Homologs in group_2149

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16145 FBDBKF_16145 100.0 Morganella morganii S1 selB selenocysteine-specific translation elongation factor
EHELCC_16180 EHELCC_16180 100.0 Morganella morganii S2 selB selenocysteine-specific translation elongation factor
LHKJJB_17080 LHKJJB_17080 100.0 Morganella morganii S3 selB selenocysteine-specific translation elongation factor
HKOGLL_16760 HKOGLL_16760 100.0 Morganella morganii S5 selB selenocysteine-specific translation elongation factor
F4V73_RS17470 F4V73_RS17470 90.5 Morganella psychrotolerans selB selenocysteine-specific translation elongation factor
PMI_RS15370 PMI_RS15370 63.7 Proteus mirabilis HI4320 selB selenocysteine-specific translation elongation factor

Distribution of the homologs in the orthogroup group_2149

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2149

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P14081 0.0 690 56 7 623 1 selB Selenocysteine-specific elongation factor Escherichia coli (strain K12)
P43927 2.56e-171 504 43 8 627 3 selB Selenocysteine-specific elongation factor Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46455 1.22e-90 296 32 9 634 1 selB Selenocysteine-specific elongation factor Moorella thermoacetica
Q46497 5.62e-84 278 30 12 636 3 selB Selenocysteine-specific elongation factor Desulfomicrobium baculatum
Q5HVZ7 2.25e-37 146 31 12 376 3 tuf Elongation factor Tu Campylobacter jejuni (strain RM1221)
A1VYI6 2.25e-37 146 31 12 376 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
O69303 2.25e-37 146 31 12 376 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4R3 2.25e-37 146 31 12 376 3 tuf Elongation factor Tu Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FKQ5 2.25e-37 146 31 12 376 3 tuf Elongation factor Tu Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
B9KFF9 3.06e-36 143 30 12 376 3 tuf Elongation factor Tu Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A7GZK6 1.37e-35 141 29 11 376 3 tuf Elongation factor Tu Campylobacter curvus (strain 525.92)
A7ZCN0 3.23e-35 140 30 12 376 3 tuf Elongation factor Tu Campylobacter concisus (strain 13826)
A0RQJ3 6.39e-35 139 29 12 376 3 tuf Elongation factor Tu Campylobacter fetus subsp. fetus (strain 82-40)
C4ZB99 3.58e-33 134 28 12 390 3 tuf Elongation factor Tu Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q1H4Q1 8.3e-33 133 30 14 372 3 tuf1 Elongation factor Tu 1 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B5Z8K3 2.29e-32 132 28 14 391 3 tuf Elongation factor Tu Helicobacter pylori (strain G27)
Q1H4N9 2.64e-32 132 30 14 372 3 tuf2 Elongation factor Tu 2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q13TF5 2.72e-32 132 30 14 372 3 tuf1 Elongation factor Tu Paraburkholderia xenovorans (strain LB400)
O21245 2.89e-32 132 28 14 376 3 TUFA Elongation factor Tu, mitochondrial Reclinomonas americana
B2UUW8 3.01e-32 132 28 14 391 3 tuf Elongation factor Tu Helicobacter pylori (strain Shi470)
B5ZC31 3.51e-32 132 31 13 339 3 tuf Elongation factor Tu Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q83ES6 3.84e-32 132 30 14 369 1 tufA Elongation factor Tu Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAK7 3.84e-32 132 30 14 369 3 tuf1 Elongation factor Tu Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD33 3.84e-32 132 30 14 369 3 tuf1 Elongation factor Tu Coxiella burnetii (strain Dugway 5J108-111)
B6JN44 4.91e-32 131 28 14 391 3 tuf Elongation factor Tu Helicobacter pylori (strain P12)
Q6YQV8 5.11e-32 131 28 13 376 3 tuf Elongation factor Tu Onion yellows phytoplasma (strain OY-M)
Q2S1P8 5.5e-32 131 32 8 293 3 tuf1 Elongation factor Tu Salinibacter ruber (strain DSM 13855 / M31)
P56003 5.73e-32 131 28 14 391 3 tuf Elongation factor Tu Helicobacter pylori (strain ATCC 700392 / 26695)
Q2NJ20 7.23e-32 130 29 14 373 3 tuf Elongation factor Tu Aster yellows witches'-broom phytoplasma (strain AYWB)
P42481 9.43e-32 130 29 13 373 3 tuf Elongation factor Tu Thiomonas delicata
P50068 9.65e-32 130 31 13 339 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG3 9.65e-32 130 31 13 339 3 tuf Elongation factor Tu Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q1RHL9 1.56e-31 130 29 11 340 3 tuf Elongation factor Tu Rickettsia bellii (strain RML369-C)
A8GVB2 1.56e-31 130 29 11 340 3 tuf Elongation factor Tu Rickettsia bellii (strain OSU 85-389)
A4JAM5 2.51e-31 129 30 14 372 3 tuf1 Elongation factor Tu Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3J8Q0 3.32e-31 129 29 13 372 3 tuf1 Elongation factor Tu Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
P42482 3.66e-31 129 28 14 392 3 tuf Elongation factor Tu Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A9BHA7 3.81e-31 129 30 14 378 3 tuf Elongation factor Tu Petrotoga mobilis (strain DSM 10674 / SJ95)
Q2YAZ9 4.02e-31 129 28 13 372 3 tuf1 Elongation factor Tu Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P33167 4.34e-31 129 30 14 372 3 tuf Elongation factor Tu Burkholderia cepacia
A7HWP7 5.11e-31 128 29 12 373 3 tuf1 Elongation factor Tu Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q1BRT3 5.57e-31 128 30 14 372 3 tuf1 Elongation factor Tu Burkholderia orbicola (strain AU 1054)
Q39KI2 5.57e-31 128 30 14 372 3 tuf1 Elongation factor Tu Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ48 5.57e-31 128 30 14 372 3 tuf1 Elongation factor Tu Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K3L0 5.57e-31 128 30 14 372 3 tuf1 Elongation factor Tu Burkholderia cenocepacia (strain HI2424)
A6Q1L5 5.75e-31 128 29 13 376 3 tuf Elongation factor Tu Nitratiruptor sp. (strain SB155-2)
Q57918 6.12e-31 129 31 8 324 3 selB Selenocysteine-specific elongation factor Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7VJ74 7.16e-31 128 29 13 375 3 tuf Elongation factor Tu Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A7I3U7 7.59e-31 128 28 12 376 3 tuf Elongation factor Tu Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q5YPG4 7.72e-31 128 29 16 395 3 tuf Elongation factor Tu Nocardia farcinica (strain IFM 10152)
Q2L2G6 9.63e-31 127 29 13 374 3 tuf1 Elongation factor Tu Bordetella avium (strain 197N)
A9BCK0 1.07e-30 127 29 12 340 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9211)
Q7TT91 1.12e-30 127 30 14 372 3 tuf1 Elongation factor Tu Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q79GC6 1.12e-30 127 30 14 372 3 tuf1 Elongation factor Tu Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q79G84 1.12e-30 127 30 14 372 3 tuf1 Elongation factor Tu Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9P9Q9 1.18e-30 127 29 15 382 1 tufA Elongation factor Tu Xylella fastidiosa (strain 9a5c)
C4K4F8 1.3e-30 127 29 13 370 3 tuf Elongation factor Tu Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q2RFP5 1.33e-30 127 30 14 376 3 tuf Elongation factor Tu Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q47LJ1 1.37e-30 127 29 14 389 3 tuf Elongation factor Tu Thermobifida fusca (strain YX)
Q1AU14 1.41e-30 127 28 14 376 3 tuf1 Elongation factor Tu Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A7HBL7 1.47e-30 127 28 11 372 3 tuf1 Elongation factor Tu Anaeromyxobacter sp. (strain Fw109-5)
P49411 1.53e-30 128 32 9 301 1 TUFM Elongation factor Tu, mitochondrial Homo sapiens
A5GIP0 1.6e-30 127 29 12 343 3 tuf Elongation factor Tu Synechococcus sp. (strain WH7803)
A4FPM7 1.84e-30 127 29 14 389 3 tuf Elongation factor Tu Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
P48865 1.87e-30 127 28 11 339 3 tuf Elongation factor Tu Rickettsia prowazekii (strain Madrid E)
Q5GWR8 1.97e-30 127 28 13 374 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZX1 1.97e-30 127 28 13 374 3 tuf1 Elongation factor Tu Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P85834 2.04e-30 127 31 8 300 1 Tufm Elongation factor Tu, mitochondrial Rattus norvegicus
Q877P8 2.09e-30 126 29 15 382 3 tufA Elongation factor Tu Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A8F2E9 2.7e-30 126 29 13 344 3 tuf Elongation factor Tu Rickettsia massiliae (strain Mtu5)
Q3J5S4 2.74e-30 126 28 13 368 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGI1 2.74e-30 126 28 13 368 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1IHG6 3.38e-30 126 28 13 374 3 tuf1 Elongation factor Tu Koribacter versatilis (strain Ellin345)
A1T4L6 3.64e-30 126 28 15 393 3 tuf Elongation factor Tu Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A2C4U5 3.75e-30 126 28 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL1A)
Q7VA05 3.79e-30 126 29 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q5NQ65 3.84e-30 126 30 13 370 3 tuf Elongation factor Tu Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9ZK19 3.93e-30 126 28 14 391 3 tuf Elongation factor Tu Helicobacter pylori (strain J99 / ATCC 700824)
Q8KT95 4.43e-30 125 30 8 297 3 tuf Elongation factor Tu Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A6LPP6 4.48e-30 125 29 13 377 3 tuf1 Elongation factor Tu Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8TYP6 4.71e-30 126 32 10 295 3 tuf Elongation factor 1-alpha Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q07KJ2 4.94e-30 125 29 13 373 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain BisA53)
A5N4N1 4.98e-30 125 27 14 390 3 tuf1 Elongation factor Tu Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A2BYN4 4.99e-30 125 29 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9515)
B9L7I8 4.99e-30 125 30 13 377 3 tuf Elongation factor Tu Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q7U4D1 5.09e-30 125 29 12 343 3 tuf Elongation factor Tu Parasynechococcus marenigrum (strain WH8102)
Q3BWY6 5.39e-30 125 30 15 375 3 tuf1 Elongation factor Tu Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8NL22 5.39e-30 125 30 15 375 3 tufA Elongation factor Tu Xanthomonas axonopodis pv. citri (strain 306)
Q6MDN0 5.42e-30 125 32 8 282 3 tuf Elongation factor Tu Protochlamydia amoebophila (strain UWE25)
Q8XGZ0 5.76e-30 125 29 14 372 3 tufA Elongation factor Tu Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q134R0 5.81e-30 125 28 13 373 3 tuf2 Elongation factor Tu 2 Rhodopseudomonas palustris (strain BisB5)
Q6N4Q4 5.98e-30 125 29 14 373 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A0QS98 6.1e-30 125 28 16 395 1 tuf Elongation factor Tu Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8BFR5 6.53e-30 126 31 8 300 1 Tufm Elongation factor Tu, mitochondrial Mus musculus
Q1QN32 6.58e-30 125 29 13 373 3 tuf Elongation factor Tu Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A5EX84 6.58e-30 125 30 13 372 3 tuf Elongation factor Tu Dichelobacter nodosus (strain VCS1703A)
A9ISD9 6.94e-30 125 28 13 368 3 tuf1 Elongation factor Tu Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q211E6 7.11e-30 125 29 14 374 3 tuf Elongation factor Tu Rhodopseudomonas palustris (strain BisB18)
Q134S7 7.82e-30 125 28 13 373 3 tuf1 Elongation factor Tu 1 Rhodopseudomonas palustris (strain BisB5)
A2BT83 8.2e-30 125 29 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain AS9601)
Q46IW4 9.11e-30 125 28 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain NATL2A)
A5CW32 1e-29 124 30 14 378 3 tuf1 Elongation factor Tu Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A3PEZ7 1.06e-29 124 29 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9301)
A1B002 1.08e-29 124 29 14 368 3 tuf1 Elongation factor Tu Paracoccus denitrificans (strain Pd 1222)
P49410 1.08e-29 125 31 8 300 1 TUFM Elongation factor Tu, mitochondrial Bos taurus
Q0K5Z9 1.11e-29 124 29 14 372 3 tuf1 Elongation factor Tu Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P40175 1.27e-29 124 30 10 360 3 tuf3 Elongation factor Tu-3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8G708 1.28e-29 124 29 12 343 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9215)
A8GT71 1.37e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Sheila Smith)
B0BUR2 1.37e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia rickettsii (strain Iowa)
C4K2I2 1.37e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia peacockii (strain Rustic)
C3PPA9 1.37e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia africae (strain ESF-5)
A5V604 1.4e-29 124 28 13 389 3 tuf Elongation factor Tu Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q46WC7 1.48e-29 124 29 14 372 3 tuf1 Elongation factor Tu Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2SU25 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PZ6 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain K96243)
A3NEI1 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 668)
Q3JMP6 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1710b)
A3P0B5 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia pseudomallei (strain 1106a)
A1V8A5 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia mallei (strain SAVP1)
Q62GK3 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia mallei (strain ATCC 23344)
A2S7F9 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10229)
A3MRT8 1.5e-29 124 29 14 372 3 tuf1 Elongation factor Tu Burkholderia mallei (strain NCTC 10247)
A4WVL0 1.58e-29 124 28 13 368 3 tuf1 Elongation factor Tu Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q92GW4 1.58e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3A9P8 1.75e-29 124 27 13 377 3 tuf2 Elongation factor Tu 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A4SUU7 1.78e-29 124 29 14 369 3 tuf1 Elongation factor Tu Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q8KT97 1.79e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3A9R3 1.86e-29 124 27 13 377 3 tuf1 Elongation factor Tu 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C4Z2R9 1.93e-29 124 30 9 308 3 tuf Elongation factor Tu Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A5GW14 1.93e-29 124 29 12 338 3 tuf Elongation factor Tu Synechococcus sp. (strain RCC307)
A7GJ76 2.02e-29 124 27 14 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGF6 2.02e-29 124 27 14 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Okra / Type B1)
A5I7K8 2.02e-29 124 27 14 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ71 2.02e-29 124 27 14 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain ATCC 19397 / Type A)
Q318N5 2.05e-29 124 29 12 338 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9312)
Q2EEV7 2.07e-29 124 28 14 388 3 tufA Elongation factor Tu, plastid Helicosporidium sp. subsp. Simulium jonesii
A8GPF2 2.07e-29 124 28 16 378 3 tuf Elongation factor Tu Rickettsia akari (strain Hartford)
Q2IXR2 2.13e-29 124 28 13 373 3 tuf1 Elongation factor Tu Rhodopseudomonas palustris (strain HaA2)
P0A3B0 2.14e-29 124 29 11 336 3 tuf Elongation factor Tu Rickettsia sibirica
P0A3A9 2.14e-29 124 29 11 336 3 tuf Elongation factor Tu Rickettsia rickettsii
Q7UZY7 2.15e-29 124 29 12 338 3 tuf Elongation factor Tu Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0AUH8 2.18e-29 124 28 16 399 3 tuf1 Elongation factor Tu 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A8EZL8 2.2e-29 124 28 11 339 3 tuf Elongation factor Tu Rickettsia canadensis (strain McKiel)
B0RU96 2.32e-29 124 29 15 375 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain B100)
Q4URC5 2.32e-29 124 29 15 375 3 tuf2 Elongation factor Tu 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8PC59 2.32e-29 124 29 15 375 3 tufA Elongation factor Tu-A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q3SSW8 2.34e-29 124 28 12 373 3 tuf Elongation factor Tu Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8PC51 2.43e-29 123 29 15 375 3 tufB Elongation factor Tu-B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URD7 2.43e-29 123 29 15 375 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain 8004)
Q1LI13 2.57e-29 123 29 14 372 3 tuf1 Elongation factor Tu Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A5CCL4 3.07e-29 123 28 12 366 3 tuf2 Elongation factor Tu 2 Orientia tsutsugamushi (strain Boryong)
A5CCA0 3.16e-29 123 28 12 369 3 tuf1 Elongation factor Tu 1 Orientia tsutsugamushi (strain Boryong)
Q0AUG3 3.19e-29 123 28 16 399 3 tuf2 Elongation factor Tu 2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q8KT99 3.26e-29 123 30 8 297 3 tuf Elongation factor Tu Rickettsia helvetica
A4J0Z5 3.32e-29 123 28 14 383 3 tuf Elongation factor Tu Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q21SF0 3.33e-29 123 29 13 372 3 tuf1 Elongation factor Tu 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7V500 3.39e-29 123 31 9 288 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9313)
A1AVJ8 3.42e-29 123 29 13 372 3 tuf1 Elongation factor Tu 1 Ruthia magnifica subsp. Calyptogena magnifica
B9MQH1 3.48e-29 123 27 13 392 3 tuf Elongation factor Tu Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q73H85 3.52e-29 123 28 13 370 3 tuf2 Elongation factor Tu 2 Wolbachia pipientis wMel
Q21RV6 3.52e-29 123 29 13 372 3 tuf2 Elongation factor Tu 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q73IX6 3.62e-29 123 28 13 370 3 tuf1 Elongation factor Tu 1 Wolbachia pipientis wMel
A9NEN4 3.64e-29 123 30 17 393 3 tuf Elongation factor Tu Acholeplasma laidlawii (strain PG-8A)
Q8KTA6 3.86e-29 123 29 13 344 3 tuf Elongation factor Tu Rickettsia parkeri
Q8KTA1 3.94e-29 123 29 13 344 3 tuf Elongation factor Tu Rickettsia montanensis
Q5FTY1 4.26e-29 123 28 14 393 3 tuf Elongation factor Tu Gluconobacter oxydans (strain 621H)
A4XI37 5.28e-29 122 27 12 392 3 tuf Elongation factor Tu Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q3AMT6 6e-29 122 32 9 288 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9605)
B1KSM7 6.71e-29 122 27 14 390 3 tuf1 Elongation factor Tu Clostridium botulinum (strain Loch Maree / Type A3)
A2CC87 6.72e-29 122 31 9 288 3 tuf Elongation factor Tu Prochlorococcus marinus (strain MIT 9303)
A1AX82 6.92e-29 122 29 12 372 3 tuf2 Elongation factor Tu 2 Ruthia magnifica subsp. Calyptogena magnifica
Q123F6 7.26e-29 122 29 15 378 3 tuf1 Elongation factor Tu Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5FKR8 7.33e-29 122 27 15 390 3 tuf Elongation factor Tu Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8R7T8 7.65e-29 122 29 15 374 3 tufB Elongation factor Tu-B Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5GRY3 8.14e-29 122 28 13 370 3 tuf2 Elongation factor Tu 2 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q8KTA3 8.51e-29 122 29 13 344 3 tuf Elongation factor Tu Rickettsia rhipicephali
B0RU84 8.53e-29 122 29 15 375 3 tuf1 Elongation factor Tu 1 Xanthomonas campestris pv. campestris (strain B100)
A8Z5T8 9.24e-29 122 28 15 390 3 tuf Elongation factor Tu Karelsulcia muelleri (strain GWSS)
P13927 1.04e-28 122 29 13 341 3 tuf Elongation factor Tu Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A5D5I8 1.05e-28 122 29 14 383 3 tuf2 Elongation factor Tu 2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3SLQ1 1.05e-28 122 29 13 372 3 tuf1 Elongation factor Tu Thiobacillus denitrificans (strain ATCC 25259)
Q0AIJ7 1.12e-28 121 29 14 376 3 tuf1 Elongation factor Tu 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A5D5K0 1.13e-28 122 29 14 383 3 tuf1 Elongation factor Tu 1 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q81ZS3 1.17e-28 121 30 13 366 3 tuf1 Elongation factor Tu Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q05FI3 1.3e-28 121 29 13 367 3 tuf Elongation factor Tu Carsonella ruddii (strain PV)
Q042T5 1.33e-28 121 29 13 334 3 tuf Elongation factor Tu Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A4IW92 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKB8 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain OSU18)
A0Q874 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. novicida (strain U112)
B2SFC9 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A1M0 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain LVS)
A7NEC7 1.41e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B6YQ04 1.43e-28 121 31 9 300 3 tuf Elongation factor Tu Azobacteroides pseudotrichonymphae genomovar. CFP2
B1LBP2 1.43e-28 121 27 14 378 3 tuf Elongation factor Tu Thermotoga sp. (strain RQ2)
A5IM81 1.43e-28 121 27 14 378 3 tuf Elongation factor Tu Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
P23568 1.46e-28 121 29 12 337 1 tuf Elongation factor Tu Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5GSU2 1.48e-28 121 28 13 370 3 tuf1 Elongation factor Tu 1 Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5NID9 1.67e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JU2 1.67e-28 121 30 13 370 3 tuf Elongation factor Tu Francisella tularensis subsp. tularensis (strain FSC 198)
Q1D776 1.72e-28 121 29 15 374 3 tuf2 Elongation factor Tu 2 Myxococcus xanthus (strain DK1622)
Q1D7V1 1.76e-28 121 29 15 374 3 tuf1 Elongation factor Tu 1 Myxococcus xanthus (strain DK1622)
Q4ZMP2 1.98e-28 121 29 16 376 3 tuf Elongation factor Tu Pseudomonas syringae pv. syringae (strain B728a)
Q73PN3 2.07e-28 120 29 15 388 3 tuf Elongation factor Tu Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B0TC54 2.21e-28 120 27 13 395 3 tuf Elongation factor Tu Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
C5C0J3 2.38e-28 120 31 9 290 3 tuf Elongation factor Tu Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q3YRK7 2.46e-28 120 29 12 375 3 tuf1 Elongation factor Tu Ehrlichia canis (strain Jake)
P95724 2.48e-28 120 29 16 396 3 tuf Elongation factor Tu Streptomyces cinnamoneus
A8YUS2 2.57e-28 120 26 14 387 3 tuf Elongation factor Tu Lactobacillus helveticus (strain DPC 4571)
B3QY22 2.67e-28 120 27 14 389 3 tuf Elongation factor Tu Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q7M7F1 2.82e-28 120 29 13 372 3 tuf1 Elongation factor Tu Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2W2H3 2.96e-28 120 27 12 373 3 tuf1 Elongation factor Tu Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B9K884 3e-28 120 28 14 378 1 tuf Elongation factor Tu Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q48D34 3.06e-28 120 29 15 373 3 tuf Elongation factor Tu Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P42478 3.16e-28 120 29 11 338 3 tuf Elongation factor Tu (Fragment) Spirochaeta aurantia
A1SNN5 3.21e-28 120 28 16 394 3 tuf Elongation factor Tu Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0LRL8 3.37e-28 120 28 16 392 3 tuf Elongation factor Tu Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q0AF46 3.61e-28 120 29 14 376 3 tuf2 Elongation factor Tu 2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B0TX03 3.71e-28 120 29 13 370 3 tuf Elongation factor Tu Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
P33165 3.74e-28 120 30 7 297 3 tuf Elongation factor Tu Bacteroides fragilis (strain YCH46)
Q5L890 3.74e-28 120 30 7 297 3 tuf Elongation factor Tu Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q889X3 3.95e-28 120 29 16 379 3 tuf Elongation factor Tu Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1LSY4 3.96e-28 120 28 14 369 3 tuf Elongation factor Tu Baumannia cicadellinicola subsp. Homalodisca coagulata
Q981F7 4.32e-28 120 30 14 383 3 tufA Elongation factor Tu Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
C0ZIH6 4.4e-28 120 31 7 299 3 tuf Elongation factor Tu Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
P42479 5.8e-28 119 27 15 389 3 tuf Elongation factor Tu Stigmatella aurantiaca
P09591 5.94e-28 119 28 15 375 1 tufA Elongation factor Tu Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T82 5.94e-28 119 28 15 375 1 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UZH4 5.94e-28 119 28 15 375 3 tuf1 Elongation factor Tu Pseudomonas aeruginosa (strain PA7)
Q4FLK5 6.02e-28 119 28 15 389 3 tuf Elongation factor Tu Pelagibacter ubique (strain HTCC1062)
Q822I4 6.24e-28 119 29 14 378 3 tuf Elongation factor Tu Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q74JU6 6.31e-28 119 29 13 334 3 tuf Elongation factor Tu Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A6T3K6 6.55e-28 119 29 13 372 3 tuf1 Elongation factor Tu Janthinobacterium sp. (strain Marseille)
A1WVD6 6.68e-28 119 29 13 369 3 tuf2 Elongation factor Tu 2 Halorhodospira halophila (strain DSM 244 / SL1)
A4QBH0 6.81e-28 119 28 13 388 3 tuf Elongation factor Tu Corynebacterium glutamicum (strain R)
A1WVC4 7.14e-28 119 29 13 369 3 tuf1 Elongation factor Tu 1 Halorhodospira halophila (strain DSM 244 / SL1)
B7IT17 7.16e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain G9842)
P42439 7.27e-28 119 28 13 388 3 tuf Elongation factor Tu Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6HPR0 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H92 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain ZK / E33L)
Q814C4 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ46 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain B4264)
C1ET37 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain 03BB102)
B7JKB7 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain AH820)
Q81VT2 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus anthracis
A0R8H8 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus thuringiensis (strain Al Hakam)
C3LJ80 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q3 8.42e-28 119 29 13 375 3 tuf Elongation factor Tu Bacillus anthracis (strain A0248)
Q2GFN6 8.66e-28 119 28 12 375 3 tuf1 Elongation factor Tu Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C1AYS3 8.96e-28 119 28 14 392 3 tuf Elongation factor Tu Rhodococcus opacus (strain B4)
Q0SFF4 8.96e-28 119 28 14 392 3 tuf Elongation factor Tu Rhodococcus jostii (strain RHA1)
B2UQY9 9.83e-28 119 27 14 383 3 tuf Elongation factor Tu Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B8DAY7 9.98e-28 119 29 15 391 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4a (strain HCC23)
Q927I6 9.98e-28 119 29 15 391 3 tuf Elongation factor Tu Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8EX18 1.06e-27 119 29 12 335 3 tuf Elongation factor Tu Malacoplasma penetrans (strain HF-2)
Q0BUQ2 1.15e-27 119 28 14 392 3 tuf Elongation factor Tu Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A5FZW7 1.24e-27 118 26 12 388 3 tuf Elongation factor Tu Acidiphilium cryptum (strain JF-5)
P13537 1.48e-27 118 27 14 378 3 tuf Elongation factor Tu Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B9IZJ2 1.51e-27 118 28 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain Q1)
B7HQU2 1.51e-27 118 28 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain AH187)
Q73F98 1.51e-27 118 28 13 375 3 tuf Elongation factor Tu Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8R7V2 1.54e-27 118 28 15 374 3 tufA Elongation factor Tu-A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q605B0 1.55e-27 118 27 12 372 3 tuf1 Elongation factor Tu Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0ANN1 1.66e-27 118 29 13 373 3 tuf1 Elongation factor Tu Maricaulis maris (strain MCS10)
A9VP75 1.7e-27 118 29 13 375 3 tuf Elongation factor Tu Bacillus mycoides (strain KBAB4)
Q826Z7 1.73e-27 118 30 6 297 3 tuf2 Elongation factor Tu 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A5DN78 1.9e-27 118 31 9 300 3 TUF1 Elongation factor Tu, mitochondrial Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q6F0J5 1.91e-27 118 27 13 389 3 tuf Elongation factor Tu Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q0I0B9 1.94e-27 118 28 14 376 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-7)
Q0HNV1 1.94e-27 118 28 14 376 3 tuf1 Elongation factor Tu 1 Shewanella sp. (strain MR-4)
B8I5N8 1.95e-27 118 31 7 287 3 tuf Elongation factor Tu Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q01SX2 2.03e-27 118 27 15 392 3 tuf1 Elongation factor Tu Solibacter usitatus (strain Ellin6076)
A6X0A2 2.04e-27 118 29 13 368 3 tuf1 Elongation factor Tu Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5L5H6 2.09e-27 118 28 14 378 3 tuf Elongation factor Tu Chlamydia abortus (strain DSM 27085 / S26/3)
A0ALY8 2.19e-27 118 29 15 391 3 tuf Elongation factor Tu Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y422 2.19e-27 118 29 15 391 1 tuf Elongation factor Tu Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WB9 2.19e-27 118 29 15 391 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain F2365)
C1KZK6 2.19e-27 118 29 15 391 3 tuf Elongation factor Tu Listeria monocytogenes serotype 4b (strain CLIP80459)
B1HMZ0 2.4e-27 117 28 14 390 3 tuf Elongation factor Tu Lysinibacillus sphaericus (strain C3-41)
A0KRL0 2.65e-27 117 28 13 375 3 tuf1 Elongation factor Tu Shewanella sp. (strain ANA-3)
Q3A6R2 2.85e-27 117 28 14 376 3 tuf1 Elongation factor Tu 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8FS84 2.92e-27 117 29 14 388 3 tuf Elongation factor Tu Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B3PMU1 3.1e-27 117 27 12 388 3 tuf Elongation factor Tu Metamycoplasma arthritidis (strain 158L3-1)
Q04B37 3.12e-27 117 28 11 334 3 tuf Elongation factor Tu Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAQ0 3.12e-27 117 28 11 334 3 tuf Elongation factor Tu Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A8LC58 3.48e-27 117 29 15 392 3 tuf Elongation factor Tu Parafrankia sp. (strain EAN1pec)
A1VIP8 3.59e-27 117 29 16 379 3 tuf1 Elongation factor Tu Polaromonas naphthalenivorans (strain CJ2)
A8LLG2 3.6e-27 117 29 13 362 3 tuf1 Elongation factor Tu Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
C3K2X8 3.75e-27 117 29 15 358 3 tuf Elongation factor Tu Pseudomonas fluorescens (strain SBW25)
A6Q6H4 3.81e-27 117 28 13 379 3 tuf Elongation factor Tu Sulfurovum sp. (strain NBC37-1)
Q255F3 4.13e-27 117 28 14 378 3 tuf Elongation factor Tu Chlamydia felis (strain Fe/C-56)
A4VHL6 4.36e-27 117 27 14 375 3 tuf1 Elongation factor Tu 1 Stutzerimonas stutzeri (strain A1501)
Q5HAS0 4.4e-27 117 28 12 375 3 tuf1 Elongation factor Tu Ehrlichia ruminantium (strain Welgevonden)
Q5FFE6 4.4e-27 117 28 12 375 3 tuf1 Elongation factor Tu Ehrlichia ruminantium (strain Gardel)
Q85FT7 4.51e-27 117 30 9 308 3 tufA Elongation factor Tu, chloroplastic Cyanidioschyzon merolae (strain NIES-3377 / 10D)
Q250N4 4.6e-27 117 27 15 394 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain Y51)
B8G1W4 4.6e-27 117 27 15 394 3 tuf Elongation factor Tu Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q1ACI3 4.91e-27 117 27 16 399 3 tufA Elongation factor Tu, chloroplastic Chara vulgaris
C0Q9Y7 4.98e-27 117 28 13 376 3 tuf Elongation factor Tu Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q9Y700 5.51e-27 117 31 8 279 3 tuf1 Elongation factor Tu, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P29542 5.62e-27 117 29 12 339 3 tuf1 Elongation factor Tu-1 Streptomyces ramocissimus
A4G9U0 5.76e-27 116 28 12 372 3 tuf1 Elongation factor Tu Herminiimonas arsenicoxydans
A1WHC3 6.38e-27 116 28 14 373 3 tuf1 Elongation factor Tu Verminephrobacter eiseniae (strain EF01-2)
A5IYA9 6.51e-27 116 31 9 287 3 tuf Elongation factor Tu Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q3A6P9 6.54e-27 116 28 14 376 3 tuf2 Elongation factor Tu 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B0SSH9 6.73e-27 116 29 16 376 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SAF6 6.73e-27 116 29 16 376 3 tuf Elongation factor Tu Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
P64025 6.77e-27 116 29 13 368 3 tufA Elongation factor Tu Brucella suis biovar 1 (strain 1330)
A5VR08 6.77e-27 116 29 13 368 3 tuf1 Elongation factor Tu Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P64024 6.77e-27 116 29 13 368 3 tufA Elongation factor Tu Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M5Q2 6.77e-27 116 29 13 368 3 tuf1 Elongation factor Tu Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YM08 6.77e-27 116 29 13 368 3 tuf1 Elongation factor Tu Brucella abortus (strain 2308)
Q67JU1 6.85e-27 116 26 14 401 3 tuf Elongation factor Tu Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q73SD1 6.88e-27 116 28 16 395 3 tuf Elongation factor Tu Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QL35 6.88e-27 116 28 16 395 3 tuf Elongation factor Tu Mycobacterium avium (strain 104)
Q5LMR5 6.9e-27 116 28 13 362 3 tuf1 Elongation factor Tu Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A8HTW6 7.19e-27 116 27 14 400 3 tuf1 Elongation factor Tu Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B0CH34 7.23e-27 116 29 13 368 3 tuf1 Elongation factor Tu Brucella suis (strain ATCC 23445 / NCTC 10510)
Q38WR7 7.49e-27 116 27 10 334 3 tuf Elongation factor Tu Latilactobacillus sakei subsp. sakei (strain 23K)
B2GIL2 8.08e-27 116 32 10 280 3 tuf Elongation factor Tu Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q6AP73 8.23e-27 116 29 15 378 3 tuf2 Elongation factor Tu 2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8EK81 8.54e-27 116 28 13 375 3 tuf1 Elongation factor Tu 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q2JFH8 8.68e-27 116 29 16 391 3 tuf Elongation factor Tu Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B8GIQ3 8.68e-27 116 29 9 311 3 tuf Elongation factor 1-alpha Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q039K9 9.05e-27 116 27 14 378 3 tuf Elongation factor Tu Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WE38 9.05e-27 116 27 14 378 3 tuf Elongation factor Tu Lacticaseibacillus casei (strain BL23)
A9KRZ4 9.27e-27 116 28 16 395 3 tuf Elongation factor Tu Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q6A6L7 9.53e-27 116 29 15 393 3 tuf Elongation factor Tu Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1GDV0 1.04e-26 115 28 13 368 3 tuf1 Elongation factor Tu Ruegeria sp. (strain TM1040)
Q11Q98 1.07e-26 115 28 13 368 3 tuf Elongation factor Tu Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A0JZ88 1.1e-26 115 28 15 390 3 tuf Elongation factor Tu Arthrobacter sp. (strain FB24)
Q65PA9 1.13e-26 115 26 12 388 3 tuf Elongation factor Tu Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A5FIJ9 1.18e-26 115 29 16 389 3 tuf Elongation factor Tu Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A9H3R7 1.23e-26 115 27 14 390 3 tuf Elongation factor Tu Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q160Y4 1.25e-26 115 29 13 362 3 tuf1 Elongation factor Tu Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B9DKV8 1.36e-26 115 29 14 372 3 tuf Elongation factor Tu Staphylococcus carnosus (strain TM300)
Q6AP86 1.44e-26 115 28 14 375 3 tuf1 Elongation factor Tu 1 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8CQ81 1.45e-26 115 28 14 374 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRK4 1.45e-26 115 28 14 374 3 tuf Elongation factor Tu Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P50371 1.46e-26 115 29 9 311 3 tufA Elongation factor Tu, chloroplastic Chara connivens
A9WSW5 1.48e-26 115 28 14 393 3 tuf Elongation factor Tu Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A4VHM8 1.51e-26 115 28 15 375 3 tuf2 Elongation factor Tu 2 Stutzerimonas stutzeri (strain A1501)
B4S5M9 1.52e-26 115 29 13 386 3 tuf Elongation factor Tu Prosthecochloris aestuarii (strain DSM 271 / SK 413)
P56292 1.6e-26 115 29 11 349 3 tufA Elongation factor Tu, chloroplastic Chlorella vulgaris
C5D3R5 1.6e-26 115 28 15 389 3 tuf Elongation factor Tu Geobacillus sp. (strain WCH70)
P72231 1.66e-26 115 28 15 391 3 tuf Elongation factor Tu Planobispora rosea
P42480 1.68e-26 115 29 11 337 3 tuf Elongation factor Tu Hymenobacter ocellatus
P18906 1.68e-26 115 28 12 338 3 tuf Elongation factor Tu Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q8EK70 1.72e-26 115 28 13 375 3 tuf2 Elongation factor Tu 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q4A9G1 1.77e-26 115 29 14 350 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q0I0A7 1.83e-26 115 28 14 376 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-7)
A2SLF9 1.83e-26 115 29 13 372 3 tuf1 Elongation factor Tu Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q4A7K0 1.85e-26 115 28 16 390 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 7448)
Q600B6 1.85e-26 115 28 16 390 3 tuf Elongation factor Tu Mesomycoplasma hyopneumoniae (strain 232)
A4T1R2 1.87e-26 115 28 16 390 3 tuf Elongation factor Tu Mycolicibacterium gilvum (strain PYR-GCK)
Q3K5X4 1.95e-26 115 29 14 367 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain Pf0-1)
A3DJ00 2e-26 115 27 13 386 3 tuf Elongation factor Tu Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q0HNT9 2.01e-26 115 28 13 375 3 tuf2 Elongation factor Tu 2 Shewanella sp. (strain MR-4)
Q2LQA3 2.04e-26 115 26 15 385 3 tuf Elongation factor Tu Syntrophus aciditrophicus (strain SB)
A1R8U9 2.07e-26 115 27 15 393 3 tuf Elongation factor Tu Paenarthrobacter aurescens (strain TC1)
P9WNN1 2.09e-26 115 29 16 395 1 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN0 2.09e-26 115 29 16 395 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U071 2.09e-26 115 29 16 395 3 tuf Elongation factor Tu Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AL18 2.09e-26 115 29 16 395 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KGG5 2.09e-26 115 29 16 395 3 tuf Elongation factor Tu Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A559 2.09e-26 115 29 16 395 3 tuf Elongation factor Tu Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P22679 2.27e-26 115 26 13 394 1 tuf Elongation factor Tu Metamycoplasma hominis (strain ATCC 23114 / DSM 25592 / NBRC 14850 / NCTC 10111 / PG21)
Q8KAH0 2.44e-26 114 28 12 385 3 tuf Elongation factor Tu Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q4A597 2.77e-26 114 27 13 385 3 tuf Elongation factor Tu Mycoplasmopsis synoviae (strain 53)
Q1BDD3 2.82e-26 114 28 15 388 3 tuf Elongation factor Tu Mycobacterium sp. (strain MCS)
A1UBL1 2.82e-26 114 28 15 388 3 tuf Elongation factor Tu Mycobacterium sp. (strain KMS)
A3PV96 2.82e-26 114 28 15 388 3 tuf Elongation factor Tu Mycobacterium sp. (strain JLS)
Q877L9 2.84e-26 114 29 12 336 3 tufA Elongation factor Tu Clostridium tetani (strain Massachusetts / E88)
B0BBV3 2.9e-26 114 29 14 375 3 tuf Elongation factor Tu Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7N8 2.9e-26 114 29 14 375 1 tuf Elongation factor Tu Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q2II78 3.05e-26 114 27 13 373 3 tuf1 Elongation factor Tu Anaeromyxobacter dehalogenans (strain 2CP-C)
P42474 3.09e-26 114 29 16 390 3 tuf Elongation factor Tu Cellulophaga lytica
Q6NJD5 3.13e-26 114 28 13 388 3 tuf Elongation factor Tu Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9TJQ8 3.14e-26 114 28 12 352 3 tufA Elongation factor Tu, plastid Prototheca wickerhamii
B8HD11 3.16e-26 114 28 15 390 3 tuf Elongation factor Tu Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
P0CD71 3.31e-26 114 29 14 375 3 tuf Elongation factor Tu Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KM40 3.31e-26 114 29 14 375 3 tuf Elongation factor Tu Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q30TQ5 3.39e-26 114 29 7 302 3 tuf Elongation factor Tu Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9TMM9 3.66e-26 114 31 11 304 3 tufA Elongation factor Tu, apicoplast Toxoplasma gondii
B2RL52 3.66e-26 114 30 8 298 3 tuf Elongation factor Tu Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q0RRS3 3.8e-26 114 29 16 391 3 tuf Elongation factor Tu Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q28UW7 3.87e-26 114 28 14 370 3 tuf1 Elongation factor Tu Jannaschia sp. (strain CCS1)
A4XZ92 4.06e-26 114 27 15 375 3 tuf Elongation factor Tu Pseudomonas mendocina (strain ymp)
A6GYU7 4.37e-26 114 29 17 391 3 tuf Elongation factor Tu Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8UE16 4.8e-26 114 29 15 385 3 tufA Elongation factor Tu Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0ABH7 4.83e-26 114 27 13 372 3 tuf1 Elongation factor Tu Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5WLR4 4.87e-26 114 28 14 392 3 tuf Elongation factor Tu Shouchella clausii (strain KSM-K16)
P75022 5.22e-26 114 29 15 385 3 tufA Elongation factor Tu Rhizobium radiobacter
A8F4Q9 5.48e-26 114 28 12 340 3 tuf Elongation factor Tu Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
P09953 6.1e-26 114 30 8 286 3 tuf Elongation factor Tu Micrococcus luteus
Q11HA6 6.61e-26 113 28 15 386 3 tuf1 Elongation factor Tu Chelativorans sp. (strain BNC1)
P02991 7.02e-26 114 26 12 398 1 tufA Elongation factor Tu, chloroplastic Euglena gracilis
A1USL2 7.12e-26 113 28 14 370 3 tuf2 Elongation factor Tu 2 Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
O93729 7.16e-26 114 27 17 428 3 tuf Elongation factor 1-alpha Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A0LIH6 7.4e-26 113 28 14 378 3 tuf1 Elongation factor Tu Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B1JDW6 7.75e-26 113 29 14 351 3 tuf1 Elongation factor Tu Pseudomonas putida (strain W619)
B0KK53 7.75e-26 113 29 14 351 3 tuf1 Elongation factor Tu Pseudomonas putida (strain GB-1)
A5VXN3 7.75e-26 113 29 14 351 3 tuf Elongation factor Tu Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88QP8 7.75e-26 113 29 14 351 1 tufA Elongation factor Tu-A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1USC1 8.12e-26 113 28 14 370 3 tuf1 Elongation factor Tu 1 Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q2G8Y2 8.88e-26 113 29 13 367 3 tuf Elongation factor Tu Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4SHU2 9.22e-26 113 27 14 386 3 tuf1 Elongation factor Tu Aeromonas salmonicida (strain A449)
Q4L3K9 9.67e-26 113 28 14 374 3 tuf Elongation factor Tu Staphylococcus haemolyticus (strain JCSC1435)
Q03YI2 9.89e-26 113 27 13 369 3 tuf Elongation factor Tu Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B1XI63 9.92e-26 113 27 9 348 3 tuf Elongation factor Tu Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O83217 1.06e-25 113 29 13 370 3 tuf Elongation factor Tu Treponema pallidum (strain Nichols)
P42473 1.06e-25 113 28 13 386 3 tuf Elongation factor Tu Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A8EW02 1.08e-25 113 28 14 369 3 tuf Elongation factor Tu Aliarcobacter butzleri (strain RM4018)
Q1IFW8 1.12e-25 113 29 15 373 3 tuf1 Elongation factor Tu Pseudomonas entomophila (strain L48)
Q88QN7 1.12e-25 113 29 15 373 3 tufB Elongation factor Tu-B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q17VM8 1.13e-25 113 30 8 304 3 tuf Elongation factor Tu Helicobacter acinonychis (strain Sheeba)
P50372 1.14e-25 113 32 8 290 3 tufA Elongation factor Tu, chloroplastic Codium fragile
A4IJI7 1.15e-25 112 28 16 389 3 tuf Elongation factor Tu Geobacillus thermodenitrificans (strain NG80-2)
B7GJ65 1.18e-25 112 27 13 384 3 tuf Elongation factor Tu Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q30X13 1.45e-25 112 31 9 303 3 tuf Elongation factor Tu Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q21M86 1.57e-25 112 28 16 389 3 tuf1 Elongation factor Tu Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9TKZ5 1.63e-25 112 29 8 312 3 tufA Elongation factor Tu, chloroplastic Nephroselmis olivacea
Q4K519 1.64e-25 112 28 15 378 3 tuf1 Elongation factor Tu Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P60338 1.67e-25 112 27 13 390 1 tufA Elongation factor Tu-A Thermus thermophilus
Q5SHN6 1.67e-25 112 27 13 390 1 tufA Elongation factor Tu-A Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q49V58 1.72e-25 112 28 14 375 3 tuf Elongation factor Tu Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P60339 1.75e-25 112 27 13 390 1 tufB Elongation factor Tu-B Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P33166 1.9e-25 112 30 8 302 1 tuf Elongation factor Tu Bacillus subtilis (strain 168)
C5BQ44 1.95e-25 112 28 17 387 3 tuf Elongation factor Tu Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5L3Z9 1.96e-25 112 28 16 389 3 tuf Elongation factor Tu Geobacillus kaustophilus (strain HTA426)
A8F982 1.97e-25 112 28 13 376 3 tuf Elongation factor Tu Bacillus pumilus (strain SAFR-032)
Q9PK73 2.12e-25 112 29 15 375 3 tuf Elongation factor Tu Chlamydia muridarum (strain MoPn / Nigg)
A0PXT1 2.2e-25 112 26 16 390 3 tuf1 Elongation factor Tu Clostridium novyi (strain NT)
P29544 2.28e-25 112 29 6 299 3 tuf3 Elongation factor Tu-3 Streptomyces ramocissimus
P30768 2.29e-25 112 28 16 390 3 tuf Elongation factor Tu Mycobacterium leprae (strain TN)
B8ZSC1 2.29e-25 112 28 16 390 3 tuf Elongation factor Tu Mycobacterium leprae (strain Br4923)
C4LL63 2.31e-25 112 28 15 394 3 tuf Elongation factor Tu Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
P42471 2.5e-25 112 27 13 393 3 tuf Elongation factor Tu Brevibacterium linens
Q5F5Q8 2.64e-25 112 27 13 372 3 tuf1 Elongation factor Tu Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q6L202 2.91e-25 112 27 7 300 3 tuf Elongation factor 1-alpha Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A1WCN6 3.09e-25 111 28 14 372 3 tuf2 Elongation factor Tu 2 Acidovorax sp. (strain JS42)
A1W2Q5 3.15e-25 111 28 14 372 3 tuf1 Elongation factor Tu 1 Acidovorax sp. (strain JS42)
Q01698 3.21e-25 111 27 13 390 1 tuf Elongation factor Tu Thermus aquaticus
C6C171 3.28e-25 111 30 11 339 3 tuf Elongation factor Tu Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q31IY4 3.3e-25 111 29 14 372 3 tuf1 Elongation factor Tu Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1KRF9 3.3e-25 111 27 13 372 3 tuf1 Elongation factor Tu Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P64027 3.3e-25 111 27 13 372 1 tufA Elongation factor Tu Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P64026 3.3e-25 111 27 13 372 3 tufA Elongation factor Tu Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B8ELG5 3.33e-25 111 28 14 392 3 tuf Elongation factor Tu Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
B9E8Q0 3.67e-25 111 27 12 372 3 tuf Elongation factor Tu Macrococcus caseolyticus (strain JCSC5402)
Q9Z9L6 3.72e-25 111 27 13 388 3 tuf Elongation factor Tu Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6KYK9 3.94e-25 111 30 6 297 3 tuf Elongation factor Tu Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A3MV69 4.09e-25 112 28 17 428 3 tuf Elongation factor 1-alpha Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
A1A0T1 4.18e-25 111 29 13 339 3 tuf Elongation factor Tu Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
P26184 4.57e-25 111 26 11 372 3 tuf Elongation factor Tu Flexistipes sinusarabici
Q98QG1 4.79e-25 111 27 16 392 3 tuf Elongation factor Tu Mycoplasmopsis pulmonis (strain UAB CTIP)
B0CCD0 4.81e-25 111 27 10 348 3 tuf Elongation factor Tu Acaryochloris marina (strain MBIC 11017)
A6U842 4.82e-25 110 29 14 370 3 tuf1 Elongation factor Tu Sinorhizobium medicae (strain WSM419)
Q925Y6 4.82e-25 110 29 14 370 3 tufA Elongation factor Tu Rhizobium meliloti (strain 1021)
Q5WZL4 4.93e-25 111 27 14 374 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Lens)
Q3IJV1 5.12e-25 110 28 15 389 3 tuf2 Elongation factor Tu 2 Pseudoalteromonas translucida (strain TAC 125)
Q2JUX4 5.23e-25 111 27 11 351 3 tuf Elongation factor Tu Synechococcus sp. (strain JA-3-3Ab)
Q72GW4 5.68e-25 111 27 13 390 3 tuf1 Elongation factor Tu Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q8KHX9 5.71e-25 110 27 14 370 3 tuf1 Elongation factor Tu Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A6LLL1 5.71e-25 110 30 9 285 3 tuf Elongation factor Tu Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
O50306 5.76e-25 110 28 16 389 3 tuf Elongation factor Tu Geobacillus stearothermophilus
Q3ILP4 5.84e-25 110 28 15 389 3 tuf1 Elongation factor Tu 1 Pseudoalteromonas translucida (strain TAC 125)
Q2K9L8 6.01e-25 110 29 16 387 3 tuf2 Elongation factor Tu 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6MU81 6.2e-25 110 27 16 391 3 tuf Elongation factor Tu Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q2SSW8 6.2e-25 110 27 16 391 3 tuf Elongation factor Tu Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q839G8 6.38e-25 110 27 12 372 3 tuf Elongation factor Tu Enterococcus faecalis (strain ATCC 700802 / V583)
O50340 6.48e-25 110 28 7 303 3 tuf Elongation factor Tu Fervidobacterium islandicum
A7GK18 6.62e-25 110 27 14 390 3 tuf Elongation factor Tu Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3AW53 6.92e-25 110 31 9 288 3 tuf Elongation factor Tu Synechococcus sp. (strain CC9902)
Q5ZYP5 7.1e-25 110 27 14 374 3 tuf1 Elongation factor Tu Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR6 7.1e-25 110 27 14 374 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Corby)
Q5X873 7.1e-25 110 27 14 374 3 tuf1 Elongation factor Tu Legionella pneumophila (strain Paris)
A2STF0 7.11e-25 111 27 10 322 3 tuf Elongation factor 1-alpha Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
P17245 7.24e-25 110 27 9 348 3 tufA Elongation factor Tu, cyanelle Cyanophora paradoxa
Q97EH5 7.26e-25 110 27 11 336 3 tuf Elongation factor Tu Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B6JET1 7.58e-25 110 27 14 388 3 tuf Elongation factor Tu Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B7IHU4 8.07e-25 110 29 8 291 3 tuf Elongation factor Tu Thermosipho africanus (strain TCF52B)
Q25820 8.2e-25 110 26 7 311 3 tufA Elongation factor Tu, apicoplast Plasmodium falciparum (isolate 3D7)
A1JIH3 8.49e-25 110 29 14 367 3 tuf1 Elongation factor Tu 1 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P64029 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain MW2)
A8YZP5 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBT9 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain MSSA476)
Q6GJC0 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain MRSA252)
P99152 8.89e-25 110 28 14 374 1 tuf Elongation factor Tu Staphylococcus aureus (strain N315)
P64028 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QEK0 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain Newman)
Q5HIC7 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain COL)
Q2YSB3 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQA2 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH9)
Q2G0N0 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ92 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain USA300)
A6TZ25 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain JH1)
A7WYX6 8.89e-25 110 28 14 374 3 tuf Elongation factor Tu Staphylococcus aureus (strain Mu3 / ATCC 700698)
A0KQ95 8.98e-25 110 28 14 375 3 tuf1 Elongation factor Tu Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B7JUP5 9.14e-25 110 29 6 288 3 tuf Elongation factor Tu Rippkaea orientalis (strain PCC 8801 / RF-1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_17160
Feature type CDS
Gene selB
Product selenocysteine-specific translation elongation factor
Location 40533 - 42395 (strand: -1)
Length 1863 (nucleotides) / 620 (amino acids)

Contig

Accession ZDB_535
Length 62169 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2149
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF03144 Elongation factor Tu domain 2
PF09106 Elongation factor SelB, winged helix
PF09107 Elongation factor SelB, winged helix
PF21214 Selenocysteine-specific elongation factor, winged helix domain
PF21458 Selenocysteine-specific elongation factor, winged helix 1/3

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3276 Translation, ribosomal structure and biogenesis (J) J Selenocysteine-specific translation elongation factor SelB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03833 selenocysteine-specific elongation factor - -

Protein Sequence

MIFATAGHVDHGKTALIQAVTGVDTTHLPEEKKRGMTIDLGYAYWPQDDDTVIGFVDVPGHEKFLGNMLAGIGGIRHILLIIACDDGVMAQTREHLAILRLAGRPQISVVLTKADRVPAERVEEVRQEITELLLSDGWPESPVFVTSSHTGEGLDTLRAHLRLHHQQQASDSRTEKRFRMAIDRVFSVKGAGLVVTGTALAGRVSTGDTLWVTGSDKSVRVRGIHAQNRQQEQAQAGDRVAINLSGDVSKETVSRGDWLLSEKPVQSAHRILAEIETDEGLKSWQPVHIHHGASHITGRVSLLSDDNIRPLLAEITLDTPLWLAEEDRLILRDISAQRTLAGARVLNLSSPRRGKRRPEFLAWLSERAAAQDDRDVLMCELPRGEISLPVFAWARQLTAEKLAECTAGLNLLINDGYALSAQRVETAKAILLATLADYHQSHSDQMGVGRDRLKRMALPVVSDSIVFPVIAQLLDEKQIVRTRGWLHLPGFGLAFDPAQDALWHSAEPLFQQEPWWVRDLAVKLGIDETAARQFLKKAAQLGHIMAIVPDRYYHRSQITEFAQVIREYNQTHEEGIGAAQFRDKYGMGRKLAVQILEFFDRTGFTRRRGDKHILRDEGLF

Flanking regions ( +/- flanking 50bp)

GATCTGCGTTGCCTTGAAGATGAAAACCGACTTTTACAGGCACTGTTACCATGATTTTTGCTACAGCCGGCCATGTTGACCACGGAAAAACGGCTCTTATTCAGGCGGTAACCGGCGTGGATACCACCCATCTGCCGGAAGAGAAAAAACGCGGAATGACCATCGACCTCGGCTATGCCTACTGGCCGCAGGATGATGATACGGTTATCGGCTTTGTGGATGTGCCGGGCCATGAAAAGTTTCTCGGCAATATGCTGGCGGGTATCGGCGGGATCCGCCATATCCTGCTGATTATTGCCTGCGACGACGGAGTGATGGCACAGACCCGCGAGCATCTGGCGATTCTGCGCTTAGCAGGGCGTCCGCAAATCTCTGTGGTGCTGACCAAAGCCGATCGCGTCCCGGCGGAGCGGGTTGAGGAAGTCCGGCAGGAAATCACAGAACTGCTGTTATCTGACGGCTGGCCGGAAAGCCCGGTCTTTGTCACCTCATCCCATACCGGCGAAGGGCTGGATACACTGCGGGCGCATCTGCGTCTGCACCATCAGCAGCAAGCCTCAGACAGCCGGACAGAAAAACGTTTCCGGATGGCGATTGACCGTGTTTTCAGTGTCAAAGGGGCGGGGCTGGTGGTAACCGGTACCGCGCTGGCCGGGCGTGTCAGCACCGGTGACACTTTATGGGTGACCGGCAGTGACAAATCTGTCCGTGTGCGCGGTATTCATGCCCAGAACCGCCAGCAGGAGCAGGCTCAGGCCGGTGACCGTGTGGCGATCAACCTGAGCGGTGATGTCAGCAAAGAGACGGTTTCCCGCGGTGACTGGCTGCTGAGCGAAAAACCGGTGCAGTCTGCACACCGCATTCTGGCGGAAATTGAAACAGATGAAGGTCTGAAAAGCTGGCAGCCGGTGCATATTCACCACGGCGCCAGCCATATCACCGGGCGGGTTTCCCTCCTGAGTGACGATAACATCCGTCCGCTGCTGGCGGAAATCACCCTTGATACCCCGCTCTGGCTGGCGGAGGAAGACCGGCTGATCCTGCGCGATATCAGTGCGCAGCGCACACTGGCGGGTGCCCGTGTGCTGAATTTGTCTTCCCCGCGACGCGGAAAACGTCGCCCGGAATTTCTGGCGTGGTTATCAGAACGGGCAGCGGCACAGGATGATCGCGATGTCCTGATGTGCGAACTGCCGCGCGGGGAAATTTCTCTGCCGGTGTTTGCCTGGGCGCGGCAGCTGACAGCGGAAAAACTGGCGGAATGTACTGCCGGGCTGAATCTGCTGATCAACGACGGTTATGCCCTTTCGGCACAACGGGTTGAAACGGCAAAAGCCATTCTGCTGGCTACTCTGGCGGATTATCATCAGTCACACAGCGACCAGATGGGCGTCGGCCGTGACAGGCTGAAACGGATGGCATTACCGGTGGTTTCTGATTCCATCGTATTTCCGGTTATTGCACAATTACTGGATGAAAAACAGATTGTCAGAACCCGTGGCTGGCTCCATCTGCCCGGATTCGGTCTGGCTTTCGATCCGGCACAGGACGCGCTCTGGCACAGTGCGGAACCGCTGTTTCAGCAGGAGCCGTGGTGGGTTCGTGATCTGGCCGTTAAACTCGGCATTGATGAAACCGCCGCCCGTCAGTTTCTGAAAAAAGCCGCACAGCTGGGTCATATTATGGCGATTGTGCCTGACCGCTATTATCACCGGTCACAAATCACGGAATTCGCGCAGGTTATCCGTGAATATAATCAGACACATGAAGAAGGTATCGGCGCGGCACAATTCAGGGATAAATACGGCATGGGGCGTAAGCTGGCCGTACAGATTCTGGAGTTTTTTGACAGGACCGGTTTTACCCGCCGCAGAGGGGACAAACATATTTTGCGGGATGAGGGACTATTCTGATTTTCTTCAAAAAGGATTTAAGACATGAAGATCGATTTGGAAAATTTTGT