Homologs in group_2068

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15475 FBDBKF_15475 87.2 Morganella morganii S1 atpF F0F1 ATP synthase subunit B
EHELCC_15835 EHELCC_15835 87.2 Morganella morganii S2 atpF F0F1 ATP synthase subunit B
NLDBIP_16535 NLDBIP_16535 87.2 Morganella morganii S4 atpF F0F1 ATP synthase subunit B
LHKJJB_16270 LHKJJB_16270 87.2 Morganella morganii S3 atpF F0F1 ATP synthase subunit B
HKOGLL_16040 HKOGLL_16040 87.2 Morganella morganii S5 atpF F0F1 ATP synthase subunit B
F4V73_RS17670 F4V73_RS17670 86.5 Morganella psychrotolerans atpF F0F1 ATP synthase subunit B

Distribution of the homologs in the orthogroup group_2068

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2068

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F0E3 2.06e-105 300 100 0 156 3 atpF ATP synthase subunit b Proteus mirabilis (strain HI4320)
Q3YVP0 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella sonnei (strain Ss046)
P0ABA3 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella flexneri
Q0SYU0 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella flexneri serotype 5b (strain 8401)
Q329S5 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella dysenteriae serotype 1 (strain Sd197)
Q31UN6 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella boydii serotype 4 (strain Sb227)
B2TUN9 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK81 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4J6 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain UTI89 / UPEC)
B1LL63 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain SMS-3-5 / SECEC)
B6I3X3 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain SE11)
P0ABA0 1.29e-93 270 87 0 156 1 atpF ATP synthase subunit b Escherichia coli (strain K12)
B1IX02 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABA1 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX3 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6J9 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O9:H4 (strain HS)
B1X9W4 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain K12 / DH10B)
B5YXE0 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABA2 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O157:H7
A7ZTU8 1.29e-93 270 87 0 156 3 atpF ATP synthase subunit b Escherichia coli O139:H28 (strain E24377A / ETEC)
A1JTD1 5.08e-93 269 87 0 156 3 atpF ATP synthase subunit b Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7MMX3 1.98e-92 268 87 0 156 3 atpF ATP synthase subunit b Cronobacter sakazakii (strain ATCC BAA-894)
B1JRM8 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q4 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSI9 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pestis (strain Pestoides F)
Q1CCH1 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5U3 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM4 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pestis
B2K843 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C091 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE4 3.18e-92 267 87 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8ACP2 3.28e-92 267 86 0 156 3 atpF ATP synthase subunit b Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WGF1 9.3e-92 266 85 0 156 3 atpF ATP synthase subunit b Enterobacter sp. (strain 638)
Q7CPE4 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGD7 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella typhi
B4TN35 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella schwarzengrund (strain CVM19633)
B5BIP0 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi A (strain AKU_12601)
A9MXB0 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKW8 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYD5 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella newport (strain SL254)
B4TAX6 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella heidelberg (strain SL476)
B5QVD6 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella enteritidis PT4 (strain P125109)
B5FN37 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella dublin (strain CT_02021853)
Q57HX5 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella choleraesuis (strain SC-B67)
A9MJR5 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EZ00 1.84e-91 265 85 0 156 3 atpF ATP synthase subunit b Salmonella agona (strain SL483)
A8G7M4 3.14e-91 265 87 0 156 3 atpF ATP synthase subunit b Serratia proteamaculans (strain 568)
B5XZM0 4e-91 264 84 0 156 3 atpF ATP synthase subunit b Klebsiella pneumoniae (strain 342)
Q7NA90 4.18e-91 264 84 0 156 3 atpF ATP synthase subunit b Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B5RFV9 9.21e-91 263 85 0 156 3 atpF ATP synthase subunit b Salmonella gallinarum (strain 287/91 / NCTC 13346)
A6TG40 4.04e-89 259 84 0 154 3 atpF ATP synthase subunit b Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VCA8 5.04e-89 259 82 0 156 3 atpF ATP synthase subunit b Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6CYJ1 7.25e-84 246 85 0 156 3 atpF ATP synthase subunit b Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NQ90 2.19e-82 242 82 0 156 3 atpF ATP synthase subunit b Sodalis glossinidius (strain morsitans)
A0KQY2 1.11e-76 228 73 0 156 3 atpF ATP synthase subunit b Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B1KQ38 1.81e-73 219 68 0 156 3 atpF ATP synthase subunit b Shewanella woodyi (strain ATCC 51908 / MS32)
A8G1W9 1.67e-72 217 67 0 156 3 atpF ATP synthase subunit b Shewanella sediminis (strain HAW-EB3)
A4STP7 5.16e-72 216 69 0 156 3 atpF ATP synthase subunit b Aeromonas salmonicida (strain A449)
A3QJR4 3.15e-71 214 66 0 156 3 atpF ATP synthase subunit b Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8HAG7 3.18e-71 214 67 0 156 3 atpF ATP synthase subunit b Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1T0Z3 6.7e-71 213 67 0 156 3 atpF ATP synthase subunit b Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0TQF8 7e-71 213 67 0 156 3 atpF ATP synthase subunit b Shewanella halifaxensis (strain HAW-EB4)
Q12HP7 4.71e-70 211 64 0 156 3 atpF ATP synthase subunit b Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9KX10 6.33e-70 211 64 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS195)
A6WUJ4 6.33e-70 211 64 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS185)
Q7MGH6 6.4e-70 211 65 0 156 3 atpF ATP synthase subunit b Vibrio vulnificus (strain YJ016)
Q8DDH2 6.4e-70 211 65 0 156 3 atpF ATP synthase subunit b Vibrio vulnificus (strain CMCP6)
A3DAR8 9.7e-70 210 64 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q8E8B6 1.06e-69 210 64 0 156 3 atpF ATP synthase subunit b Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9KNH1 1.87e-69 209 65 0 156 3 atpF ATP synthase subunit b Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F475 1.87e-69 209 65 0 156 3 atpF ATP synthase subunit b Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q07VU0 3.69e-69 209 64 0 156 3 atpF ATP synthase subunit b Shewanella frigidimarina (strain NCIMB 400)
B6EHU1 7.73e-67 203 64 0 156 3 atpF ATP synthase subunit b Aliivibrio salmonicida (strain LFI1238)
Q6LLG4 9.84e-67 202 62 0 156 3 atpF ATP synthase subunit b Photobacterium profundum (strain SS9)
B5FCZ5 1.1e-66 202 65 0 154 3 atpF ATP synthase subunit b Aliivibrio fischeri (strain MJ11)
Q5E1N3 1.1e-66 202 65 0 154 3 atpF ATP synthase subunit b Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1SBU4 3.7e-66 201 67 0 156 3 atpF ATP synthase subunit b Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q15MU0 8.41e-66 200 61 0 156 3 atpF2 ATP synthase subunit b 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87KA4 1.04e-63 195 66 0 156 3 atpF ATP synthase subunit b Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0L2T2 2.44e-63 194 66 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain ANA-3)
P12989 2.88e-63 194 66 0 156 3 atpF ATP synthase subunit b Vibrio alginolyticus
A7N0Y5 5.61e-63 193 65 0 156 3 atpF1 ATP synthase subunit b 1 Vibrio campbellii (strain ATCC BAA-1116)
Q0HPF7 8.6e-63 192 65 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain MR-7)
Q0HD75 8.6e-63 192 65 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain MR-4)
Q48AW4 3.23e-62 191 58 0 156 3 atpF ATP synthase subunit b Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QZI2 2.95e-61 189 58 0 156 3 atpF ATP synthase subunit b Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1RQB4 6.93e-61 188 64 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain W3-18-1)
A4YCI2 6.93e-61 188 64 0 156 3 atpF ATP synthase subunit b Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q3IK46 8.53e-61 187 57 0 156 3 atpF ATP synthase subunit b Pseudoalteromonas translucida (strain TAC 125)
B0BRX6 1.03e-60 187 60 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2P7 1.03e-60 187 60 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q65Q03 5.13e-60 186 60 0 156 3 atpF ATP synthase subunit b Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7VPP4 1.25e-59 184 58 0 156 3 atpF ATP synthase subunit b Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A3N2U8 2.86e-59 184 59 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q1LTV0 5.43e-58 180 58 0 156 3 atpF ATP synthase subunit b Baumannia cicadellinicola subsp. Homalodisca coagulata
Q1QSC6 6.22e-57 178 56 0 156 3 atpF ATP synthase subunit b Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2S6N7 3.24e-56 176 55 0 156 3 atpF ATP synthase subunit b Hahella chejuensis (strain KCTC 2396)
A5UGZ3 3.62e-56 176 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain PittGG)
A5UA07 4.6e-56 176 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain PittEE)
P43720 6.39e-56 175 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN60 6.39e-56 175 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain 86-028NP)
A6VL61 7.45e-56 175 61 0 156 3 atpF ATP synthase subunit b Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CKW4 2.13e-55 174 60 0 156 3 atpF ATP synthase subunit b Pasteurella multocida (strain Pm70)
A1U7H8 5.05e-55 173 55 0 156 3 atpF ATP synthase subunit b Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B0UWG9 6.45e-54 170 58 0 156 3 atpF ATP synthase subunit b Histophilus somni (strain 2336)
Q0I5W9 6.45e-54 170 58 0 156 3 atpF ATP synthase subunit b Histophilus somni (strain 129Pt)
A5WBA7 2.56e-53 169 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JFU5 2.98e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain W619)
B0KRB2 2.98e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain GB-1)
Q87TT0 4.62e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZL20 5.04e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas syringae pv. syringae (strain B728a)
B3PIT1 5.56e-53 168 53 0 156 3 atpF ATP synthase subunit b Cellvibrio japonicus (strain Ueda107)
Q494C7 7.84e-53 167 52 0 156 3 atpF ATP synthase subunit b Blochmanniella pennsylvanica (strain BPEN)
Q1I2I3 7.89e-53 167 50 0 156 3 atpF ATP synthase subunit b Pseudomonas entomophila (strain L48)
Q88BX0 8.15e-53 167 50 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48BG1 1.3e-52 167 50 0 156 3 atpF ATP synthase subunit b Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4K3A5 1.95e-52 166 50 0 156 3 atpF ATP synthase subunit b Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K437 2.2e-52 166 50 0 156 3 atpF ATP synthase subunit b Pseudomonas fluorescens (strain Pf0-1)
A6VF36 3.13e-52 166 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain PA7)
Q9HT16 3.3e-52 166 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF0 3.3e-52 166 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain UCBPP-PA14)
A6W3T2 4.04e-50 160 52 0 156 3 atpF2 ATP synthase subunit b 2 Marinomonas sp. (strain MWYL1)
Q3SF62 7.46e-50 160 51 0 156 3 atpF ATP synthase subunit b Thiobacillus denitrificans (strain ATCC 25259)
Q1Q895 6.21e-49 157 50 0 156 3 atpF ATP synthase subunit b Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A4Y191 1.12e-48 157 48 0 156 3 atpF ATP synthase subunit b Pseudomonas mendocina (strain ymp)
Q4FQ33 1.18e-48 157 50 0 156 3 atpF ATP synthase subunit b Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4VS66 2.46e-48 156 51 0 156 3 atpF ATP synthase subunit b Stutzerimonas stutzeri (strain A1501)
Q0A4M4 4.53e-48 155 46 0 156 3 atpF ATP synthase subunit b Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0VKX0 1.39e-47 154 48 0 156 3 atpF ATP synthase subunit b Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q21DK4 2.07e-47 154 53 0 156 3 atpF ATP synthase subunit b Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q6FFK4 3.16e-47 153 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P57120 5.35e-47 153 46 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A7N2U5 1.31e-46 152 45 0 156 3 atpF2 ATP synthase subunit b 2 Vibrio campbellii (strain ATCC BAA-1116)
A1WZT5 9.64e-46 149 47 0 156 3 atpF ATP synthase subunit b Halorhodospira halophila (strain DSM 244 / SL1)
A5WBV7 1.7e-44 146 50 0 156 3 atpF ATP synthase subunit b Psychrobacter sp. (strain PRwf-1)
Q83AF9 1.7e-44 146 44 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBC6 1.7e-44 146 44 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KBG1 1.7e-44 146 44 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain Dugway 5J108-111)
B6J2D6 1.7e-44 146 44 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain CbuG_Q212)
B6J959 1.7e-44 146 44 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain CbuK_Q154)
Q1GXM6 2.52e-43 143 45 0 156 3 atpF ATP synthase subunit b Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q31DL6 5.17e-43 142 49 0 153 3 atpF ATP synthase subunit b Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7VQW0 1.21e-42 142 44 0 156 3 atpF ATP synthase subunit b Blochmanniella floridana
Q89B43 1.91e-41 138 42 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q82XQ2 2.82e-41 138 47 0 156 3 atpF ATP synthase subunit b Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2T7K4 9.37e-41 137 44 0 156 3 atpF ATP synthase subunit b Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q60CR8 9.55e-41 137 44 0 156 3 atpF1 ATP synthase subunit b 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q13SP8 1.63e-40 136 43 0 156 3 atpF ATP synthase subunit b Paraburkholderia xenovorans (strain LB400)
Q12GQ4 3.74e-40 135 44 0 156 3 atpF ATP synthase subunit b Polaromonas sp. (strain JS666 / ATCC BAA-500)
A4JA31 5.48e-40 135 44 0 156 3 atpF ATP synthase subunit b Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0AJB4 6.29e-40 135 46 0 156 3 atpF ATP synthase subunit b Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2JJK3 6.81e-40 134 43 0 156 3 atpF ATP synthase subunit b Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1BRA6 8.85e-40 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia orbicola (strain AU 1054)
B1JSV3 8.85e-40 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia orbicola (strain MC0-3)
B4EEY5 8.85e-40 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K2X9 8.85e-40 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia cenocepacia (strain HI2424)
Q0BJL9 1.02e-39 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQL0 1.02e-39 134 44 0 156 3 atpF ATP synthase subunit b Burkholderia ambifaria (strain MC40-6)
Q39KY0 2.33e-39 133 43 0 156 3 atpF ATP synthase subunit b Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B0VBP7 3.2e-39 133 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AYE)
A3M140 3.2e-39 133 50 0 156 1 atpF ATP synthase subunit b Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I0Z8 3.2e-39 133 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain ACICU)
B7I1W0 3.2e-39 133 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AB0057)
B7H298 3.2e-39 133 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AB307-0294)
Q477Z5 3.69e-39 132 44 0 156 3 atpF ATP synthase subunit b Dechloromonas aromatica (strain RCB)
A9AJG0 6.64e-39 132 44 0 156 3 atpF ATP synthase subunit b Burkholderia multivorans (strain ATCC 17616 / 249)
B0VNK0 1.39e-38 131 50 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain SDF)
Q5WSG4 3.22e-38 130 47 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Lens)
Q5ZR97 3.22e-38 130 47 0 156 3 atpF ATP synthase subunit b Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III7 3.22e-38 130 47 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Corby)
Q5X0N9 3.22e-38 130 47 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Paris)
Q2STE5 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PH6 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain K96243)
A3NF44 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 668)
Q3JXV4 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 1710b)
A3P0Z4 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 1106a)
A1V8T5 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain SAVP1)
Q62FR9 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain ATCC 23344)
A2S6K2 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain NCTC 10229)
A3MQJ5 3.96e-38 130 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain NCTC 10247)
Q2YCA7 6.82e-38 129 46 0 156 3 atpF1 ATP synthase subunit b 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8D3J7 2.37e-37 128 37 0 156 3 atpF ATP synthase subunit b Wigglesworthia glossinidia brevipalpis
Q223D2 9.1e-37 127 41 0 156 3 atpF1 ATP synthase subunit b 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A2SC66 1.12e-36 126 44 0 156 3 atpF ATP synthase subunit b Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
O51876 1.96e-36 126 41 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B4SJS3 2.3e-36 125 41 0 156 3 atpF ATP synthase subunit b Stenotrophomonas maltophilia (strain R551-3)
B2FHZ2 4.81e-36 125 41 0 156 3 atpF ATP synthase subunit b Stenotrophomonas maltophilia (strain K279a)
Q3BP11 6.31e-36 124 42 0 156 3 atpF ATP synthase subunit b Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGG3 6.31e-36 124 42 0 156 3 atpF ATP synthase subunit b Xanthomonas axonopodis pv. citri (strain 306)
Q5H4Y8 7.6e-36 124 42 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB4 7.6e-36 124 42 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q8 7.6e-36 124 42 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q46VX6 1.27e-35 124 41 0 156 3 atpF ATP synthase subunit b Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9BPU3 1.46e-35 124 44 0 156 3 atpF ATP synthase subunit b Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8PCZ9 3.02e-35 123 42 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWC6 3.02e-35 123 42 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain B100)
Q4UQF0 3.02e-35 123 42 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain 8004)
B0TWS3 4.88e-35 122 43 0 153 3 atpF ATP synthase subunit b Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1LHK6 1.46e-34 121 40 0 156 3 atpF ATP synthase subunit b Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0K5M3 1.6e-34 121 40 0 156 3 atpF ATP synthase subunit b Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B3R7L9 2.16e-34 120 40 0 156 3 atpF ATP synthase subunit b Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A1W2T3 2.52e-34 120 44 0 156 3 atpF ATP synthase subunit b Acidovorax sp. (strain JS42)
B2UGV3 3.61e-34 120 40 0 156 3 atpF ATP synthase subunit b Ralstonia pickettii (strain 12J)
A1VIU8 9.28e-34 119 41 0 156 3 atpF ATP synthase subunit b Polaromonas naphthalenivorans (strain CJ2)
B4RJF6 1.6e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z4 1.6e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KW15 1.82e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7DD66 1.82e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1IPX1 1.82e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M119 1.82e-33 118 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup C (strain 053442)
B5ER46 2.05e-33 118 37 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JB88 2.05e-33 118 37 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A1AXU6 2.38e-33 118 38 0 156 3 atpF ATP synthase subunit b Ruthia magnifica subsp. Calyptogena magnifica
A1TJ37 2.97e-33 117 42 0 156 3 atpF ATP synthase subunit b Paracidovorax citrulli (strain AAC00-1)
Q8XU72 3.1e-33 117 40 0 156 3 atpF ATP synthase subunit b 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1WF54 4.95e-33 117 42 0 156 3 atpF ATP synthase subunit b Verminephrobacter eiseniae (strain EF01-2)
Q3J6M7 7e-33 117 42 0 156 3 atpF ATP synthase subunit b Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B0U5A2 7.39e-33 117 41 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain M12)
P41172 7.54e-33 117 36 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferridurans
A4SUT0 1.29e-32 116 40 0 156 3 atpF ATP synthase subunit b Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q9PE81 2.01e-32 115 41 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain 9a5c)
A5CVF9 2.35e-32 115 40 0 152 3 atpF ATP synthase subunit b Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q7VU48 5.28e-32 114 48 0 156 3 atpF ATP synthase subunit b Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A4GAH3 1.14e-31 114 43 0 156 3 atpF ATP synthase subunit b Herminiimonas arsenicoxydans
B1XSD0 1.92e-31 113 41 0 156 3 atpF ATP synthase subunit b Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q7W3A6 2.93e-31 112 48 0 156 3 atpF ATP synthase subunit b Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM5 2.93e-31 112 48 0 156 3 atpF ATP synthase subunit b Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A6T474 3.16e-30 110 44 0 156 3 atpF ATP synthase subunit b Janthinobacterium sp. (strain Marseille)
A9HY36 3.26e-30 110 46 0 156 3 atpF ATP synthase subunit b Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A5EXJ9 6.81e-30 109 37 0 153 3 atpF ATP synthase subunit b Dichelobacter nodosus (strain VCS1703A)
A4IW20 1.97e-29 108 43 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK7 3.18e-29 107 43 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q8E3 3.18e-29 107 43 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. novicida (strain U112)
B2SEX7 3.18e-29 107 43 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14K10 3.18e-29 107 43 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BK80 5.76e-29 107 42 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1H8 5.76e-29 107 42 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain LVS)
A7NEH8 5.76e-29 107 42 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q87E86 1.69e-26 100 41 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I864 1.69e-26 100 41 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain M23)
A1K1R8 7.24e-26 99 44 0 156 3 atpF ATP synthase subunit b Azoarcus sp. (strain BH72)
Q5P4E6 2.02e-24 95 41 0 156 3 atpF ATP synthase subunit b Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4SGZ0 3.67e-22 90 38 2 154 3 atpF ATP synthase subunit b Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B4SH38 1.01e-21 89 38 2 154 3 atpF ATP synthase subunit b Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B4S6E4 1.9e-21 88 36 2 154 3 atpF2 ATP synthase subunit b 2 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q3ANW4 4.81e-21 87 38 3 154 3 atpF ATP synthase subunit b Chlorobium chlorochromatii (strain CaD3)
B3EIJ6 2.61e-20 85 37 2 156 3 atpF ATP synthase subunit b Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q3B143 4.91e-20 84 36 0 150 3 atpF2 ATP synthase subunit b 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
B3EQ96 5.35e-20 84 33 2 154 3 atpF ATP synthase subunit b Chlorobium phaeobacteroides (strain BS1)
B3QLV1 1.17e-19 83 35 2 154 3 atpF ATP synthase subunit b Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A0M6G6 1.55e-19 83 33 0 134 3 atpF ATP synthase subunit b Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B0TI54 5.22e-19 81 30 0 156 3 atpF ATP synthase subunit b Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B2A3G6 1.37e-18 80 33 1 155 3 atpF ATP synthase subunit b Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q11YP3 3.96e-18 79 31 0 137 3 atpF ATP synthase subunit b Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q24MN7 5.86e-18 79 30 0 156 3 atpF ATP synthase subunit b Desulfitobacterium hafniense (strain Y51)
A6H2D9 6.13e-18 79 34 1 144 3 atpF ATP synthase subunit b Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8KGE9 6.87e-18 79 34 3 161 3 atpF ATP synthase subunit b Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A4ITJ3 1.11e-17 78 30 2 157 3 atpF ATP synthase subunit b Geobacillus thermodenitrificans (strain NG80-2)
B1LBC3 1.28e-17 78 31 1 156 3 atpF ATP synthase subunit b Thermotoga sp. (strain RQ2)
A5ILW8 1.28e-17 78 31 1 156 3 atpF ATP synthase subunit b Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1U9 1.28e-17 78 31 1 156 3 atpF ATP synthase subunit b Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A1BJW4 2.21e-17 77 34 0 152 3 atpF ATP synthase subunit b Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A1A3C9 2.32e-16 75 31 1 151 3 atpF ATP synthase subunit b Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A5FL32 5.42e-16 73 31 1 135 3 atpF ATP synthase subunit b Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A5CYE6 6.02e-16 73 30 2 159 3 atpF ATP synthase subunit b Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A6TK61 8.74e-16 73 30 1 148 3 atpF ATP synthase subunit b Alkaliphilus metalliredigens (strain QYMF)
Q5WB74 1.14e-15 72 32 0 149 3 atpF ATP synthase subunit b Shouchella clausii (strain KSM-K16)
Q5KUI9 4.25e-15 71 31 3 154 3 atpF ATP synthase subunit b Geobacillus kaustophilus (strain HTA426)
A7HJW1 4.29e-15 71 30 0 153 3 atpF ATP synthase subunit b Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A8F3J8 4.82e-15 71 29 0 147 3 atpF ATP synthase subunit b Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A6L4M2 6.69e-15 70 30 1 154 3 atpF ATP synthase subunit b Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
P22481 1.45e-14 70 30 0 152 3 atpF ATP synthase subunit b Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P21904 1.53e-14 70 30 3 167 1 atpF ATP synthase subunit b, sodium ion specific Propionigenium modestum
B3EU96 1.85e-14 69 30 3 153 3 atpF ATP synthase subunit b Amoebophilus asiaticus (strain 5a2)
Q02XA1 2.3e-14 69 32 3 156 3 atpF ATP synthase subunit b Lactococcus lactis subsp. cremoris (strain SK11)
P0A2Z1 2.3e-14 69 32 3 156 3 atpF ATP synthase subunit b Lactococcus lactis subsp. cremoris (strain MG1363)
P0A2Z0 2.3e-14 69 32 3 156 3 atpF ATP synthase subunit b Lactococcus lactis subsp. lactis (strain IL1403)
Q67TC1 4.28e-14 68 32 0 150 3 atpF ATP synthase subunit b Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A1SHI7 7.79e-14 68 31 1 146 3 atpF ATP synthase subunit b Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q9K4D7 9.75e-14 68 32 1 146 3 atpF ATP synthase subunit b Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8G7A9 1.07e-13 68 30 1 151 3 atpF ATP synthase subunit b Bifidobacterium longum (strain NCC 2705)
Q6GEW8 1.16e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MRSA252)
B3DTV4 1.16e-13 67 30 1 151 3 atpF ATP synthase subunit b Bifidobacterium longum (strain DJO10A)
Q7A0C4 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MW2)
A8YY74 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7K3 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MSSA476)
Q7A4E7 1.17e-13 67 26 0 151 1 atpF ATP synthase subunit b Staphylococcus aureus (strain N315)
Q99SF1 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIV1 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Newman)
Q5HE93 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain COL)
Q2YUJ7 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUQ2 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain JH9)
Q2G2F8 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF20 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain USA300)
A6U3J2 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain JH1)
A7X4U9 1.17e-13 67 26 0 151 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Mu3 / ATCC 700698)
A4J9A3 1.67e-13 67 29 0 155 3 atpF ATP synthase subunit b Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8EM79 2.34e-13 67 33 2 135 3 atpF ATP synthase subunit b Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8CNJ3 2.46e-13 67 25 0 151 3 atpF ATP synthase subunit b Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB5 2.46e-13 67 25 0 151 3 atpF ATP synthase subunit b Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8RGD8 2.8e-13 66 30 0 156 3 atpF ATP synthase subunit b Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4L7Y8 3.16e-13 67 27 0 151 3 atpF ATP synthase subunit b Staphylococcus haemolyticus (strain JCSC1435)
Q03LX7 7.28e-13 65 28 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5J5 7.28e-13 65 28 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M108 7.28e-13 65 28 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain CNRZ 1066)
A8YUJ7 8.11e-13 65 30 4 164 3 atpF ATP synthase subunit b Lactobacillus helveticus (strain DPC 4571)
P50013 8.18e-13 65 32 2 146 3 atpF ATP synthase subunit b Streptomyces lividans
Q6AG62 8.51e-13 65 32 1 153 3 atpF ATP synthase subunit b Leifsonia xyli subsp. xyli (strain CTCB07)
A4VVK3 8.74e-13 65 31 5 164 3 atpF ATP synthase subunit b Streptococcus suis (strain 05ZYH33)
A4W1W1 8.74e-13 65 31 5 164 3 atpF ATP synthase subunit b Streptococcus suis (strain 98HAH33)
Q71WP5 9.98e-13 65 27 4 164 3 atpF ATP synthase subunit b Listeria monocytogenes serotype 4b (strain F2365)
Q3A942 1.17e-12 65 33 2 144 3 atpF ATP synthase subunit b Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B1HM52 1.18e-12 65 26 0 151 3 atpF ATP synthase subunit b Lysinibacillus sphaericus (strain C3-41)
A5CQ56 1.25e-12 65 39 1 135 3 atpF ATP synthase subunit b Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A8AYG5 1.4e-12 64 28 2 161 3 atpF ATP synthase subunit b Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B1W0A7 1.6e-12 65 32 2 152 3 atpF ATP synthase subunit b Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0ALL7 1.97e-12 64 26 4 164 3 atpF ATP synthase subunit b Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B3QZF0 2.05e-12 64 34 0 150 3 atpF ATP synthase subunit b Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A4XKX4 2.55e-12 64 31 2 148 3 atpF ATP synthase subunit b Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q82J80 2.68e-12 64 34 2 144 3 atpF ATP synthase subunit b Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P41014 2.78e-12 63 27 2 143 3 atpF ATP synthase subunit b Bacillus caldotenax
Q9RGY5 2.86e-12 64 30 4 164 2 atpF ATP synthase subunit b Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q4JUJ6 3.36e-12 64 29 1 151 3 atpF ATP synthase subunit b Corynebacterium jeikeium (strain K411)
B4UJU5 3.83e-12 63 28 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter sp. (strain K)
Q814V8 3.92e-12 63 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK6 3.92e-12 63 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain B4264)
Q8Y4B8 4.11e-12 63 27 4 164 3 atpF ATP synthase subunit b Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q927W0 4.2e-12 63 26 4 164 3 atpF ATP synthase subunit b Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0AUC9 4.92e-12 63 28 0 145 3 atpF ATP synthase subunit b Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
O05098 5.48e-12 63 24 1 157 3 atpF ATP synthase subunit b Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A3CM10 5.72e-12 63 28 4 164 3 atpF ATP synthase subunit b Streptococcus sanguinis (strain SK36)
Q03EL0 5.76e-12 63 26 3 163 3 atpF ATP synthase subunit b Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
P09221 6.85e-12 63 32 4 146 1 atpF ATP synthase subunit b Bacillus sp. (strain PS3)
A8MJW3 8.11e-12 62 25 0 153 3 atpF ATP synthase subunit b Alkaliphilus oremlandii (strain OhILAs)
Q8E076 8.59e-12 62 27 3 162 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5V2 8.59e-12 62 27 3 162 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype III (strain NEM316)
Q3K1J9 8.59e-12 62 27 3 162 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B7HY69 9.17e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain AH187)
Q72XE4 9.17e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HAX5 9.46e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630T9 9.46e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ZK / E33L)
B7JGN4 9.46e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain AH820)
Q81JZ1 9.46e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus anthracis
A0RL99 9.46e-12 62 28 1 159 3 atpF ATP synthase subunit b Bacillus thuringiensis (strain Al Hakam)
Q0ZS23 9.53e-12 62 24 0 156 1 atpF ATP synthase subunit b, sodium ion specific Clostridium paradoxum
B7IQW2 1.13e-11 62 28 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain G9842)
A9VSA7 1.15e-11 62 27 1 159 3 atpF ATP synthase subunit b Bacillus mycoides (strain KBAB4)
Q9K6H1 1.36e-11 62 36 6 158 3 atpF ATP synthase subunit b Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0SGP5 1.86e-11 62 33 1 151 3 atpF ATP synthase subunit b Rhodococcus jostii (strain RHA1)
P20601 2.39e-11 61 27 0 153 3 atpF ATP synthase subunit b Priestia megaterium (strain ATCC 12872 / QMB1551)
A8L3W1 2.87e-11 62 30 1 146 3 atpF ATP synthase subunit b Parafrankia sp. (strain EAN1pec)
A7HIW7 3.04e-11 61 28 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter sp. (strain Fw109-5)
Q8KRV2 3.55e-11 61 30 3 157 1 atpF ATP synthase subunit b, sodium ion specific Ilyobacter tartaricus
Q2RFX5 4e-11 61 31 3 145 1 atpF ATP synthase subunit b Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6MS90 4.35e-11 61 26 2 153 3 atpF ATP synthase subunit b Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A9WNC4 4.35e-11 61 32 1 146 3 atpF ATP synthase subunit b Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q04BA7 4.4e-11 60 28 4 164 3 atpF ATP synthase subunit b Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAW9 4.4e-11 60 28 4 164 3 atpF ATP synthase subunit b Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B2GLY6 5.15e-11 60 32 2 152 3 atpF ATP synthase subunit b Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q49Z54 5.61e-11 60 24 0 151 3 atpF ATP synthase subunit b Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B1I6L8 5.86e-11 60 30 2 160 3 atpF ATP synthase subunit b Desulforudis audaxviator (strain MP104C)
Q5Z0Y5 6.1e-11 60 36 1 136 3 atpF ATP synthase subunit b Nocardia farcinica (strain IFM 10152)
B3WDL4 7.17e-11 60 26 3 160 3 atpF ATP synthase subunit b Lacticaseibacillus casei (strain BL23)
P95785 8.85e-11 60 26 3 160 3 atpF ATP synthase subunit b Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A6L8N7 9.1e-11 60 27 1 154 3 atpF ATP synthase subunit b Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q2ST38 1.05e-10 60 26 2 153 3 atpF ATP synthase subunit b Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A3DIM5 1.1e-10 60 28 2 154 3 atpF ATP synthase subunit b Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q2IHP6 1.43e-10 59 27 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter dehalogenans (strain 2CP-C)
B3E0Z6 1.43e-10 59 27 1 150 3 atpF ATP synthase subunit b Methylacidiphilum infernorum (isolate V4)
A9BFX7 1.55e-10 59 24 0 156 3 atpF ATP synthase subunit b Petrotoga mobilis (strain DSM 10674 / SJ95)
A7NIR3 1.61e-10 59 30 2 151 3 atpF ATP synthase subunit b Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A0Q2Z8 1.91e-10 58 24 1 157 3 atpF ATP synthase subunit b Clostridium novyi (strain NT)
Q74K19 2.25e-10 58 29 3 144 3 atpF ATP synthase subunit b Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A6W7G5 2.27e-10 59 34 1 135 3 atpF ATP synthase subunit b Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
P0A2Z3 4.56e-10 58 27 0 144 1 atpF ATP synthase subunit b Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IQX4 4.56e-10 58 27 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae (strain CGSP14)
P0A2Z2 4.56e-10 58 27 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1ICT3 4.56e-10 58 27 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae (strain Hungary19A-6)
B5E675 4.56e-10 58 27 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 19F (strain G54)
Q04HT5 4.56e-10 58 27 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B0RED8 4.66e-10 58 36 1 135 3 atpF ATP synthase subunit b Clavibacter sepedonicus
Q831A1 4.84e-10 58 28 3 160 3 atpF ATP synthase subunit b Enterococcus faecalis (strain ATCC 700802 / V583)
A7GV60 5.35e-10 58 26 0 152 3 atpF ATP synthase subunit b Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q03A22 5.83e-10 57 26 3 160 3 atpF ATP synthase subunit b Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A0JY68 6.26e-10 58 31 1 145 3 atpF ATP synthase subunit b Arthrobacter sp. (strain FB24)
B6YR08 6.82e-10 57 25 1 153 3 atpF ATP synthase subunit b Azobacteroides pseudotrichonymphae genomovar. CFP2
A9AVV0 7.12e-10 57 25 2 154 3 atpF ATP synthase subunit b Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A0LDW8 1.13e-09 57 32 2 158 3 atpF ATP synthase subunit b Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q042L1 1.33e-09 57 30 3 144 3 atpF ATP synthase subunit b Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A6LQH2 1.38e-09 57 26 1 157 3 atpF ATP synthase subunit b Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q6A8C3 1.45e-09 57 31 2 151 3 atpF ATP synthase subunit b Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q8FQ24 1.47e-09 57 29 1 151 3 atpF ATP synthase subunit b Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q1AVH5 1.76e-09 57 26 0 153 3 atpF ATP synthase subunit b Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A5UQN7 1.8e-09 56 31 0 132 3 atpF ATP synthase subunit b Roseiflexus sp. (strain RS-1)
A9HDM4 1.97e-09 56 27 0 154 3 atpF ATP synthase subunit b Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B2KEW8 2.09e-09 56 30 3 138 3 atpF ATP synthase subunit b Elusimicrobium minutum (strain Pei191)
A4T8J9 2.46e-09 58 30 4 156 3 atpFH ATP synthase subunit b-delta Mycolicibacterium gilvum (strain PYR-GCK)
Q2S434 3.06e-09 56 34 0 144 3 atpF ATP synthase subunit b Salinibacter ruber (strain DSM 13855 / M31)
A1TD58 4.56e-09 57 34 7 158 3 atpFH ATP synthase subunit b-delta Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q03QY4 5.24e-09 55 29 2 132 3 atpF ATP synthase subunit b Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8A9U9 6e-09 55 30 7 162 3 atpF ATP synthase subunit b Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1B550 6.19e-09 57 24 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain MCS)
A1UJY7 6.19e-09 57 24 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain KMS)
A3Q3B4 6.19e-09 57 24 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain JLS)
A5IYE1 6.61e-09 55 25 2 152 3 atpF ATP synthase subunit b Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q1WUD0 6.83e-09 55 27 2 147 3 atpF ATP synthase subunit b Ligilactobacillus salivarius (strain UCC118)
Q64UA6 7.15e-09 55 25 4 169 3 atpF ATP synthase subunit b Bacteroides fragilis (strain YCH46)
Q5LD84 7.15e-09 55 25 4 169 3 atpF ATP synthase subunit b Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A9WGS8 7.26e-09 55 28 3 125 3 atpF ATP synthase subunit b Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q6MAK3 7.55e-09 54 26 0 150 3 atpF ATP synthase subunit b Protochlamydia amoebophila (strain UWE25)
Q65DX0 8.28e-09 55 32 3 160 3 atpF ATP synthase subunit b Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q88UT9 8.86e-09 55 26 4 153 3 atpF ATP synthase subunit b Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B2HQK6 1.3e-08 54 25 0 133 3 atpF ATP synthase subunit b Mycobacterium marinum (strain ATCC BAA-535 / M)
Q57EX8 1.65e-08 54 38 2 114 3 atpF ATP synthase subunit b Brucella abortus biovar 1 (strain 9-941)
Q8G2D9 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella suis biovar 1 (strain 1330)
B0CK72 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VNW4 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M8G0 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YMC5 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella abortus (strain 2308)
B2S9N0 1.65e-08 54 38 2 114 3 atpF1 ATP synthase subunit b 1 Brucella abortus (strain S19)
Q8YFH7 1.68e-08 54 38 2 114 3 atpF ATP synthase subunit b Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
B1MLV9 1.75e-08 55 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
B1YMR8 1.83e-08 54 30 3 141 3 atpF ATP synthase subunit b Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A9KK96 2.36e-08 53 27 4 158 3 atpF ATP synthase subunit b Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q3Z8Z6 2.56e-08 53 25 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A0PUK4 3.13e-08 53 25 0 141 3 atpF ATP synthase subunit b Mycobacterium ulcerans (strain Agy99)
Q4G3A0 3.38e-08 53 29 3 151 3 atpF2 ATP synthase subunit b', chloroplastic Emiliania huxleyi
Q3ZZU1 4.23e-08 53 25 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain CBDB1)
A5FRQ1 4.23e-08 53 25 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
P80285 4.92e-08 53 32 1 151 1 atpF ATP synthase subunit b Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
B1VFY3 5.7e-08 52 29 1 151 3 atpF ATP synthase subunit b Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B2G687 6.26e-08 52 25 2 149 3 atpF ATP synthase subunit b Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIQ7 6.26e-08 52 25 2 149 3 atpF ATP synthase subunit b Limosilactobacillus reuteri (strain DSM 20016)
Q04G24 7.54e-08 52 24 2 149 3 atpF ATP synthase subunit b Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B0SLC4 7.65e-08 52 26 2 154 3 atpF ATP synthase subunit b Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDA1 7.65e-08 52 26 2 154 3 atpF ATP synthase subunit b Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B0JWU9 8.28e-08 52 27 1 157 3 atpF ATP synthase subunit b Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0RDB0 9.71e-08 52 30 2 155 3 atpF ATP synthase subunit b Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A4XAW6 1.01e-07 52 32 1 146 3 atpF ATP synthase subunit b Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
P9WPV5 1.04e-07 52 24 1 129 1 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPV4 1.04e-07 52 24 1 129 3 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U205 1.04e-07 52 24 1 129 3 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KI94 1.04e-07 52 24 1 129 3 atpF ATP synthase subunit b Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P63657 1.04e-07 52 24 1 129 3 atpF ATP synthase subunit b Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P26681 1.5e-07 51 22 1 154 3 atpF ATP synthase subunit b Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
A4QDG9 1.8e-07 51 27 1 151 3 atpF ATP synthase subunit b Corynebacterium glutamicum (strain R)
Q3B400 1.81e-07 52 27 2 128 3 atpF1 ATP synthase subunit b 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q79VG9 1.86e-07 51 27 1 151 3 atpF ATP synthase subunit b Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7V034 2.69e-07 50 28 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A8G6V4 3.33e-07 50 28 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9215)
Q2J6M9 3.52e-07 50 29 2 155 3 atpF ATP synthase subunit b Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q180X1 4e-07 50 24 0 129 3 atpF ATP synthase subunit b Clostridioides difficile (strain 630)
Q40608 4.27e-07 50 28 0 138 3 atpF2 ATP synthase subunit b', chloroplastic Ochrosphaera neapolitana
A7G9Q5 4.75e-07 50 24 3 137 3 atpF ATP synthase subunit b Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE30 4.75e-07 50 24 3 137 3 atpF ATP synthase subunit b Clostridium botulinum (strain Okra / Type B1)
B4U2D7 5e-07 50 23 3 155 3 atpF ATP synthase subunit b Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A6LJR5 5.42e-07 50 26 0 153 3 atpF ATP synthase subunit b Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B2TJZ6 5.71e-07 49 21 0 152 3 atpF ATP synthase subunit b Clostridium botulinum (strain Eklund 17B / Type B)
B2UZJ6 5.71e-07 49 21 0 152 3 atpF ATP synthase subunit b Clostridium botulinum (strain Alaska E43 / Type E3)
B2GAU1 5.84e-07 50 24 2 154 3 atpF ATP synthase subunit b Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A5HY48 5.89e-07 49 24 3 137 3 atpF ATP synthase subunit b Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQH5 5.89e-07 49 24 3 137 3 atpF ATP synthase subunit b Clostridium botulinum (strain ATCC 19397 / Type A)
B1KSS4 6.39e-07 49 24 3 137 3 atpF ATP synthase subunit b Clostridium botulinum (strain Loch Maree / Type A3)
P37814 6.63e-07 49 30 2 133 1 atpF ATP synthase subunit b Bacillus subtilis (strain 168)
A7Z9Q4 6.7e-07 49 30 2 133 3 atpF ATP synthase subunit b Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8M2J7 7.18e-07 49 30 1 146 3 atpF ATP synthase subunit b Salinispora arenicola (strain CNS-205)
Q8EWZ2 7.87e-07 50 25 5 162 3 atpF ATP synthase subunit b Malacoplasma penetrans (strain HF-2)
Q9PR09 8.14e-07 50 26 2 152 3 atpF ATP synthase subunit b Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIC4 8.14e-07 50 26 2 152 3 atpF ATP synthase subunit b Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q7UFB9 9.73e-07 50 31 5 130 3 atpF2 ATP synthase subunit b 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A2BYH9 9.88e-07 48 27 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9515)
A9NGW6 1.18e-06 49 23 2 160 3 atpF ATP synthase subunit b Acholeplasma laidlawii (strain PG-8A)
A1R7V6 1.19e-06 49 30 1 146 3 atpF ATP synthase subunit b Paenarthrobacter aurescens (strain TC1)
A8Z5R3 1.43e-06 49 29 1 149 3 atpF ATP synthase subunit b Karelsulcia muelleri (strain GWSS)
P47643 1.49e-06 49 20 0 151 3 atpF ATP synthase subunit b Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q6F206 1.59e-06 48 25 3 164 3 atpF ATP synthase subunit b Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A3PEU2 2.04e-06 48 27 1 142 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9301)
A0R204 2.09e-06 48 24 0 142 1 atpF ATP synthase subunit b Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A4T8K9 2.78e-06 48 26 0 138 3 atpF ATP synthase subunit b Mycolicibacterium gilvum (strain PYR-GCK)
A2BT28 2.89e-06 47 27 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain AS9601)
B2J056 3.27e-06 48 32 4 148 3 atpF ATP synthase subunit b Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7NCS0 3.63e-06 47 32 6 152 3 atpF2 ATP synthase subunit b' Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B4S7A0 4.43e-06 48 26 1 118 3 atpF1 ATP synthase subunit b 1 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B1WXB2 5.03e-06 48 28 3 133 3 atpF3 ATP synthase subunit b 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
A8FIB6 7.38e-06 47 29 0 128 3 atpF ATP synthase subunit b Bacillus pumilus (strain SAFR-032)
B1WUI0 1.17e-05 46 28 1 154 3 atpF1 ATP synthase subunit b 1 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2JIF8 1.24e-05 46 27 3 144 3 atpF ATP synthase subunit b Synechococcus sp. (strain JA-2-3B'a(2-13))
B6IQS5 1.28e-05 47 26 3 156 3 atpF1 ATP synthase subunit b 1 Rhodospirillum centenum (strain ATCC 51521 / SW)
B1XHZ0 1.28e-05 46 30 6 171 3 atpF1 ATP synthase subunit b 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q6NHT3 1.41e-05 46 29 1 151 3 atpF ATP synthase subunit b Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B1XHZ1 1.59e-05 45 32 4 147 3 atpF2 ATP synthase subunit b' Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q04ZU1 1.92e-05 45 25 2 138 3 atpF ATP synthase subunit b Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S14 1.92e-05 45 25 2 138 3 atpF ATP synthase subunit b Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q98QU1 2.37e-05 45 25 2 148 3 atpF ATP synthase subunit b Mycoplasmopsis pulmonis (strain UAB CTIP)
Q7UH06 2.7e-05 45 24 3 162 3 atpF1 ATP synthase subunit b 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q6B8R1 3.18e-05 45 25 2 133 3 atpF2 ATP synthase subunit b', chloroplastic Gracilaria tenuistipitata var. liui
Q318T8 3.69e-05 44 26 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9312)
A6VWQ5 3.91e-05 45 28 5 143 3 atpF1 ATP synthase subunit b 1 Marinomonas sp. (strain MWYL1)
A1TD59 4.09e-05 44 23 0 142 3 atpF ATP synthase subunit b Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q73X55 4.15e-05 45 25 0 133 3 atpF ATP synthase subunit b Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15155
Feature type CDS
Gene atpF
Product F0F1 ATP synthase subunit B
Location 3362997 - 3363467 (strand: 1)
Length 471 (nucleotides) / 156 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2068
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00430 ATP synthase B/B' CF(0)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0711 Energy production and conversion (C) C FoF1-type ATP synthase, membrane subunit b or b'

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02109 F-type H+-transporting ATPase subunit b Oxidative phosphorylation
Photosynthesis
Metabolic pathways		 F-type ATPase, prokaryotes and chloroplasts

Protein Sequence

MNLNATILGQAIAFVLFVLFCMKYVWPPIMAAIEKRQKEIADGLSSAERAKKDLDLAKADAGEQLAKAKAEAQAIIESANKQRTQMIEEAKAEAEQERSKIVAQAQSELEAERKRAREELRKQVAMLAIAGAEKIIERSVDEAANSDIVDKLVAEL

Flanking regions ( +/- flanking 50bp)

AGCAGTAAAAACATCAAGTTAGTTAATAACCAAGAAAGAGGTATTGTGCTGTGAATTTAAATGCAACAATCCTCGGCCAGGCCATCGCATTTGTCCTGTTTGTTTTGTTCTGCATGAAATATGTATGGCCACCAATTATGGCGGCCATTGAAAAACGTCAAAAAGAAATTGCTGACGGTTTATCTTCTGCAGAACGTGCGAAAAAGGACTTAGATTTAGCGAAAGCCGATGCAGGCGAACAGTTAGCGAAAGCAAAAGCTGAAGCACAAGCAATCATTGAGTCTGCGAATAAACAACGCACTCAAATGATTGAAGAAGCTAAAGCTGAAGCAGAGCAAGAACGTAGTAAGATCGTTGCACAAGCTCAATCCGAATTGGAAGCAGAGCGTAAACGTGCTCGTGAAGAACTTCGTAAACAAGTCGCTATGCTGGCTATCGCTGGTGCCGAGAAAATTATTGAACGTTCCGTGGATGAAGCTGCTAATAGCGACATCGTTGATAAACTGGTCGCTGAACTGTAAGGAGGGAGGGGCATGTCTGAAATAGCAACGGTAGCTCGCCCCTACGCCAA