5.05e-31 128 30 14 385 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
Q57918 4.65e-30 127 31 8 325 3 selB Selenocysteine-specific elongation factor Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TYP6 4.93e-30 126 33 11 295 3 tuf Elongation factor 1-alpha Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B5ZC31 6.75e-30 125 28 14 379 3 tuf Elongation factor Tu Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
C4ZB99 8.96e-30 125 31 9 309 3 tuf Elongation factor Tu Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A6Q1L5 1.21e-29 124 28 13 387 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
P50068 1.46e-29 124 28 14 379 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG3 1.46e-29 124 28 14 379 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A7GZK6 2.8e-29 123 30 14 388 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
Q73PN3 6.14e-29 122 28 15 387 3 tuf Elongation factor Tu Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P40175 6.38e-29 122 31 8 295 3 tuf3 Elongation factor Tu-3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O83217 6.62e-29 122 29 15 386 3 tuf Elongation factor Tu Treponema pallidum (strain Nichols)
A9BCK0 7.61e-29 122 28 13 387 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
Q3A9R3 1.13e-28 122 28 16 393 3 tuf1 Elongation factor Tu 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B9MQH1 1.25e-28 121 28 15 391 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q3A9P8 1.25e-28 121 28 16 393 3 tuf2 Elongation factor Tu 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7I3U7 1.37e-28 121 29 14 378 3 tuf Elongation factor Tu Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
P42471 1.43e-28 121 29 13 385 3 tuf Elongation factor Tu Brevibacterium linens
A4XI37 1.88e-28 121 28 15 391 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
P13927 2.46e-28 120 27 13 382 3 tuf Elongation factor Tu Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P95724 2.53e-28 120 27 13 390 3 tuf Elongation factor Tu Streptomyces cinnamoneus
Q6L202 2.72e-28 121 29 7 300 3 tuf Elongation factor 1-alpha Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q83ES6 2.98e-28 120 29 15 387 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 2.98e-28 120 29 15 387 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 2.98e-28 120 29 15 387 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
Q826Z7 2.99e-28 120 32 7 292 3 tuf2 Elongation factor Tu 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9WSW5 3.1e-28 120 28 16 389 3 tuf Elongation factor Tu Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q1AU14 3.11e-28 120 29 13 369 3 tuf1 Elongation factor Tu Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A2C4U5 3.5e-28 120 28 10 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL1A)
Q5YPG4 4.8e-28 120 28 14 385 3 tuf Elongation factor Tu Nocardia farcinica (strain IFM 10152)
C4K4F8 4.88e-28 119 29 13 381 3 tuf Elongation factor Tu Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A0RQJ3 5.52e-28 119 28 13 393 3 tuf Elongation factor Tu Campylobacter fetus subsp. fetus (strain 82-40)
Q5GRY3 7.3e-28 119 30 11 338 3 tuf2 Elongation factor Tu 2 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q7VA05 7.33e-28 119 27 14 390 3 tuf Elongation factor Tu Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
C4Z2R9 8.19e-28 119 30 9 320 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A8LC58 8.43e-28 119 29 14 388 3 tuf Elongation factor Tu Parafrankia sp. (strain EAN1pec)
P23568 8.94e-28 119 27 13 382 1 tuf Elongation factor Tu Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5GSU2 9.02e-28 119 30 11 338 3 tuf1 Elongation factor Tu 1 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q46IW4 9.46e-28 119 28 10 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL2A)
B9L7I8 9.73e-28 119 29 14 394 3 tuf Elongation factor Tu Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
P02991 1.05e-27 119 28 13 400 1 tufA Elongation factor Tu, chloroplastic Euglena gracilis
Q9TKZ5 1.08e-27 119 28 14 399 3 tufA Elongation factor Tu, chloroplastic Nephroselmis olivacea
Q8R7T8 1.36e-27 118 29 16 393 3 tufB Elongation factor Tu-B Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
C5D3R5 1.68e-27 118 29 14 383 3 tuf Elongation factor Tu Geobacillus sp. (strain WCH70)
A0LRL8 1.97e-27 118 27 12 385 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B2GIL2 2.37e-27 117 28 17 388 3 tuf Elongation factor Tu Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
P72231 2.45e-27 117 28 13 387 3 tuf Elongation factor Tu Planobispora rosea
Q6YQV8 3e-27 117 28 13 381 3 tuf Elongation factor Tu Onion yellows phytoplasma (strain OY-M)
Q7U4D1 3.23e-27 117 27 13 387 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
A0JZ88 3.52e-27 117 28 16 388 3 tuf Elongation factor Tu Arthrobacter sp. (strain FB24)
A8Z5T8 4e-27 117 28 12 384 3 tuf Elongation factor Tu Karelsulcia muelleri (strain GWSS)
A1T4L6 4.22e-27 117 28 14 385 3 tuf Elongation factor Tu Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q2EEV7 4.8e-27 117 28 13 399 3 tufA Elongation factor Tu, plastid Helicosporidium sp. subsp. Simulium jonesii
A2BYN4 4.84e-27 117 28 9 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9515)
B9DKV8 5.21e-27 117 29 14 383 3 tuf Elongation factor Tu Staphylococcus carnosus (strain TM300)
Q1ACI3 5.45e-27 117 30 8 300 3 tufA Elongation factor Tu, chloroplastic Chara vulgaris
Q2NJ20 5.64e-27 116 28 13 381 3 tuf Elongation factor Tu Aster yellows witches'-broom phytoplasma (strain AYWB)
Q318N5 5.74e-27 117 27 14 390 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9312)
Q6MU81 5.83e-27 116 28 15 392 3 tuf Elongation factor Tu Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2SSW8 5.83e-27 116 28 15 392 3 tuf Elongation factor Tu Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A4T1R2 6.63e-27 116 27 14 385 3 tuf Elongation factor Tu Mycolicibacterium gilvum (strain PYR-GCK)
Q2JFH8 7.12e-27 116 28 16 388 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
P29542 7.6e-27 116 27 13 385 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
Q5FKR8 7.93e-27 116 28 15 383 3 tuf Elongation factor Tu Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8R7V2 9.67e-27 116 29 16 393 3 tufA Elongation factor Tu-A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A1R8U9 9.94e-27 116 27 16 391 3 tuf Elongation factor Tu Paenarthrobacter aurescens (strain TC1)
Q6F0J5 1e-26 115 27 14 388 3 tuf Elongation factor Tu Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q0BUQ2 1e-26 116 27 14 384 3 tuf Elongation factor Tu Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A7HWP7 1.01e-26 116 27 14 387 3 tuf1 Elongation factor Tu Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A7ZCN0 1.03e-26 116 28 15 398 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
B8HD11 1.12e-26 115 28 16 388 3 tuf Elongation factor Tu Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q5WLR4 1.16e-26 115 28 13 387 3 tuf Elongation factor Tu Shouchella clausii (strain KSM-K16)
A4IJI7 1.16e-26 115 29 14 383 3 tuf Elongation factor Tu Geobacillus thermodenitrificans (strain NG80-2)
A5CW32 1.23e-26 115 28 14 385 3 tuf1 Elongation factor Tu Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C1AYS3 1.25e-26 115 27 13 389 3 tuf Elongation factor Tu Rhodococcus opacus (strain B4)
Q0SFF4 1.25e-26 115 27 13 389 3 tuf Elongation factor Tu Rhodococcus jostii (strain RHA1)
Q8CQ81 1.28e-26 115 29 14 382 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK4 1.28e-26 115 29 14 382 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A2CC87 1.29e-26 115 27 13 389 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
Q4L3K9 1.41e-26 115 29 14 382 3 tuf Elongation factor Tu Staphylococcus haemolyticus (strain JCSC1435)
P49411 1.41e-26 116 29 15 382 1 TUFM Elongation factor Tu, mitochondrial Homo sapiens
Q979T1 1.43e-26 116 25 12 420 3 tuf Elongation factor 1-alpha Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
B1LBP2 1.46e-26 115 27 14 388 3 tuf Elongation factor Tu Thermotoga sp. (strain RQ2)
A5IM81 1.46e-26 115 27 14 388 3 tuf Elongation factor Tu Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B5Z8K3 1.5e-26 115 27 13 393 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
Q5L3Z9 1.53e-26 115 29 14 383 3 tuf Elongation factor Tu Geobacillus kaustophilus (strain HTA426)
Q6MDN0 1.65e-26 115 28 13 386 3 tuf Elongation factor Tu Protochlamydia amoebophila (strain UWE25)
P33165 1.67e-26 115 28 13 382 3 tuf Elongation factor Tu Bacteroides fragilis (strain YCH46)
Q5L890 1.67e-26 115 28 13 382 3 tuf Elongation factor Tu Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q06SH3 1.71e-26 115 29 11 342 3 tufA Elongation factor Tu, chloroplastic Stigeoclonium helveticum
B6JN44 1.71e-26 115 27 13 393 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
A3PEZ7 1.74e-26 115 26 12 387 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9301)
Q5FTY1 1.83e-26 115 28 14 387 3 tuf Elongation factor Tu Gluconobacter oxydans (strain 621H)
A8G708 1.84e-26 115 26 12 387 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9215)
A0QS98 1.89e-26 115 27 14 385 1 tuf Elongation factor Tu Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q5NQ65 1.91e-26 115 28 11 344 3 tuf Elongation factor Tu Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q7V500 2.02e-26 115 27 13 387 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9313)
B2UUW8 2.1e-26 115 27 13 393 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
A5GIP0 2.14e-26 115 27 12 387 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
Q73IX6 2.15e-26 115 28 13 380 3 tuf1 Elongation factor Tu 1 Wolbachia pipientis wMel
A1SNN5 2.22e-26 115 27 13 385 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
A2BT83 2.24e-26 115 26 12 387 3 tuf Elongation factor Tu Prochlorococcus marinus (strain AS9601)
Q73H85 2.29e-26 115 28 13 380 3 tuf2 Elongation factor Tu 2 Wolbachia pipientis wMel
Q1BDD3 2.52e-26 115 26 14 390 3 tuf Elongation factor Tu Mycobacterium sp. (strain MCS)
A1UBL1 2.52e-26 115 26 14 390 3 tuf Elongation factor Tu Mycobacterium sp. (strain KMS)
A3PV96 2.52e-26 115 26 14 390 3 tuf Elongation factor Tu Mycobacterium sp. (strain JLS)
A8YUS2 2.93e-26 114 28 15 383 3 tuf Elongation factor Tu Lactobacillus helveticus (strain DPC 4571)
Q1RHL9 2.97e-26 114 29 10 336 3 tuf Elongation factor Tu Rickettsia bellii (strain RML369-C)
A8GVB2 2.97e-26 114 29 10 336 3 tuf Elongation factor Tu Rickettsia bellii (strain OSU 85-389)
Q0RRS3 3.27e-26 114 29 16 388 3 tuf Elongation factor Tu Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A6LPP6 3.52e-26 114 28 13 385 3 tuf1 Elongation factor Tu Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q2S1P8 4e-26 114 26 11 371 3 tuf1 Elongation factor Tu Salinibacter ruber (strain DSM 13855 / M31)
O50306 4.02e-26 114 29 14 383 3 tuf Elongation factor Tu Geobacillus stearothermophilus
A8F2E9 4.35e-26 114 27 14 389 3 tuf Elongation factor Tu Rickettsia massiliae (strain Mtu5)
B9KFF9 4.37e-26 114 27 13 393 3 tuf Elongation factor Tu Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
P50371 4.38e-26 114 30 8 300 3 tufA Elongation factor Tu, chloroplastic Chara connivens
B6YQ04 4.46e-26 114 28 14 388 3 tuf Elongation factor Tu Azobacteroides pseudotrichonymphae genomovar. CFP2
Q042T5 4.87e-26 114 27 15 383 3 tuf Elongation factor Tu Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B9E8Q0 4.99e-26 114 28 14 387 3 tuf Elongation factor Tu Macrococcus caseolyticus (strain JCSC5402)
Q0AUH8 5.2e-26 114 28 15 398 3 tuf1 Elongation factor Tu 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q7VJ74 5.27e-26 114 28 14 388 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
P56292 5.66e-26 114 27 13 397 3 tufA Elongation factor Tu, chloroplastic Chlorella vulgaris
A5EX84 5.66e-26 114 28 15 385 3 tuf Elongation factor Tu Dichelobacter nodosus (strain VCS1703A)
A8GPF2 5.96e-26 114 27 14 388 3 tuf Elongation factor Tu Rickettsia akari (strain Hartford)
Q04B37 6.52e-26 113 27 15 389 3 tuf Elongation factor Tu Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAQ0 6.52e-26 113 27 15 389 3 tuf Elongation factor Tu Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P85834 6.94e-26 114 27 14 375 1 Tufm Elongation factor Tu, mitochondrial Rattus norvegicus
P42478 7.32e-26 113 28 14 352 3 tuf Elongation factor Tu (Fragment) Spirochaeta aurantia
Q73SD1 8.01e-26 113 27 13 387 3 tuf Elongation factor Tu Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QL35 8.01e-26 113 27 13 387 3 tuf Elongation factor Tu Mycobacterium avium (strain 104)
P56003 8.59e-26 113 27 14 394 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
P60338 8.6e-26 113 26 13 393 1 tufA Elongation factor Tu-A Thermus thermophilus
Q5SHN6 8.6e-26 113 26 13 393 1 tufA Elongation factor Tu-A Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q0AUG3 8.63e-26 113 28 15 398 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P60339 8.68e-26 113 26 13 393 1 tufB Elongation factor Tu-B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q8KT97 8.88e-26 113 27 14 389 3 tuf Elongation factor Tu Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3J8Q0 9.4e-26 113 28 15 387 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q9MUP0 9.59e-26 113 31 10 300 3 tufA Elongation factor Tu, chloroplastic Mesostigma viride
P29544 9.98e-26 113 30 6 291 3 tuf3 Elongation factor Tu-3 Streptomyces ramocissimus
Q5HVZ7 1.02e-25 113 28 10 343 3 tuf Elongation factor Tu Campylobacter jejuni (strain RM1221)
A1VYI6 1.02e-25 113 28 10 343 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
O69303 1.02e-25 113 28 10 343 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4R3 1.02e-25 113 28 10 343 3 tuf Elongation factor Tu Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKQ5 1.02e-25 113 28 10 343 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q8EX18 1.05e-25 113 26 13 388 3 tuf Elongation factor Tu Malacoplasma penetrans (strain HF-2)
P18906 1.13e-25 112 27 10 353 3 tuf Elongation factor Tu Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A9BHA7 1.21e-25 112 27 14 399 3 tuf Elongation factor Tu Petrotoga mobilis (strain DSM 10674 / SJ95)
A9H3R7 1.22e-25 112 28 15 388 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q6A6L7 1.27e-25 112 27 13 385 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q2W2H3 1.28e-25 112 27 14 384 3 tuf1 Elongation factor Tu Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P49410 1.34e-25 113 28 15 387 1 TUFM Elongation factor Tu, mitochondrial Bos taurus
Q2RFP5 1.35e-25 112 27 15 392 3 tuf Elongation factor Tu Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
C6A4R7 1.41e-25 113 31 9 295 3 tuf Elongation factor 1-alpha Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q01698 1.44e-25 112 26 13 393 1 tuf Elongation factor Tu Thermus aquaticus
A5DN78 1.46e-25 113 30 8 300 3 TUF1 Elongation factor Tu, mitochondrial Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q7UZY7 1.49e-25 112 27 14 390 3 tuf Elongation factor Tu Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8ETY4 1.52e-25 112 28 14 387 3 tuf Elongation factor Tu Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8BFR5 1.54e-25 113 27 14 375 1 Tufm Elongation factor Tu, mitochondrial Mus musculus
A5GW14 1.58e-25 112 27 14 390 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
P48865 1.59e-25 112 27 15 387 3 tuf Elongation factor Tu Rickettsia prowazekii (strain Madrid E)
A8EZL8 1.81e-25 112 27 14 389 3 tuf Elongation factor Tu Rickettsia canadensis (strain McKiel)
Q74JU6 1.85e-25 112 27 16 384 3 tuf Elongation factor Tu Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A1WVD6 1.85e-25 112 27 14 383 3 tuf2 Elongation factor Tu 2 Halorhodospira halophila (strain DSM 244 / SL1)
A1AVJ8 1.9e-25 112 27 13 383 3 tuf1 Elongation factor Tu 1 Ruthia magnifica subsp. Calyptogena magnifica
Q3AMT6 1.96e-25 112 26 13 387 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
Q49V58 2.06e-25 112 28 14 387 3 tuf Elongation factor Tu Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q82DQ0 2.07e-25 112 27 13 390 3 tuf1 Elongation factor Tu 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q67JU1 2.09e-25 112 29 13 385 3 tuf Elongation factor Tu Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C5C0J3 2.1e-25 112 28 15 388 3 tuf Elongation factor Tu Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
P40174 2.13e-25 112 27 13 390 3 tuf1 Elongation factor Tu-1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P09953 2.25e-25 112 27 16 390 3 tuf Elongation factor Tu Micrococcus luteus
P33167 2.25e-25 112 28 15 386 3 tuf Elongation factor Tu Burkholderia cepacia
A5IYA9 2.29e-25 112 27 9 310 3 tuf Elongation factor Tu Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q6N4Q4 2.35e-25 112 27 15 390 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A5D5I8 2.42e-25 112 28 13 346 3 tuf2 Elongation factor Tu 2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
P09591 2.45e-25 112 28 16 387 1 tufA Elongation factor Tu Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T82 2.45e-25 112 28 16 387 1 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UZH4 2.45e-25 112 28 16 387 3 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain PA7)
Q8KT95 2.47e-25 112 27 15 387 3 tuf Elongation factor Tu Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A1WVC4 2.49e-25 112 27 14 383 3 tuf1 Elongation factor Tu 1 Halorhodospira halophila (strain DSM 244 / SL1)
A5D5K0 2.51e-25 112 28 13 346 3 tuf1 Elongation factor Tu 1 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3SSW8 2.54e-25 112 27 13 390 3 tuf Elongation factor Tu Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q92GW4 2.54e-25 112 27 14 389 3 tuf Elongation factor Tu Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B7J241 2.54e-25 112 27 12 385 3 tuf Elongation factor Tu Borreliella burgdorferi (strain ZS7)
P50062 2.54e-25 112 27 12 385 3 tuf Elongation factor Tu Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8KTA3 2.66e-25 112 27 14 387 3 tuf Elongation factor Tu Rickettsia rhipicephali
A8GT71 2.79e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Sheila Smith)
B0BUR2 2.79e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Iowa)
C4K2I2 2.79e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia peacockii (strain Rustic)
C3PPA9 2.79e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia africae (strain ESF-5)
Q53871 2.82e-25 112 27 13 390 3 tuf1 Elongation factor Tu-1 Streptomyces collinus
P13537 2.83e-25 112 26 13 387 3 tuf Elongation factor Tu Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P14634 2.9e-25 112 26 14 402 3 tufA Elongation factor Tu, plastid Euglena longa
Q72GW4 3.01e-25 112 26 13 393 3 tuf1 Elongation factor Tu Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A6Q6H4 3.08e-25 111 28 16 396 3 tuf Elongation factor Tu Sulfurovum sp. (strain NBC37-1)
P9WNN1 3.12e-25 111 27 13 384 1 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN0 3.12e-25 111 27 13 384 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U071 3.12e-25 111 27 13 384 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AL18 3.12e-25 111 27 13 384 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KGG5 3.12e-25 111 27 13 384 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A559 3.12e-25 111 27 13 384 3 tuf Elongation factor Tu Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q65PA9 3.18e-25 111 28 13 387 3 tuf Elongation factor Tu Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A6YG72 3.22e-25 112 27 13 398 3 tufA Elongation factor Tu, chloroplastic Pleurastrum terricola
A8EW02 3.26e-25 111 27 14 392 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
P0A3B0 3.27e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia sibirica
P0A3A9 3.27e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia rickettsii
Q1BRT3 3.3e-25 111 28 15 386 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 3.3e-25 111 28 15 386 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 3.3e-25 111 28 15 386 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 3.3e-25 111 28 15 386 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
A4XBP8 3.47e-25 111 28 13 389 3 tuf Elongation factor Tu Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q8KT99 3.52e-25 111 27 14 389 3 tuf Elongation factor Tu Rickettsia helvetica
Q0SN31 3.62e-25 111 27 12 385 3 tuf Elongation factor Tu Borreliella afzelii (strain PKo)
Q661E5 3.66e-25 111 27 12 385 3 tuf Elongation factor Tu Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A4JAM5 3.69e-25 111 28 15 386 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9WFP3 3.73e-25 111 28 14 388 3 tuf1 Elongation factor Tu Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B1MGH7 3.74e-25 111 28 14 389 3 tuf Elongation factor Tu Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A9NEN4 3.81e-25 111 28 13 384 3 tuf Elongation factor Tu Acholeplasma laidlawii (strain PG-8A)
P50064 3.84e-25 111 27 13 399 3 tufA Elongation factor Tu Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P42480 3.96e-25 111 28 10 343 3 tuf Elongation factor Tu Hymenobacter ocellatus
A5V604 4.01e-25 111 28 15 388 3 tuf Elongation factor Tu Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A1AX82 4.13e-25 111 27 13 383 3 tuf2 Elongation factor Tu 2 Ruthia magnifica subsp. Calyptogena magnifica
Q4A597 4.41e-25 111 30 8 289 3 tuf Elongation factor Tu Mycoplasmopsis synoviae (strain 53)
P19486 4.54e-25 111 28 8 296 3 tuf Elongation factor 1-alpha Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
A6MW28 4.59e-25 111 28 12 363 3 tufA Elongation factor Tu, chloroplastic Rhodomonas salina
A7NR65 6.35e-25 110 27 13 391 3 tuf1 Elongation factor Tu 1 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q1IHG6 6.38e-25 110 27 14 385 3 tuf1 Elongation factor Tu Koribacter versatilis (strain Ellin345)
P64029 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain MW2)
A8YZP5 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBT9 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain MSSA476)
Q6GJC0 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain MRSA252)
P99152 6.41e-25 110 28 14 382 1 tuf Elongation factor Tu Staphylococcus aureus (strain N315)
P64028 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEK0 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain Newman)
Q5HIC7 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain COL)
Q2YSB3 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQA2 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH9)
Q2G0N0 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ92 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300)
A6TZ25 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH1)
A7WYX6 6.41e-25 110 28 14 382 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q1H4Q1 6.59e-25 110 28 14 385 3 tuf1 Elongation factor Tu 1 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P26751 6.87e-25 111 31 9 295 3 tuf Elongation factor 1-alpha Pyrococcus woesei
B2S0H9 6.91e-25 110 27 12 385 3 tuf Elongation factor Tu Borrelia hermsii (strain HS1 / DAH)
Q13TF5 7.3e-25 110 28 15 386 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
Q9TMM9 7.38e-25 110 31 12 349 3 tufA Elongation factor Tu, apicoplast Toxoplasma gondii
Q9V0V7 8.01e-25 110 31 9 295 3 tuf Elongation factor 1-alpha Pyrococcus abyssi (strain GE5 / Orsay)
B7GJ65 8.76e-25 110 28 13 383 3 tuf Elongation factor Tu Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q8U152 8.87e-25 110 31 9 295 3 tuf Elongation factor 1-alpha Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q3A6R2 9.16e-25 110 27 14 387 3 tuf1 Elongation factor Tu 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q9ZK19 9.33e-25 110 27 13 393 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
Q85FT7 9.35e-25 110 29 14 361 3 tufA Elongation factor Tu, chloroplastic Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q6ACZ0 9.43e-25 110 28 16 389 3 tuf Elongation factor Tu Leifsonia xyli subsp. xyli (strain CTCB07)
Q98QG1 1.02e-24 110 26 14 384 3 tuf Elongation factor Tu Mycoplasmopsis pulmonis (strain UAB CTIP)
A1QZR2 1.04e-24 110 27 12 385 3 tuf Elongation factor Tu Borrelia turicatae (strain 91E135)
Q7VRP0 1.07e-24 110 29 12 381 3 tuf Elongation factor Tu Blochmanniella floridana
B4S5M9 1.09e-24 110 28 13 384 3 tuf Elongation factor Tu Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q6KI66 1.12e-24 110 26 14 388 3 tuf Elongation factor Tu Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
A5FZW7 1.16e-24 110 28 12 365 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
Q839G8 1.19e-24 110 28 13 383 3 tuf Elongation factor Tu Enterococcus faecalis (strain ATCC 700802 / V583)
B5RPI0 1.29e-24 109 27 12 385 3 tuf Elongation factor Tu Borrelia recurrentis (strain A1)
B5RM34 1.29e-24 109 27 12 385 3 tuf Elongation factor Tu Borrelia duttonii (strain Ly)
A6LLL1 1.35e-24 109 28 7 293 3 tuf Elongation factor Tu Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q97EH5 1.36e-24 109 28 15 389 3 tuf Elongation factor Tu Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q83NT9 1.4e-24 109 27 15 390 3 tuf Elongation factor Tu Tropheryma whipplei (strain TW08/27)
Q1LSY4 1.41e-24 109 28 11 352 3 tuf Elongation factor Tu Baumannia cicadellinicola subsp. Homalodisca coagulata
A3DJ00 1.41e-24 109 28 16 389 3 tuf Elongation factor Tu Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B8DLL9 1.42e-24 109 29 13 386 3 tuf Elongation factor Tu Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B3QY22 1.43e-24 109 25 12 385 3 tuf Elongation factor Tu Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B7JUP5 1.47e-24 110 26 13 397 3 tuf Elongation factor Tu Rippkaea orientalis (strain PCC 8801 / RF-1)
Q2N9A8 1.53e-24 109 29 15 369 3 tuf Elongation factor Tu Erythrobacter litoralis (strain HTCC2594)
O59153 1.59e-24 110 31 9 295 1 tuf Elongation factor 1-alpha Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P42479 1.6e-24 109 28 13 347 3 tuf Elongation factor Tu Stigmatella aurantiaca
C6C171 1.64e-24 109 27 12 385 3 tuf Elongation factor Tu Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q0ANN1 1.65e-24 109 28 14 391 3 tuf1 Elongation factor Tu Maricaulis maris (strain MCS10)
A6W5T5 1.68e-24 109 28 14 389 3 tuf Elongation factor Tu Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q07KJ2 1.71e-24 109 27 15 387 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
A8M531 1.75e-24 109 28 13 389 3 tuf Elongation factor Tu Salinispora arenicola (strain CNS-205)
A5N4N1 1.75e-24 109 28 14 386 3 tuf1 Elongation factor Tu Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q1H4N9 1.79e-24 109 28 14 385 3 tuf2 Elongation factor Tu 2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q3J5S4 1.82e-24 109 27 14 385 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGI1 1.82e-24 109 27 14 385 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0RB36 1.88e-24 109 28 15 388 3 tuf Elongation factor Tu Clavibacter sepedonicus
Q9Z9L6 1.89e-24 109 27 14 394 3 tuf Elongation factor Tu Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P42482 1.9e-24 109 27 13 393 3 tuf Elongation factor Tu Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q981F7 2e-24 109 27 13 383 3 tufA Elongation factor Tu Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1A0T1 2.02e-24 109 28 13 355 3 tuf Elongation factor Tu Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q83GW1 2.07e-24 109 28 16 392 3 tuf Elongation factor Tu Tropheryma whipplei (strain Twist)
B2UQY9 2.16e-24 109 27 13 381 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q18EY5 2.33e-24 109 28 8 305 3 tuf Elongation factor 1-alpha Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B8GIQ3 2.34e-24 109 29 8 301 3 tuf Elongation factor 1-alpha Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q039K9 2.43e-24 108 29 13 340 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 2.43e-24 108 29 13 340 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
Q05FI3 2.52e-24 108 27 10 340 3 tuf Elongation factor Tu Carsonella ruddii (strain PV)
A9ISD9 2.52e-24 108 27 16 385 3 tuf1 Elongation factor Tu Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q8A463 2.53e-24 108 28 13 382 3 tuf Elongation factor Tu Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q605B0 2.57e-24 108 27 14 388 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
O33594 2.61e-24 108 27 13 385 3 tuf1 Elongation factor Tu Kitasatospora aureofaciens
Q1QN32 2.65e-24 108 27 16 391 3 tuf Elongation factor Tu Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q134R0 2.7e-24 108 27 15 387 3 tuf2 Elongation factor Tu 2 Rhodopseudomonas palustris (strain BisB5)
Q3A6P9 2.8e-24 108 27 14 387 3 tuf2 Elongation factor Tu 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q20EU5 3.19e-24 108 27 14 398 3 tufA Elongation factor Tu, chloroplastic Oltmannsiellopsis viridis
Q5GWR8 3.25e-24 108 28 14 385 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 3.25e-24 108 28 14 385 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2L2G6 3.28e-24 108 26 13 389 3 tuf1 Elongation factor Tu Bordetella avium (strain 197N)
A6KYK9 3.41e-24 108 28 12 381 3 tuf Elongation factor Tu Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q2YAZ9 3.44e-24 108 28 14 384 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A4W5A0 3.51e-24 108 28 12 383 3 tuf1 Elongation factor Tu Enterobacter sp. (strain 638)
A6X0A2 3.7e-24 108 28 13 386 3 tuf1 Elongation factor Tu Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q211E6 3.84e-24 108 27 15 390 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
Q134S7 3.84e-24 108 27 15 387 3 tuf1 Elongation factor Tu 1 Rhodopseudomonas palustris (strain BisB5)
A0PM42 4.34e-24 108 27 13 387 3 tuf Elongation factor Tu Mycobacterium ulcerans (strain Agy99)
B2HSL3 4.34e-24 108 27 13 387 3 tuf Elongation factor Tu Mycobacterium marinum (strain ATCC BAA-535 / M)
A1B002 4.46e-24 108 27 14 382 3 tuf1 Elongation factor Tu Paracoccus denitrificans (strain Pd 1222)
Q1D7V1 4.5e-24 108 28 16 386 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
Q1D776 4.55e-24 108 28 16 386 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
B8DAY7 4.57e-24 108 27 12 383 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4a (strain HCC23)
Q927I6 4.57e-24 108 27 12 383 3 tuf Elongation factor Tu Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1JIH3 4.64e-24 108 28 13 383 3 tuf1 Elongation factor Tu 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WVL0 4.85e-24 108 27 14 385 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q4MYA4 4.91e-24 108 27 10 350 3 tufA Elongation factor Tu, apicoplast Theileria parva
A0ALY8 5.26e-24 108 27 12 383 3 tuf Elongation factor Tu Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y422 5.26e-24 108 27 12 383 1 tuf Elongation factor Tu Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WB9 5.26e-24 108 27 12 383 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain F2365)
C1KZK6 5.26e-24 108 27 12 383 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain CLIP80459)
A5CCL4 5.39e-24 108 27 10 339 3 tuf2 Elongation factor Tu 2 Orientia tsutsugamushi (strain Boryong)
O50340 5.43e-24 108 27 14 392 3 tuf Elongation factor Tu Fervidobacterium islandicum
Q118Z2 5.55e-24 108 28 13 359 3 tuf Elongation factor Tu Trichodesmium erythraeum (strain IMS101)
Q9TJQ8 5.55e-24 108 28 7 299 3 tufA Elongation factor Tu, plastid Prototheca wickerhamii
Q0P3M7 5.76e-24 108 25 14 402 3 tufA Elongation factor Tu, chloroplastic Ostreococcus tauri
A5CCA0 5.8e-24 107 27 10 339 3 tuf1 Elongation factor Tu 1 Orientia tsutsugamushi (strain Boryong)
B9K884 5.82e-24 108 26 14 388 1 tuf Elongation factor Tu Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q2G8Y2 5.9e-24 107 27 14 385 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q1GDV0 5.95e-24 107 28 14 385 3 tuf1 Elongation factor Tu Ruegeria sp. (strain TM1040)
P42481 6.01e-24 107 27 14 384 3 tuf Elongation factor Tu Thiomonas delicata
Q7TT91 6.6e-24 107 27 13 383 3 tuf1 Elongation factor Tu Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q79GC6 6.6e-24 107 27 13 383 3 tuf1 Elongation factor Tu Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q79G84 6.6e-24 107 27 13 383 3 tuf1 Elongation factor Tu Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P17197 6.99e-24 108 30 9 295 3 tuf Elongation factor 1-alpha Thermococcus celer
Q33451 7.01e-24 107 27 12 380 3 tufA Elongation factor Tu, apicoplast Eimeria tenella
P42472 7.45e-24 107 27 14 384 3 tuf Elongation factor Tu (Fragment) Chloroflexus aurantiacus
A8F4Q9 7.59e-24 107 27 10 342 3 tuf Elongation factor Tu Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A6TEX7 7.96e-24 107 29 13 387 3 tufA Elongation factor Tu Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C0Q9Y7 7.97e-24 107 26 12 384 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B7GU46 8.18e-24 107 28 12 350 3 tuf Elongation factor Tu Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B8I5N8 8.21e-24 107 28 15 386 3 tuf Elongation factor Tu Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q250N4 8.92e-24 107 27 14 396 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain Y51)
B8G1W4 8.92e-24 107 27 14 396 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B6JET1 8.97e-24 107 28 16 391 3 tuf Elongation factor Tu Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B7IHU4 9.09e-24 107 29 9 294 3 tuf Elongation factor Tu Thermosipho africanus (strain TCF52B)
A8LLG2 9.23e-24 107 28 14 385 3 tuf1 Elongation factor Tu Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B0CCD0 9.34e-24 107 27 12 358 3 tuf Elongation factor Tu Acaryochloris marina (strain MBIC 11017)
A1JS52 1.04e-23 107 29 15 384 3 tuf2 Elongation factor Tu 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P22679 1.04e-23 107 27 16 389 1 tuf Elongation factor Tu Metamycoplasma hominis (strain ATCC 23114 / DSM 25592 / NBRC 14850 / NCTC 10111 / PG21)
P30768 1.05e-23 107 27 13 387 3 tuf Elongation factor Tu Mycobacterium leprae (strain TN)
B8ZSC1 1.05e-23 107 27 13 387 3 tuf Elongation factor Tu Mycobacterium leprae (strain Br4923)
Q664R7 1.07e-23 107 28 13 384 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCT9 1.07e-23 107 28 13 384 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FNN8 1.07e-23 107 28 13 384 3 tuf2 Elongation factor Tu 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TGY7 1.07e-23 107 28 13 384 3 tuf1 Elongation factor Tu 1 Yersinia pestis (strain Pestoides F)
Q8ZJB2 1.07e-23 107 28 13 384 3 tufA Elongation factor Tu-A Yersinia pestis
Q1C2U1 1.07e-23 107 28 13 384 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Antiqua)
A8HTW6 1.08e-23 107 26 13 396 3 tuf1 Elongation factor Tu Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B3ETZ7 1.23e-23 107 26 10 343 3 tuf Elongation factor Tu Amoebophilus asiaticus (strain 5a2)
A4TS36 1.23e-23 107 28 13 381 3 tuf2 Elongation factor Tu 2 Yersinia pestis (strain Pestoides F)
Q8ZAN8 1.23e-23 107 28 13 381 3 tufB Elongation factor Tu-B Yersinia pestis
Q1C1T4 1.23e-23 107 28 13 381 3 tuf2 Elongation factor Tu 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FQ9 1.23e-23 107 28 13 381 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FNJ0 1.23e-23 107 28 13 381 3 tuf1 Elongation factor Tu 1 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8D240 1.29e-23 107 28 14 382 3 tuf Elongation factor Tu Wigglesworthia glossinidia brevipalpis
Q5NID9 1.32e-23 107 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JU2 1.32e-23 107 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain FSC 198)
A7GJ76 1.33e-23 107 28 15 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGF6 1.33e-23 107 28 15 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Okra / Type B1)
A5I7K8 1.33e-23 107 28 15 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ71 1.33e-23 107 28 15 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain ATCC 19397 / Type A)
Q06J54 1.4e-23 107 27 15 398 3 tufA Elongation factor Tu, chloroplastic Bigelowiella natans
Q2IXR2 1.44e-23 106 27 15 387 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain HaA2)
A4IW92 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKB8 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain OSU18)
A0Q874 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. novicida (strain U112)
B2SFC9 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1M0 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain LVS)
A7NEC7 1.51e-23 106 28 14 382 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q9Y700 1.6e-23 107 28 8 303 3 tuf1 Elongation factor Tu, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q21RV6 1.64e-23 106 28 15 384 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21SF0 1.72e-23 106 28 15 384 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A4SHU2 1.84e-23 106 28 13 383 3 tuf1 Elongation factor Tu Aeromonas salmonicida (strain A449)
A0PXT1 1.87e-23 106 27 15 387 3 tuf1 Elongation factor Tu Clostridium novyi (strain NT)
Q8KTA1 1.89e-23 106 26 14 389 3 tuf Elongation factor Tu Rickettsia montanensis
Q1CN86 1.89e-23 106 28 13 381 3 tuf1 Elongation factor Tu 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8KTA6 1.96e-23 106 26 14 389 3 tuf Elongation factor Tu Rickettsia parkeri
A8GKK1 1.96e-23 106 28 12 383 3 tuf2 Elongation factor Tu 2 Serratia proteamaculans (strain 568)
Q1GP97 1.96e-23 106 27 15 394 3 tuf Elongation factor Tu Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P19457 1.99e-23 106 27 11 356 3 tufA Elongation factor Tu, chloroplastic Guillardia theta
B3E156 2.17e-23 106 27 13 381 3 tuf Elongation factor Tu Methylacidiphilum infernorum (isolate V4)
A7NS01 2.18e-23 106 27 13 391 3 tuf2 Elongation factor Tu 2 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A7MKI5 2.22e-23 106 29 14 385 3 tuf1 Elongation factor Tu Cronobacter sakazakii (strain ATCC BAA-894)
Q8G5B7 2.23e-23 106 28 12 350 3 tuf Elongation factor Tu Bifidobacterium longum (strain NCC 2705)
B3DT29 2.23e-23 106 28 12 350 3 tuf Elongation factor Tu Bifidobacterium longum (strain DJO10A)
Q5LMR5 2.25e-23 106 27 14 386 3 tuf1 Elongation factor Tu Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A7Z0N5 2.29e-23 106 27 13 387 3 tuf Elongation factor Tu Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P42474 2.31e-23 106 28 14 386 3 tuf Elongation factor Tu Cellulophaga lytica
P0A1H5 2.34e-23 106 28 13 387 3 tufA Elongation factor Tu Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1H6 2.34e-23 106 28 13 387 3 tufA Elongation factor Tu Salmonella typhi
A9MT05 2.34e-23 106 28 13 387 3 tuf1 Elongation factor Tu Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIW4 2.34e-23 106 28 13 387 3 tuf1 Elongation factor Tu Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H76 2.34e-23 106 28 13 387 3 tuf1 Elongation factor Tu Salmonella choleraesuis (strain SC-B67)
A9MHG0 2.34e-23 106 28 13 387 3 tuf1 Elongation factor Tu Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q2SU25 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 2.38e-23 106 28 15 386 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
Q6CZW6 2.39e-23 106 27 12 383 3 tuf1 Elongation factor Tu Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A2CI56 2.39e-23 106 26 16 402 3 tufA Elongation factor Tu, chloroplastic Chlorokybus atmophyticus
B1KSM7 2.39e-23 106 28 15 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Loch Maree / Type A3)
A9KRZ4 2.55e-23 105 29 8 313 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A7ZUJ2 2.57e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A6N2 2.6e-23 105 28 13 387 3 tufA Elongation factor Tu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A6N3 2.6e-23 105 28 13 387 3 tufA Elongation factor Tu Escherichia coli O157:H7
Q3YV04 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Shigella sonnei (strain Ss046)
Q0SY20 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Shigella flexneri serotype 5b (strain 8401)
Q1R5U4 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain UTI89 / UPEC)
P0CE48 2.6e-23 105 28 13 387 1 tufB Elongation factor Tu 2 Escherichia coli (strain K12)
B1IVA7 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TA85 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AIF3 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli O1:K1 / APEC
A8A779 2.6e-23 105 28 13 387 3 tuf2 Elongation factor Tu 2 Escherichia coli O9:H4 (strain HS)
A7HM54 2.64e-23 105 27 15 390 3 tuf Elongation factor Tu Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q8XGZ0 2.66e-23 105 28 14 385 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q83JC4 2.67e-23 105 28 13 387 3 tufA Elongation factor Tu Shigella flexneri
Q32B27 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu Shigella dysenteriae serotype 1 (strain Sd197)
Q31VV0 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu Shigella boydii serotype 4 (strain Sb227)
Q3YWT3 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Shigella sonnei (strain Ss046)
Q1R5Y2 2.67e-23 105 28 13 387 1 tuf1 Elongation factor Tu 1 Escherichia coli (strain UTI89 / UPEC)
P0CE47 2.67e-23 105 28 13 387 1 tufA Elongation factor Tu 1 Escherichia coli (strain K12)
B1IPW0 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TCC0 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGM6 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Escherichia coli O1:K1 / APEC
A8A5E6 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Escherichia coli O9:H4 (strain HS)
A7ZSL4 2.67e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1LI13 2.71e-23 105 28 14 385 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0SZX8 2.72e-23 105 28 13 387 3 tuf1 Elongation factor Tu 1 Shigella flexneri serotype 5b (strain 8401)
P29543 2.88e-23 105 27 13 385 3 tuf2 Elongation factor Tu-2 Streptomyces ramocissimus
Q2GD83 2.9e-23 106 26 14 418 3 tuf Elongation factor Tu Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A6T3K6 2.95e-23 105 27 15 384 3 tuf1 Elongation factor Tu Janthinobacterium sp. (strain Marseille)
Q6AP86 2.95e-23 105 27 13 385 3 tuf1 Elongation factor Tu 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A5USJ1 3.05e-23 105 27 14 391 3 tuf1 Elongation factor Tu 1 Roseiflexus sp. (strain RS-1)
B6YVG2 3.12e-23 106 30 9 295 3 tuf Elongation factor 1-alpha Thermococcus onnurineus (strain NA1)
Q0K5Z9 3.15e-23 105 27 14 385 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P59506 3.18e-23 105 28 14 386 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89J82 3.2e-23 105 27 14 390 3 tuf Elongation factor Tu Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7TTF9 3.24e-23 105 28 13 381 3 tufA Elongation factor Tu Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0CH34 3.49e-23 105 28 14 381 3 tuf1 Elongation factor Tu Brucella suis (strain ATCC 23445 / NCTC 10510)
P51287 3.58e-23 105 28 12 363 3 tufA Elongation factor Tu, chloroplastic Porphyra purpurea
Q123F6 3.58e-23 105 28 15 386 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q4A7K0 3.61e-23 105 27 15 385 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 7448)
Q600B6 3.61e-23 105 27 15 385 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 232)
Q11Q98 3.88e-23 105 27 11 338 3 tuf Elongation factor Tu Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q4A9G1 3.96e-23 105 26 14 385 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q3ZJ24 4.04e-23 105 26 13 397 3 tufA Elongation factor Tu, chloroplastic Tupiella akineta
P17245 4.07e-23 105 29 12 358 3 tufA Elongation factor Tu, cyanelle Cyanophora paradoxa
A5CUB6 4.13e-23 105 28 15 388 3 tuf Elongation factor Tu Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q8R603 4.25e-23 105 29 15 382 3 tuf Elongation factor Tu Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q057A2 4.33e-23 105 28 12 381 3 tuf Elongation factor Tu Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q6AP73 4.35e-23 105 27 9 340 3 tuf2 Elongation factor Tu 2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P26184 4.39e-23 105 27 12 381 3 tuf Elongation factor Tu Flexistipes sinusarabici
P75022 4.4e-23 105 27 16 386 3 tufA Elongation factor Tu Rhizobium radiobacter
Q1MIE3 4.49e-23 105 28 14 383 3 tuf1 Elongation factor Tu Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8UE16 4.49e-23 105 27 16 386 3 tufA Elongation factor Tu Agrobacterium fabrum (strain C58 / ATCC 33970)
Q11HA6 4.61e-23 105 26 14 385 3 tuf1 Elongation factor Tu Chelativorans sp. (strain BNC1)
Q46WC7 4.73e-23 105 28 14 385 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4VHL6 4.75e-23 105 27 15 387 3 tuf1 Elongation factor Tu 1 Stutzerimonas stutzeri (strain A1501)
B0BQZ3 4.93e-23 105 28 13 381 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N246 4.93e-23 105 28 13 381 3 tuf1 Elongation factor Tu Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A4YSJ0 5.14e-23 105 27 15 391 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain ORS 278)
A5ELM9 5.14e-23 105 27 15 391 3 tuf Elongation factor Tu Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B0TX03 5.21e-23 105 27 14 388 3 tuf Elongation factor Tu Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
P74227 5.34e-23 105 29 7 289 1 tuf Elongation factor Tu Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0TC54 5.4e-23 105 27 11 345 3 tuf Elongation factor Tu Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
O29325 5.84e-23 105 29 8 295 3 tuf Elongation factor 1-alpha Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P64025 5.87e-23 104 27 13 379 3 tufA Elongation factor Tu Brucella suis biovar 1 (strain 1330)
A5VR08 5.87e-23 104 27 13 379 3 tuf1 Elongation factor Tu Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P64024 5.87e-23 104 27 13 379 3 tufA Elongation factor Tu Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M5Q2 5.87e-23 104 27 13 379 3 tuf1 Elongation factor Tu Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YM08 5.87e-23 104 27 13 379 3 tuf1 Elongation factor Tu Brucella abortus (strain 2308)
B1HMZ0 6.06e-23 104 26 12 387 3 tuf Elongation factor Tu Lysinibacillus sphaericus (strain C3-41)
C5CC66 6.37e-23 104 27 13 384 3 tuf Elongation factor Tu Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
P43926 7.01e-23 104 28 12 381 3 tufA Elongation factor Tu Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15370
Feature type CDS
Gene selB
Product selenocysteine-specific translation elongation factor
Location 3414035 - 3415897 (strand: -1)
Length 1863 (nucleotides) / 620 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2184
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF09106 Elongation factor SelB, winged helix
PF09107 Elongation factor SelB, winged helix
PF21214 Selenocysteine-specific elongation factor, winged helix domain
PF21458 Selenocysteine-specific elongation factor, winged helix 1/3

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3276 Translation, ribosomal structure and biogenesis (J) J Selenocysteine-specific translation elongation factor SelB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03833 selenocysteine-specific elongation factor - -

Protein Sequence

MIFATAGHVDHGKTTLIQAITGVDTTHLPEEKKRGMTIDLGYAYWPQTDGSVIGFVDVPGHEKFLSNMLAGIGGISHALLIVACDDGVMAQTIEHTAILRLAGCPNITVILTKADRVEPPRIDEVKQQITTHLLNLGWSAPQIFVTSASTGVGIAPLRDYLVTLHQQEQQHPQWHKRFRLAIDRVFSIKGAGLVVTGTALAGQIALGDTFWLTGADKPVRIRALHAQNQPVEQAGAGMRIAINISGDVSKETVSRGDWLLSQAPLYPSHKILVSLTADESIKHWQPVHIHHGTRHITGRIALLNNTDETPLLAELILDEPLWLVDNDRLILRDISAQRTLAAAKVLCLHSPRRGKRQAEFLSWLSALDKANTVSDNLALYLPKGELLLTQFAWAQQLTETALDTLLTTFDVISISGVVISKANAEQAKAKLLRTLEEYHQQHNDQMGVGRSRLKRMALPTYHDELVYHLIDQLRQEGAIKQTRGWLHLPTHGLAFTAEQEALWQIAKNYFQQSEPWWVRDLAHEMKNDEKVIRGLLRKAAQLGLIIPIIADRYYTHDSIEKFAAIIVKYNETNGSVTAADFRDELAVGRKLAVQILEYFDRTGFTRRKKDLHILRDKGLF

Flanking regions ( +/- flanking 50bp)

GACCTACGTTGTCTTGAGGATGAAAATGCATTAATACAGGCTCTATCACTATGATTTTTGCGACAGCCGGTCACGTAGACCACGGAAAAACAACATTAATACAAGCGATCACCGGTGTAGATACAACTCACTTACCTGAAGAAAAAAAACGCGGTATGACCATCGATTTAGGTTATGCCTATTGGCCACAAACCGATGGATCAGTCATTGGTTTTGTCGATGTCCCCGGTCATGAAAAGTTTCTTTCTAATATGTTGGCCGGTATTGGGGGAATTTCTCACGCCTTATTAATTGTCGCTTGTGATGACGGTGTGATGGCACAAACTATTGAACATACAGCTATCTTACGTCTTGCCGGTTGTCCTAACATCACCGTGATCCTCACCAAAGCAGATCGTGTAGAGCCACCACGTATTGATGAAGTTAAACAGCAGATAACCACACACTTACTTAATCTAGGTTGGTCAGCACCACAAATCTTTGTCACTTCAGCCTCAACTGGCGTAGGTATCGCGCCATTACGAGACTATTTAGTTACCCTACATCAGCAAGAGCAACAACACCCTCAATGGCATAAGCGTTTTCGCTTAGCAATTGATCGTGTATTTAGTATTAAAGGTGCGGGTTTGGTGGTCACAGGTACTGCACTTGCCGGGCAAATTGCGCTAGGTGATACTTTTTGGCTAACCGGTGCAGACAAACCGGTAAGAATTAGGGCATTACATGCGCAAAATCAGCCAGTAGAACAAGCTGGTGCAGGTATGCGCATTGCGATAAATATTAGTGGTGATGTCAGTAAAGAAACGGTTTCTCGTGGTGATTGGTTACTATCACAAGCACCACTTTATCCTTCACACAAAATATTAGTCAGTCTAACAGCTGATGAATCTATTAAACATTGGCAACCGGTTCATATTCATCATGGTACACGCCATATTACAGGACGTATTGCACTATTAAATAATACCGATGAAACACCGCTATTAGCAGAGCTTATTCTTGATGAACCCTTGTGGCTGGTGGATAACGATAGACTAATTTTACGCGATATTAGTGCACAACGAACTTTAGCGGCGGCCAAAGTGCTCTGCTTACACTCTCCTCGTCGGGGTAAACGACAAGCTGAGTTTTTATCTTGGCTAAGTGCACTTGATAAAGCCAACACGGTGAGTGATAACCTCGCACTCTATTTACCCAAAGGTGAATTATTATTGACTCAATTTGCTTGGGCACAGCAACTGACGGAAACCGCACTTGATACGCTATTAACCACCTTTGATGTTATTTCTATTTCCGGCGTCGTCATTTCGAAAGCCAATGCCGAACAGGCTAAAGCAAAACTATTACGCACACTAGAAGAATATCACCAGCAACATAACGATCAAATGGGTGTGGGCCGTTCCCGTTTAAAACGTATGGCTCTTCCCACTTATCACGATGAGCTGGTTTATCACTTAATTGATCAGTTACGCCAAGAAGGTGCTATTAAGCAAACTCGAGGCTGGCTACATCTACCAACACATGGGTTAGCCTTCACAGCAGAGCAAGAGGCACTATGGCAGATTGCCAAAAACTATTTTCAACAATCAGAGCCTTGGTGGGTTCGTGATCTCGCCCATGAAATGAAAAATGATGAAAAAGTCATACGAGGCTTATTACGCAAAGCTGCTCAACTAGGTCTTATTATCCCCATTATTGCCGATCGCTATTATACTCATGATTCGATAGAAAAATTTGCCGCTATCATCGTAAAATATAACGAAACTAACGGCAGTGTAACCGCAGCCGATTTTCGTGATGAACTGGCCGTAGGTCGCAAACTTGCCGTACAAATTCTTGAGTATTTTGACCGAACAGGGTTCACTCGACGTAAAAAAGATCTTCATATCTTACGAGATAAAGGGTTATTCTAACTTAACTGGTTACTCTTTATGATTGGCTGGATATGAGCATTCAGCCAATT